Starting /dee2/code/volunteer_pipeline.sh SRR11389870 current disk space = 1544498970624 free memory = 1601959064 SRR11389870 SRAfilesize fa07114d1c709b686b8b60c6b10e246f SRR11389870.sra SRR11389870.sra file validated SRR11389870 is paired end SRR11389870 is conventional basespace SRR11389870 read1 length is 42-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389870_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 42-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2545 32.0 32.0 32.0 32.0 32.0 2 31.35325 32.0 32.0 32.0 32.0 32.0 3 31.108 32.0 32.0 32.0 32.0 32.0 4 31.374 32.0 32.0 32.0 32.0 32.0 5 31.4305 32.0 32.0 32.0 32.0 32.0 6 34.1085 36.0 36.0 36.0 32.0 36.0 7 34.3565 36.0 36.0 36.0 32.0 36.0 8 34.30175 36.0 36.0 36.0 32.0 36.0 9 34.3555 36.0 36.0 36.0 32.0 36.0 10-11 34.295375 36.0 36.0 36.0 32.0 36.0 12-13 34.39275 36.0 36.0 36.0 32.0 36.0 14-15 34.256249999999994 36.0 36.0 36.0 32.0 36.0 16-17 34.32275 36.0 36.0 36.0 32.0 36.0 18-19 34.1065 36.0 36.0 36.0 32.0 36.0 20-21 34.056875000000005 36.0 36.0 36.0 32.0 36.0 22-23 33.974875 36.0 36.0 36.0 32.0 36.0 24-25 33.819500000000005 36.0 36.0 36.0 32.0 36.0 26-27 33.718500000000006 36.0 36.0 36.0 32.0 36.0 28-29 33.560125 36.0 36.0 36.0 29.5 36.0 30-31 33.515 36.0 36.0 36.0 27.0 36.0 32-33 33.545874999999995 36.0 36.0 36.0 27.0 36.0 34-35 33.522625 36.0 36.0 36.0 29.5 36.0 36-37 33.31525 36.0 36.0 36.0 24.0 36.0 38-39 33.303375 36.0 36.0 36.0 24.0 36.0 40-41 33.291125 36.0 36.0 36.0 27.0 36.0 42-43 33.19629591772943 36.0 34.0 36.0 20.5 36.0 44-45 33.126344758568926 36.0 36.0 36.0 21.0 36.0 46-47 33.135544430538175 36.0 36.0 36.0 20.5 36.0 48-49 32.67776664997496 36.0 36.0 36.0 14.0 36.0 50-51 32.976214321482225 36.0 36.0 36.0 17.5 36.0 52-53 32.75081392436765 36.0 36.0 36.0 14.0 36.0 54-55 32.677900275620146 36.0 34.0 36.0 14.0 36.0 56-57 32.86757704835881 36.0 32.0 36.0 14.0 36.0 58-59 32.71354171572756 36.0 34.0 36.0 14.0 36.0 60-61 32.18972431077694 36.0 32.0 36.0 14.0 36.0 62-63 31.92742541990474 36.0 32.0 36.0 14.0 36.0 64-65 32.01918254764293 36.0 32.0 36.0 14.0 36.0 66-67 31.632397191574725 36.0 32.0 36.0 14.0 36.0 68-69 31.428123432012043 36.0 32.0 36.0 14.0 36.0 70-71 31.560322762734028 36.0 32.0 36.0 14.0 36.0 72-73 31.486339719734335 36.0 32.0 36.0 14.0 36.0 74-75 31.07299181222688 36.0 29.5 36.0 14.0 36.0 76 29.97666905958363 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 3.0 24 8.0 25 10.0 26 34.0 27 59.0 28 103.0 29 175.0 30 258.0 31 366.0 32 575.0 33 810.0 34 1173.0 35 422.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.325 10.225 9.425 44.025 2 27.425 10.6 39.825 22.15 3 25.650000000000002 16.375 20.825 37.15 4 32.4 22.0 18.275 27.325 5 29.599999999999998 26.075 22.325 22.0 6 24.156171284634762 28.866498740554157 24.181360201511335 22.79596977329975 7 18.025 22.8 37.225 21.95 8 20.974999999999998 21.025 30.725 27.275 9 20.45 18.25 33.575 27.725 10-11 25.224999999999998 27.775 21.9 25.1 12-13 25.724999999999998 21.425 23.674999999999997 29.175 14-15 24.925 23.375 24.75 26.950000000000003 16-17 26.237500000000004 22.787499999999998 23.6375 27.3375 18-19 24.837500000000002 23.1375 23.575 28.449999999999996 20-21 25.724999999999998 23.2375 24.9875 26.05 22-23 25.974999999999998 23.6375 24.224999999999998 26.1625 24-25 25.0 24.1375 22.6125 28.249999999999996 26-27 25.324999999999996 23.6125 23.7625 27.3 28-29 26.0 23.7375 23.7625 26.5 30-31 25.324999999999996 23.200000000000003 23.6375 27.8375 32-33 25.137500000000003 23.724999999999998 23.775 27.3625 34-35 25.0375 23.5625 25.025 26.375 36-37 25.650000000000002 23.775 24.125 26.450000000000003 38-39 24.3125 23.9375 23.625 28.125 40-41 25.868967241810452 22.893223305826456 24.043510877719427 27.19429857464366 42-43 25.83187390542907 22.95471603702777 23.204903677758317 28.008506379784837 44-45 25.572375828850248 22.294507694232454 24.934317527836857 27.198798949080444 46-47 26.207759699624532 22.878598247809762 22.81602002503129 28.09762202753442 48-49 25.43815723585378 23.059589384076116 23.97346019028543 27.52879318978468 50-51 25.7135703555333 23.072108162243367 24.01101652478718 27.203304957436153 52-53 25.97044828449787 23.002754820936637 23.328324567993988 27.698472326571498 54-55 25.256827862691054 23.390127787521926 23.402655975945876 27.950388373841147 56-57 24.79328489100476 23.12703583061889 24.968679528940115 27.110999749436232 58-59 25.924069665455455 22.57862423255231 23.831600050119032 27.6657060518732 60-61 26.453634085213036 22.531328320802004 23.759398496240603 27.25563909774436 62-63 24.818250188017046 23.126096766106794 24.05364753070945 28.002005515166704 64-65 27.557673019057173 21.70260782347041 23.746238716148447 26.993480441323968 66-67 26.35406218655968 22.166499498495487 23.44533600802407 28.03410230692076 68-69 25.639739086803814 23.09332664325138 23.595082789764174 27.67185148018063 70-71 26.286718553853877 23.612854632186796 23.462214411247803 26.638212402711524 72-73 26.04967847686294 22.92270835960156 23.20010087000378 27.827512293531708 74-75 26.41359171754712 20.135386249004515 24.993363419166446 28.45765861428192 76 28.14070351758794 0.0 31.26346015793252 40.59583632447954 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 2.0 23 1.5 24 1.5 25 4.0 26 3.5 27 4.5 28 7.5 29 8.0 30 11.0 31 13.5 32 16.0 33 27.0 34 36.5 35 49.5 36 62.5 37 68.0 38 85.5 39 107.5 40 123.0 41 142.0 42 153.0 43 175.0 44 196.5 45 188.5 46 184.0 47 186.5 48 194.0 49 195.5 50 186.5 51 165.0 52 141.5 53 144.5 54 150.0 55 139.0 56 135.0 57 141.5 58 134.0 59 116.5 60 111.5 61 115.0 62 119.0 63 111.5 64 107.5 65 115.5 66 111.5 67 99.5 68 90.0 69 83.0 70 75.5 71 71.5 72 63.0 73 46.0 74 42.5 75 46.5 76 42.0 77 37.0 78 27.0 79 17.5 80 13.0 81 10.5 82 9.5 83 9.0 84 8.5 85 5.0 86 2.0 87 0.5 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.75 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.025 42-43 0.06250781347668459 44-45 0.012509382036527395 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 42 1.0 43 2.0 44 0.0 45 2.0 46 0.0 47 1.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 2.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 1.0 62 0.0 63 1.0 64 0.0 65 0.0 66 0.0 67 2.0 68 0.0 69 1.0 70 4.0 71 5.0 72 21.0 73 66.0 74 244.0 75 859.0 76 2786.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3193849256365 98.5 2 0.5545752457776657 1.0999999999999999 3 0.10083186286866651 0.3 4 0.025207965717166627 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389870 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389870_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.913 32.0 32.0 32.0 32.0 32.0 2 30.7215 32.0 32.0 32.0 32.0 32.0 3 30.456 32.0 32.0 32.0 32.0 32.0 4 30.4805 32.0 32.0 32.0 32.0 32.0 5 30.6455 32.0 32.0 32.0 32.0 32.0 6 33.6685 36.0 36.0 36.0 32.0 36.0 7 33.86775 36.0 36.0 36.0 32.0 36.0 8 33.86 36.0 36.0 36.0 32.0 36.0 9 33.69375 36.0 36.0 36.0 32.0 36.0 10-11 33.69925 36.0 36.0 36.0 32.0 36.0 12-13 33.722875 36.0 36.0 36.0 32.0 36.0 14-15 33.592875 36.0 36.0 36.0 32.0 36.0 16-17 33.539625 36.0 36.0 36.0 32.0 36.0 18-19 33.362375 36.0 36.0 36.0 24.0 36.0 20-21 33.3755 36.0 36.0 36.0 27.0 36.0 22-23 33.380875 36.0 36.0 36.0 27.0 36.0 24-25 33.2395 36.0 36.0 36.0 24.0 36.0 26-27 33.265625 36.0 36.0 36.0 21.0 36.0 28-29 33.223375000000004 36.0 36.0 36.0 17.5 36.0 30-31 33.0795 36.0 36.0 36.0 17.5 36.0 32-33 33.02375 36.0 36.0 36.0 17.5 36.0 34-35 32.964625 36.0 36.0 36.0 14.0 36.0 36-37 32.721874216988226 36.0 36.0 36.0 14.0 36.0 38-39 32.71272863943874 36.0 36.0 36.0 14.0 36.0 40-41 32.62869674185464 36.0 34.0 36.0 14.0 36.0 42-43 32.658822695997955 36.0 34.0 36.0 14.0 36.0 44-45 32.3882618510158 36.0 34.0 36.0 14.0 36.0 46-47 32.496738585047666 36.0 36.0 36.0 14.0 36.0 48-49 32.555834378920956 36.0 36.0 36.0 14.0 36.0 50-51 32.10313676286073 36.0 32.0 36.0 14.0 36.0 52-53 31.92233375156838 36.0 32.0 36.0 14.0 36.0 54-55 31.93911624403716 36.0 32.0 36.0 14.0 36.0 56-57 31.957820738137084 36.0 32.0 36.0 14.0 36.0 58-59 31.536973214766476 36.0 32.0 36.0 14.0 36.0 60-61 31.39791562029131 36.0 32.0 36.0 14.0 36.0 62-63 31.231348907309723 36.0 32.0 36.0 14.0 36.0 64-65 31.288190954773867 36.0 32.0 36.0 14.0 36.0 66-67 30.95175879396985 36.0 32.0 36.0 14.0 36.0 68-69 30.979889391654098 36.0 32.0 36.0 14.0 36.0 70-71 30.944334252262696 36.0 29.5 36.0 14.0 36.0 72-73 30.60527190906739 36.0 27.0 36.0 14.0 36.0 74-75 30.957462309858542 36.0 27.0 36.0 14.0 36.0 76 29.428001450852374 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 3.0 5 3.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 2.0 12 0.0 13 1.0 14 3.0 15 6.0 16 3.0 17 3.0 18 4.0 19 5.0 20 4.0 21 5.0 22 15.0 23 12.0 24 23.0 25 43.0 26 65.0 27 102.0 28 124.0 29 232.0 30 276.0 31 355.0 32 504.0 33 783.0 34 1016.0 35 397.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.928768497617256 20.065211938801102 8.828693253072485 39.17732631050915 2 29.470780035114117 23.225482819162277 29.897165788813645 17.406571356909957 3 25.263421976919215 26.894129453085803 19.49322629202208 28.349222277972906 4 28.410230692076226 31.795386158475424 16.72517552657974 23.069207622868607 5 30.869456276622397 30.66900526183914 18.16587321473315 20.29566524680531 6 25.0814332247557 33.324981207717364 19.19318466549737 22.400400902029567 7 22.86287290047631 16.47029330659313 32.31386312358987 28.35297066934069 8 24.197592778335007 20.837512537612838 24.523570712136408 30.441323971915747 9 24.949799196787147 20.55722891566265 25.727911646586342 28.76506024096386 10-11 27.928607340372047 26.7219708396179 19.130216189039718 26.21920563097034 12-13 27.206437012823738 21.184309781242142 22.743273824490824 28.865979381443296 14-15 27.10926694329184 23.563435181692444 23.035332578901045 26.29196529611467 16-17 27.926568590469003 22.670690305545076 22.04199673079341 27.360744373192507 18-19 27.624795674588203 22.444360618634477 22.708411920030176 27.22243178674714 20-21 27.055569524767414 24.339954739753583 22.026653256223284 26.57782247925572 22-23 28.614533568016093 23.082725672617553 21.47347246668343 26.82926829268293 24-25 26.587052168447517 23.871778755499687 22.036455059710875 27.504714016341925 26-27 27.095639059947217 23.51388714339575 22.784969209501067 26.605504587155966 28-29 27.56281407035176 24.334170854271356 21.620603015075375 26.482412060301506 30-31 27.352682497801233 23.30694810905893 22.942580726221887 26.397788666917954 32-33 27.292137653855814 24.403416227078623 22.770660638030645 25.533785481034915 34-35 27.977386934673365 23.178391959798994 22.36180904522613 26.482412060301506 36-37 27.183611914037954 23.28767123287671 22.043483725021993 27.485233128063342 38-39 27.5216681321442 24.192940585353597 22.23338776535611 26.052003517146087 40-41 28.1246074613742 23.162919231252353 21.894234392664238 26.81823891470921 42-43 27.13226981534983 24.155256877276724 22.195704057279237 26.516769250094207 44-45 28.361212426109923 23.468746069676772 22.261350773487614 25.9086907307257 46-47 27.480820022638664 23.5693623443592 22.11042636146397 26.839391271538172 48-49 27.24302588590098 23.573762251822068 22.21663734606685 26.966574516210102 50-51 28.156438631790742 23.717303822937627 22.208249496981892 25.918008048289735 52-53 27.18471017226204 24.00352068401861 22.11743995976361 26.69432918395574 54-55 27.846347607052895 23.803526448362717 22.103274559193956 26.24685138539043 56-57 27.40899357601713 23.667968257966997 22.16903892177856 26.75399924423731 58-59 27.686106562539365 23.59239198891548 22.269807280513916 26.45169416803124 60-61 27.176515056066524 23.6361345596573 22.237621267481416 26.949729116794757 62-63 27.766574237459036 23.733299722712378 21.792286362490547 26.70783967733804 64-65 27.341484936341864 24.06403630404639 22.261439556283875 26.333039203327868 66-67 27.11351896182437 23.598336903112006 21.98563689051279 27.30250724455084 68-69 26.92598187311178 24.786002014098692 22.922960725075527 25.365055387713998 70-71 27.894670530427113 22.691193146024947 22.250220486329848 27.163915837218095 72-73 27.50411548689376 23.64188932506015 22.046346713942004 26.80764847410409 74-75 27.806054111974284 20.372354674524512 24.765604071792126 27.055987141709082 76 29.28779069767442 0.0 31.90406976744186 38.80813953488372 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 9.0 1 4.5 2 0.5 3 1.0 4 1.0 5 1.0 6 1.0 7 2.0 8 3.0 9 2.5 10 1.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 2.0 18 2.5 19 1.0 20 0.5 21 1.0 22 1.5 23 2.5 24 2.0 25 1.0 26 2.5 27 3.5 28 5.5 29 8.0 30 12.5 31 17.0 32 18.5 33 19.0 34 29.0 35 46.0 36 52.5 37 57.5 38 75.0 39 97.5 40 114.5 41 135.0 42 150.5 43 161.5 44 167.5 45 167.0 46 168.5 47 181.0 48 181.0 49 178.0 50 183.5 51 160.5 52 140.5 53 135.5 54 131.5 55 136.0 56 134.0 57 132.5 58 135.5 59 138.0 60 150.5 61 144.0 62 128.0 63 114.5 64 107.5 65 111.0 66 115.5 67 120.0 68 101.5 69 82.5 70 80.0 71 81.0 72 82.0 73 71.5 74 59.5 75 56.0 76 49.0 77 37.0 78 25.5 79 19.0 80 17.5 81 12.0 82 7.5 83 7.5 84 5.5 85 2.5 86 0.5 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 3.5 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.325 3 0.35000000000000003 4 0.3 5 0.22499999999999998 6 0.22499999999999998 7 0.27499999999999997 8 0.3 9 0.4 10-11 0.5499999999999999 12-13 0.575 14-15 0.5875 16-17 0.5875 18-19 0.5875 20-21 0.575 22-23 0.575 24-25 0.5625 26-27 0.5375 28-29 0.5 30-31 0.5125000000000001 32-33 0.475 34-35 0.5 36-37 0.31320471059884736 38-39 0.26309195690303183 40-41 0.2380952380952381 42-43 0.22559217947111165 44-45 0.28843742162026587 46-47 0.26342197691921726 48-49 0.150564617314931 50-51 0.2258469259723965 52-53 0.2132998745294856 54-55 0.3263871453678132 56-57 0.3389404971127291 58-59 0.32642812303829255 60-61 0.3390256152687092 62-63 0.35167043456417985 64-65 0.33919597989949746 66-67 0.2889447236180904 68-69 0.1508295625942685 70-71 0.15096238520568625 72-73 0.139099645928174 74-75 0.14711782800588472 76 0.18135654697134565 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 9.0 36 0.0 37 0.0 38 0.0 39 1.0 40 0.0 41 0.0 42 1.0 43 2.0 44 0.0 45 1.0 46 0.0 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 2.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 1.0 62 0.0 63 1.0 64 0.0 65 0.0 66 0.0 67 2.0 68 0.0 69 1.0 70 5.0 71 7.0 72 22.0 73 70.0 74 269.0 75 847.0 76 2757.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0628166160081 97.775 2 0.8611955420466059 1.7000000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.050658561296859174 0.3 7 0.0 0.0 8 0.0 0.0 9 0.025329280648429587 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660904 spots for SRR11389870.sra Written 1660904 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra Read 1660898 spots for SRR11389870.sra Written 1660898 spots for SRR11389870.sra SRR ids: ['SRR11389870.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jdudas8n SRR11389870.sra spots: 33217966 blocks: [[1, 1660898], [1660899, 3321796], [3321797, 4982694], [4982695, 6643592], [6643593, 8304490], [8304491, 9965388], [9965389, 11626286], [11626287, 13287184], [13287185, 14948082], [14948083, 16608980], [16608981, 18269878], [18269879, 19930776], [19930777, 21591674], [21591675, 23252572], [23252573, 24913470], [24913471, 26574368], [26574369, 28235266], [28235267, 29896164], [29896165, 31557062], [31557063, 33217966]] SRR11389870 file size 6336910 SRR11389870 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389870 SRR11389870_1.fastq SRR11389870_2.fastq Input file: SRR11389870_1.fastq Paired file: SRR11389870_2.fastq trimmed: SRR11389870-trimmed-pair1.fastq, SRR11389870-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:43:51 2024 >> started Sat Dec 7 08:44:20 2024 >> done (28.656s) 33217966 read pairs processed; of these: 254 ( 0.00%) short read pairs filtered out after trimming by size control 48201 ( 0.15%) empty read pairs filtered out after trimming by size control 33169511 (99.85%) read pairs available; of these: 11887 ( 0.04%) trimmed read pairs available after processing 33157624 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 3 0.00% 22 7 0.00% 23 7 0.00% 24 9 0.00% 25 13 0.00% 26 12 0.00% 27 14 0.00% 28 22 0.00% 29 21 0.00% 30 30 0.00% 31 24 0.00% 32 26 0.00% 33 30 0.00% 34 27 0.00% 35 735 0.00% 36 812 0.00% 37 895 0.00% 38 925 0.00% 39 1145 0.00% 40 1292 0.00% 41 1494 0.00% 42 1663 0.01% 43 1798 0.01% 44 1878 0.01% 45 2025 0.01% 46 2074 0.01% 47 2141 0.01% 48 2360 0.01% 49 2609 0.01% 50 2794 0.01% 51 2983 0.01% 52 3257 0.01% 53 3657 0.01% 54 3905 0.01% 55 4243 0.01% 56 4470 0.01% 57 4859 0.01% 58 5211 0.02% 59 5651 0.02% 60 5928 0.02% 61 6217 0.02% 62 6801 0.02% 63 7539 0.02% 64 8103 0.02% 65 8749 0.03% 66 9365 0.03% 67 10419 0.03% 68 10130 0.03% 69 11316 0.03% 70 13300 0.04% 71 16981 0.05% 72 37744 0.11% 73 269080 0.81% 74 2225703 6.71% 75 14240090 42.93% 76 16216916 48.89% 33169511 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=11 prefix-density=0.50 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=241.66 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=21.1 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.96 fanout-score-rank=12 prefix-density=0.40 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.14 sequence-density-rank=24 fanout-score=146.47 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=25.1 sequence=CGGCGGCGGCGCC SRR11389870 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:44:55 Started mapping on | Dec 07 08:44:55 Finished on | Dec 07 08:46:55 Mapping speed, Million of reads per hour | 995.09 Number of input reads | 33169511 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 30961434 Uniquely mapped reads % | 93.34% Average mapped length | 150.16 Number of splices: Total | 14756557 Number of splices: Annotated (sjdb) | 14114043 Number of splices: GT/AG | 14543178 Number of splices: GC/AG | 188923 Number of splices: AT/AC | 5311 Number of splices: Non-canonical | 19145 Mismatch rate per base, % | 0.87% Deletion rate per base | 0.01% Deletion average length | 1.70 Insertion rate per base | 0.00% Insertion average length | 1.96 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1061152 % of reads mapped to multiple loci | 3.20% Number of reads mapped to too many loci | 59768 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1146925 1146925 1146925 N_multimapping 1061152 1061152 1061152 N_noFeature 778907 30212039 978657 N_ambiguous 693870 3606 147846 UnstrandedReadsAssigned:29488657 PositiveStrandReadsAssigned:745789 NegativeStrandReadsAssigned:29834931 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389870 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389870-trimmed-pair1.fastq SRR11389870-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,169,511 reads, 30,540,003 reads pseudoaligned [quant] estimated average fragment length: 202.587 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52973 SRR11389870.ke.tsv 35125 SRR11389870.se.tsv 88098 total ==> SRR11389870.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 734.692 0.000208184 1.26098e-05 PNS24247 1044 842.413 77.339 4.08545 PNS24249 1928 1726.41 313.68 8.08554 PNS24246 1044 842.413 77.339 4.08545 PNS24248 1044 842.413 77.339 4.08545 PNS24244 1471 1269.41 56.3025 1.97375 PNS24243 293 109.886 0 0 KQK14069 1603 1401.41 15182.1 482.094 KQK14071 474 275.115 613.119 99.1737 ==> SRR11389870.se.tsv <== BRADI_1g14170v3 16201 BRADI_1g53295v3 24 BRADI_1g59795v3 379 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 292 BRADI_1g74790v3 573 BRADI_1g09890v3 0 BRADI_1g77505v3 442 BRADI_1g48960v3 0 SRR11389870 completed mapping pipeline successfully