Starting /dee2/code/volunteer_pipeline.sh SRR11389871 current disk space = 1544515227648 free memory = 1601619680 SRR11389871 SRAfilesize 16d610f484809eee3b594226816ab1d9 SRR11389871.sra SRR11389871.sra file validated SRR11389871 is paired end SRR11389871 is conventional basespace SRR11389871 read1 length is 40-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389871_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 40-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2555 32.0 32.0 32.0 32.0 32.0 2 31.2515 32.0 32.0 32.0 32.0 32.0 3 31.14325 32.0 32.0 32.0 32.0 32.0 4 31.332 32.0 32.0 32.0 32.0 32.0 5 31.433 32.0 32.0 32.0 32.0 32.0 6 34.23675 36.0 36.0 36.0 32.0 36.0 7 34.42325 36.0 36.0 36.0 32.0 36.0 8 34.34775 36.0 36.0 36.0 32.0 36.0 9 34.50575 36.0 36.0 36.0 32.0 36.0 10-11 34.3425 36.0 36.0 36.0 32.0 36.0 12-13 34.204625 36.0 36.0 36.0 32.0 36.0 14-15 34.177875 36.0 36.0 36.0 32.0 36.0 16-17 34.167 36.0 36.0 36.0 32.0 36.0 18-19 34.079 36.0 36.0 36.0 32.0 36.0 20-21 34.062 36.0 36.0 36.0 32.0 36.0 22-23 33.856375 36.0 36.0 36.0 32.0 36.0 24-25 33.887 36.0 36.0 36.0 32.0 36.0 26-27 33.60625 36.0 36.0 36.0 29.5 36.0 28-29 33.5275 36.0 36.0 36.0 27.0 36.0 30-31 33.560125 36.0 36.0 36.0 27.0 36.0 32-33 33.537875 36.0 36.0 36.0 27.0 36.0 34-35 33.498625 36.0 36.0 36.0 27.0 36.0 36-37 33.364000000000004 36.0 36.0 36.0 27.0 36.0 38-39 33.395125 36.0 36.0 36.0 27.0 36.0 40-41 33.40191382220556 36.0 36.0 36.0 27.0 36.0 42-43 33.19817454363591 36.0 36.0 36.0 24.0 36.0 44-45 33.095398849712424 36.0 34.0 36.0 17.5 36.0 46-47 33.190797699424856 36.0 36.0 36.0 20.5 36.0 48-49 32.75993998499625 36.0 36.0 36.0 14.0 36.0 50-51 32.67279319829957 36.0 34.0 36.0 14.0 36.0 52-53 32.65616404101026 36.0 34.0 36.0 14.0 36.0 54-55 32.71905476369092 36.0 34.0 36.0 17.5 36.0 56-57 32.715053763440864 36.0 32.0 36.0 14.0 36.0 58-59 32.5125523501936 36.0 32.0 36.0 14.0 36.0 60-61 32.10305152576288 36.0 32.0 36.0 14.0 36.0 62-63 32.108570015555685 36.0 32.0 36.0 14.0 36.0 64-65 31.81356791492518 36.0 32.0 36.0 14.0 36.0 66-67 31.672047047047045 36.0 32.0 36.0 14.0 36.0 68-69 31.647772772772772 36.0 32.0 36.0 14.0 36.0 70-71 31.480024695194558 36.0 32.0 36.0 14.0 36.0 72-73 31.444058451273 36.0 32.0 36.0 14.0 36.0 74-75 31.131318995666096 36.0 32.0 36.0 14.0 36.0 76 30.184814814814814 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 12.0 25 23.0 26 38.0 27 46.0 28 123.0 29 169.0 30 259.0 31 351.0 32 545.0 33 839.0 34 1185.0 35 408.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.949999999999996 10.875 9.6 43.575 2 26.35 10.725 39.6 23.325000000000003 3 25.3 16.900000000000002 20.625 37.175000000000004 4 30.725 23.974999999999998 18.25 27.05 5 28.549999999999997 27.150000000000002 23.400000000000002 20.9 6 25.17570281124498 29.14156626506024 23.268072289156628 22.414658634538153 7 16.8 23.95 37.9 21.349999999999998 8 19.15 21.825 32.7 26.325 9 21.224999999999998 20.05 32.25 26.474999999999998 10-11 24.962500000000002 28.037499999999998 22.975 24.025 12-13 24.2875 22.900000000000002 24.575 28.237499999999997 14-15 23.7875 25.074999999999996 25.4375 25.7 16-17 24.95 23.9375 24.1625 26.950000000000003 18-19 24.587500000000002 24.762500000000003 23.775 26.875 20-21 25.112499999999997 24.65 24.2625 25.974999999999998 22-23 25.6125 24.725 23.6875 25.974999999999998 24-25 24.9 24.175 23.7625 27.1625 26-27 25.05 23.400000000000002 24.5125 27.037499999999998 28-29 25.55 23.825 24.1125 26.5125 30-31 24.8 23.425 24.05 27.725 32-33 23.8375 23.9375 25.2875 26.937499999999996 34-35 25.525 23.9125 24.1125 26.450000000000003 36-37 26.187500000000004 23.474999999999998 24.1375 26.200000000000003 38-39 24.5 24.637500000000003 24.1125 26.75 40-41 26.19404851212803 23.618404601150285 23.85596399099775 26.331582895723933 42-43 25.59099437148218 23.927454659161977 24.015009380863038 26.46654158849281 44-45 24.559209703638864 24.259097161435538 24.421658121795673 26.760035013129922 46-47 24.85621405351338 24.193548387096776 24.88122030507627 26.069017254313575 48-49 25.531382845711427 23.69342335583896 23.668417104276067 27.106776694173547 50-51 25.29382345586397 23.10577644411103 24.63115778944736 26.969242310577645 52-53 25.29382345586397 23.53088272068017 24.318579644911228 26.85671417854464 54-55 25.656414103525883 24.118529632408105 23.243310827706924 26.981745436359088 56-57 25.693923480870218 23.95598899724931 23.43085771442861 26.91922980745186 58-59 25.847192697261473 24.096536201075402 23.40877829185945 26.647492809803673 60-61 25.025012506253123 23.574287143571787 23.861930965482742 27.538769384692348 62-63 25.853658536585368 23.20200125078174 24.702939337085677 26.241400875547217 64-65 25.672463405479796 23.93344176154135 24.471412485925185 25.922682347053673 66-67 25.650650650650654 23.235735735735734 23.86136136136136 27.25225225225225 68-69 26.05105105105105 23.41091091091091 24.16166166166166 26.376376376376378 70-71 26.205083260297986 23.951421059221232 23.538249655690496 26.305246024790286 72-73 25.122533618197814 23.765238155083573 23.06145532235767 28.050772904360937 74-75 25.6440745144669 20.795349451710926 24.573919936583433 28.98665609723874 76 28.677287884401633 0.0 31.863653204890703 39.45905891070767 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 2.0 21 2.0 22 1.0 23 0.0 24 1.0 25 2.0 26 2.5 27 6.5 28 11.0 29 11.0 30 13.5 31 20.0 32 27.0 33 35.5 34 44.0 35 51.5 36 63.0 37 78.0 38 94.5 39 116.5 40 132.5 41 158.5 42 191.0 43 197.5 44 204.5 45 214.0 46 223.5 47 217.0 48 187.5 49 171.0 50 166.5 51 163.0 52 146.5 53 140.5 54 137.0 55 129.0 56 135.0 57 132.0 58 121.5 59 124.5 60 121.0 61 117.5 62 127.5 63 115.5 64 90.0 65 86.0 66 88.0 67 84.5 68 83.0 69 74.0 70 62.5 71 55.0 72 46.5 73 41.5 74 42.5 75 38.5 76 34.5 77 28.0 78 21.0 79 21.5 80 19.0 81 10.5 82 6.0 83 5.5 84 3.0 85 1.5 86 2.0 87 2.0 88 1.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.4 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.012501562695336917 42-43 0.037509377344336084 44-45 0.012503125781445362 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.037037037037037035 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 1.0 65 0.0 66 0.0 67 0.0 68 0.0 69 2.0 70 1.0 71 9.0 72 11.0 73 56.0 74 265.0 75 952.0 76 2700.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26896899420217 98.45 2 0.6554071086463322 1.3 3 0.050415931434333254 0.15 4 0.025207965717166627 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389871 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389871_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.90625 32.0 32.0 32.0 32.0 32.0 2 30.5775 32.0 32.0 32.0 32.0 32.0 3 30.48525 32.0 32.0 32.0 32.0 32.0 4 30.577 32.0 32.0 32.0 32.0 32.0 5 30.5145 32.0 32.0 32.0 32.0 32.0 6 33.568 36.0 36.0 36.0 21.0 36.0 7 33.75425 36.0 36.0 36.0 32.0 36.0 8 33.7745 36.0 36.0 36.0 32.0 36.0 9 33.631 36.0 36.0 36.0 32.0 36.0 10-11 33.573499999999996 36.0 36.0 36.0 29.5 36.0 12-13 33.456500000000005 36.0 36.0 36.0 21.0 36.0 14-15 33.575 36.0 36.0 36.0 26.5 36.0 16-17 33.490625 36.0 36.0 36.0 21.0 36.0 18-19 33.29275 36.0 36.0 36.0 24.0 36.0 20-21 33.2695 36.0 36.0 36.0 21.0 36.0 22-23 33.230625 36.0 36.0 36.0 21.0 36.0 24-25 33.19025 36.0 36.0 36.0 24.0 36.0 26-27 33.145125 36.0 36.0 36.0 21.0 36.0 28-29 33.142624999999995 36.0 36.0 36.0 21.0 36.0 30-31 32.963875 36.0 36.0 36.0 14.0 36.0 32-33 32.898875000000004 36.0 36.0 36.0 14.0 36.0 34-35 32.79075 36.0 36.0 36.0 14.0 36.0 36-37 32.37515636727546 36.0 34.0 36.0 14.0 36.0 38-39 32.513635226419815 36.0 32.0 36.0 14.0 36.0 40-41 32.559357072967835 36.0 34.0 36.0 14.0 36.0 42-43 32.55882352941177 36.0 34.0 36.0 14.0 36.0 44-45 32.38247809762203 36.0 34.0 36.0 14.0 36.0 46-47 32.36082603254068 36.0 34.0 36.0 14.0 36.0 48-49 32.289612015018776 36.0 32.0 36.0 14.0 36.0 50-51 31.949311639549435 36.0 32.0 36.0 14.0 36.0 52-53 31.799499374217774 36.0 32.0 36.0 14.0 36.0 54-55 31.859198998748436 36.0 32.0 36.0 14.0 36.0 56-57 31.807509386733415 36.0 32.0 36.0 14.0 36.0 58-59 31.446232584170374 36.0 32.0 36.0 14.0 36.0 60-61 31.219704556835254 36.0 32.0 36.0 14.0 36.0 62-63 30.834743192926126 36.0 29.5 36.0 14.0 36.0 64-65 31.23605422088856 36.0 32.0 36.0 14.0 36.0 66-67 30.84944889779559 36.0 29.5 36.0 14.0 36.0 68-69 30.787668578198744 36.0 27.0 36.0 14.0 36.0 70-71 30.921961453791084 36.0 29.5 36.0 14.0 36.0 72-73 30.477796845990497 36.0 27.0 36.0 14.0 36.0 74-75 30.624480950498167 36.0 27.0 36.0 14.0 36.0 76 29.438441749356855 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 2.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 3.0 17 1.0 18 5.0 19 4.0 20 4.0 21 6.0 22 11.0 23 21.0 24 27.0 25 49.0 26 68.0 27 113.0 28 185.0 29 237.0 30 297.0 31 375.0 32 555.0 33 757.0 34 929.0 35 344.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.864831038798496 20.851063829787233 8.685857321652065 38.598247809762206 2 28.48560700876095 23.879849812265334 31.66458072590738 15.969962453066334 3 24.505632040050063 27.53441802252816 19.574468085106382 28.38548185231539 4 28.660826032540676 31.013767209011263 16.7459324155194 23.57947434292866 5 30.09757317988491 32.02401801351013 19.039279459594695 18.839129347010257 6 22.9672254190643 33.675256442331744 20.540405303977984 22.81711283462597 7 23.723723723723726 15.94094094094094 32.55755755755756 27.77777777777778 8 24.23028785982478 20.97622027534418 25.15644555694618 29.637046307884855 9 23.841723015276735 20.135236664162285 27.222639619333833 28.800400701227147 10-11 27.62250908635167 26.48201529013661 20.14036846722647 25.755107156285252 12-13 28.19902243388896 21.255796465722522 23.14826419350796 27.396916906880563 14-15 26.529588766298893 23.520561685055167 23.64593781344032 26.303911735205617 16-17 28.146940822467403 23.570712136409227 22.229187562688065 26.053159478435305 18-19 26.654964894684053 23.658475426278834 23.633400200601805 26.053159478435305 20-21 27.5827482447342 24.335506519558674 21.90320962888666 26.178535606820464 22-23 27.31945837512538 23.545636910732195 22.768304914744235 26.366599799398195 24-25 27.549486344274616 23.465296918065647 22.475570032573287 26.509646705086443 26-27 25.6140350877193 24.32330827067669 23.99749373433584 26.065162907268167 28-29 27.08594337258832 23.390127787521926 22.813831120020044 26.710097719869708 30-31 26.58814684876582 23.731361984713693 23.104874075930333 26.575617090590153 32-33 26.932230990855565 24.26406112990104 23.111612175873734 25.69209570336966 34-35 26.431166228234996 23.88826255793561 23.387197795315046 26.293373418514342 36-37 26.67919799498747 24.536340852130326 22.343358395989977 26.44110275689223 38-39 27.399148083187168 24.07917815083939 22.964169381107492 25.557504384865947 40-41 27.835568366963276 24.451685674896602 22.2208296779045 25.491916280235614 42-43 27.089337175792505 23.869189324646033 23.49329657937602 25.54817692018544 44-45 26.67335171722236 24.417147154675355 23.113562296314864 25.795938831787414 46-47 26.967418546365913 24.235588972431078 22.330827067669173 26.466165413533833 48-49 27.530060120240478 23.972945891783567 22.16933867735471 26.327655310621246 50-51 26.634928589325984 24.204460035078927 23.30243046855425 25.85818090704084 52-53 28.204485653426886 23.468237063024684 21.81430898383661 26.512968299711815 54-55 27.79937304075235 24.163009404388713 22.206896551724135 25.830721003134798 56-57 26.802055910743388 24.269775604863984 23.46746897329823 25.460699511094397 58-59 27.98193904427443 23.090430201931518 22.776871942806974 26.150758810987078 60-61 27.292110874200425 23.617208077260756 22.977549228646684 26.11313181989214 62-63 26.445866265211393 25.24150043909171 22.782586877430685 25.530046418266217 64-65 26.828962228635966 23.767097502823443 23.3278955954323 26.076044673108296 66-67 27.04804917827123 23.434951699912183 23.472588131978423 26.044410989838163 68-69 26.977560486398396 23.542685220007524 23.10392378087 26.37583051272408 70-71 27.884494664155678 22.686754551161332 23.15128688010044 26.27746390458255 72-73 26.7221801665405 23.959121877365632 23.088569265707797 26.230128690386074 74-75 26.86965811965812 21.327457264957264 24.39903846153846 27.403846153846157 76 28.58719646799117 0.0 32.33995584988962 39.0728476821192 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.5 3 1.0 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 1.0 10 1.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 1.5 24 2.0 25 2.5 26 2.0 27 6.0 28 10.5 29 9.0 30 10.0 31 12.5 32 22.5 33 36.0 34 37.5 35 48.0 36 61.0 37 73.0 38 94.0 39 109.0 40 123.5 41 146.0 42 165.5 43 167.5 44 179.0 45 192.0 46 186.0 47 187.5 48 199.0 49 184.5 50 160.0 51 154.5 52 142.5 53 135.5 54 143.0 55 140.5 56 133.0 57 126.0 58 118.0 59 128.0 60 129.0 61 122.0 62 120.0 63 107.0 64 103.0 65 107.5 66 105.5 67 98.0 68 95.5 69 96.5 70 86.5 71 72.5 72 60.0 73 51.5 74 47.5 75 42.5 76 36.0 77 26.0 78 16.0 79 11.0 80 13.0 81 13.5 82 7.5 83 3.0 84 2.5 85 3.0 86 2.5 87 1.0 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 3.0 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.125 3 0.125 4 0.125 5 0.075 6 0.075 7 0.1 8 0.125 9 0.17500000000000002 10-11 0.2625 12-13 0.2625 14-15 0.3 16-17 0.3 18-19 0.3 20-21 0.3 22-23 0.3 24-25 0.22499999999999998 26-27 0.25 28-29 0.22499999999999998 30-31 0.2375 32-33 0.21250000000000002 34-35 0.21250000000000002 36-37 0.17513134851138354 38-39 0.15011258443832876 40-41 0.15016894005756476 42-43 0.11264080100125157 44-45 0.1501877346683354 46-47 0.1251564455569462 48-49 0.0750938673341677 50-51 0.10012515644555695 52-53 0.11264080100125157 54-55 0.18773466833541927 56-57 0.16270337922403005 58-59 0.20027537864563774 60-61 0.18778167250876315 62-63 0.2003255289846 64-65 0.20037570444583594 66-67 0.1628256513026052 68-69 0.0751597143930853 70-71 0.07527286413248024 72-73 0.08823900163872432 74-75 0.08006405124099279 76 0.11025358324145534 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 1.0 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 1.0 65 0.0 66 0.0 67 0.0 68 1.0 69 4.0 70 3.0 71 6.0 72 23.0 73 73.0 74 270.0 75 891.0 76 2721.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0897597977244 97.975 2 0.7838179519595448 1.55 3 0.07585335018963338 0.22499999999999998 4 0.025284450063211124 0.1 5 0.0 0.0 6 0.025284450063211124 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347540 spots for SRR11389871.sra Written 1347540 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra Read 1347534 spots for SRR11389871.sra Written 1347534 spots for SRR11389871.sra SRR ids: ['SRR11389871.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tn0xllwt SRR11389871.sra spots: 26950686 blocks: [[1, 1347534], [1347535, 2695068], [2695069, 4042602], [4042603, 5390136], [5390137, 6737670], [6737671, 8085204], [8085205, 9432738], [9432739, 10780272], [10780273, 12127806], [12127807, 13475340], [13475341, 14822874], [14822875, 16170408], [16170409, 17517942], [17517943, 18865476], [18865477, 20213010], [20213011, 21560544], [21560545, 22908078], [22908079, 24255612], [24255613, 25603146], [25603147, 26950686]] SRR11389871 file size 5137832 SRR11389871 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389871 SRR11389871_1.fastq SRR11389871_2.fastq Input file: SRR11389871_1.fastq Paired file: SRR11389871_2.fastq trimmed: SRR11389871-trimmed-pair1.fastq, SRR11389871-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:44:36 2024 >> started Sat Dec 7 08:44:58 2024 >> done (21.869s) 26950686 read pairs processed; of these: 214 ( 0.00%) short read pairs filtered out after trimming by size control 28095 ( 0.10%) empty read pairs filtered out after trimming by size control 26922377 (99.89%) read pairs available; of these: 7741 ( 0.03%) trimmed read pairs available after processing 26914636 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 4 0.00% 23 3 0.00% 24 3 0.00% 25 5 0.00% 26 4 0.00% 27 9 0.00% 28 7 0.00% 29 3 0.00% 30 7 0.00% 31 10 0.00% 32 12 0.00% 33 5 0.00% 34 13 0.00% 35 360 0.00% 36 413 0.00% 37 500 0.00% 38 542 0.00% 39 622 0.00% 40 741 0.00% 41 816 0.00% 42 876 0.00% 43 1056 0.00% 44 1067 0.00% 45 1159 0.00% 46 1166 0.00% 47 1343 0.00% 48 1414 0.01% 49 1527 0.01% 50 1729 0.01% 51 1884 0.01% 52 2059 0.01% 53 2338 0.01% 54 2478 0.01% 55 2842 0.01% 56 3005 0.01% 57 3205 0.01% 58 3490 0.01% 59 3775 0.01% 60 4086 0.02% 61 4235 0.02% 62 4703 0.02% 63 5074 0.02% 64 5661 0.02% 65 6261 0.02% 66 6736 0.03% 67 7272 0.03% 68 7287 0.03% 69 8178 0.03% 70 9508 0.04% 71 12563 0.05% 72 30345 0.11% 73 220927 0.82% 74 1837686 6.83% 75 11703666 43.47% 76 13007695 48.32% 26922377 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=31 prefix-density=0.44 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=130.49 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=16.6 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=25 prefix-density=0.45 prefix-fanout=2.2 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.17 sequence-density-rank=15 fanout-score=119.18 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=19.9 sequence=GCCGCCGCCACCCT SRR11389871 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:45:28 Started mapping on | Dec 07 08:45:28 Finished on | Dec 07 08:47:11 Mapping speed, Million of reads per hour | 940.98 Number of input reads | 26922377 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 25039256 Uniquely mapped reads % | 93.01% Average mapped length | 150.14 Number of splices: Total | 12168657 Number of splices: Annotated (sjdb) | 11626388 Number of splices: GT/AG | 11993365 Number of splices: GC/AG | 155685 Number of splices: AT/AC | 4358 Number of splices: Non-canonical | 15249 Mismatch rate per base, % | 0.92% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 977513 % of reads mapped to multiple loci | 3.63% Number of reads mapped to too many loci | 41776 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.65% % of reads unmapped: other | 0.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 905609 905609 905609 N_multimapping 977513 977513 977513 N_noFeature 697884 24419587 853120 N_ambiguous 598078 2958 138129 UnstrandedReadsAssigned:23743294 PositiveStrandReadsAssigned:616711 NegativeStrandReadsAssigned:24048007 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389871 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389871-trimmed-pair1.fastq SRR11389871-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,922,377 reads, 24,802,335 reads pseudoaligned [quant] estimated average fragment length: 204.487 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52973 SRR11389871.ke.tsv 35125 SRR11389871.se.tsv 88098 total ==> SRR11389871.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.635 0 0 PNS24247 1044 840.513 60.4449 3.93711 PNS24249 1928 1724.51 184.225 5.84851 PNS24246 1044 840.513 60.4449 3.93711 PNS24248 1044 840.513 60.4449 3.93711 PNS24244 1471 1267.51 38.4402 1.66034 PNS24243 293 108.429 0 0 KQK14069 1603 1399.51 6608.45 258.515 KQK14071 474 272.833 386.185 77.4928 ==> SRR11389871.se.tsv <== BRADI_1g14170v3 7389 BRADI_1g53295v3 59 BRADI_1g59795v3 382 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 323 BRADI_1g74790v3 206 BRADI_1g09890v3 0 BRADI_1g77505v3 437 BRADI_1g48960v3 0 SRR11389871 completed mapping pipeline successfully