Starting /dee2/code/volunteer_pipeline.sh SRR11389872 current disk space = 1544516079616 free memory = 1601945220 SRR11389872 SRAfilesize 48019ec13966e5cc9551c392099fdc4d SRR11389872.sra SRR11389872.sra file validated SRR11389872 is paired end SRR11389872 is conventional basespace SRR11389872 read1 length is 43-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389872_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 43-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.214 32.0 32.0 32.0 32.0 32.0 2 31.34425 32.0 32.0 32.0 32.0 32.0 3 31.24625 32.0 32.0 32.0 32.0 32.0 4 31.28675 32.0 32.0 32.0 32.0 32.0 5 31.40825 32.0 32.0 32.0 32.0 32.0 6 34.04825 36.0 36.0 36.0 32.0 36.0 7 34.4025 36.0 36.0 36.0 32.0 36.0 8 34.362 36.0 36.0 36.0 32.0 36.0 9 34.431 36.0 36.0 36.0 32.0 36.0 10-11 34.393625 36.0 36.0 36.0 32.0 36.0 12-13 34.298125 36.0 36.0 36.0 32.0 36.0 14-15 34.241125 36.0 36.0 36.0 32.0 36.0 16-17 34.242625 36.0 36.0 36.0 32.0 36.0 18-19 34.103750000000005 36.0 36.0 36.0 32.0 36.0 20-21 34.097625 36.0 36.0 36.0 32.0 36.0 22-23 33.860875 36.0 36.0 36.0 32.0 36.0 24-25 33.734875 36.0 36.0 36.0 29.5 36.0 26-27 33.680875 36.0 36.0 36.0 32.0 36.0 28-29 33.587375 36.0 36.0 36.0 27.0 36.0 30-31 33.601875 36.0 36.0 36.0 27.0 36.0 32-33 33.548125 36.0 36.0 36.0 29.5 36.0 34-35 33.38275 36.0 36.0 36.0 27.0 36.0 36-37 33.4035 36.0 36.0 36.0 27.0 36.0 38-39 33.44175 36.0 36.0 36.0 27.0 36.0 40-41 33.155125 36.0 34.0 36.0 20.5 36.0 42-43 33.283375 36.0 36.0 36.0 27.0 36.0 44-45 33.1202800700175 36.0 36.0 36.0 20.5 36.0 46-47 33.23843460865216 36.0 36.0 36.0 27.0 36.0 48-49 32.805826456614156 36.0 34.0 36.0 21.0 36.0 50-51 32.86505752876438 36.0 34.0 36.0 14.0 36.0 52-53 32.74462231115558 36.0 36.0 36.0 17.5 36.0 54-55 32.75233519937352 36.0 36.0 36.0 17.5 36.0 56-57 32.816237177883416 36.0 32.0 36.0 14.0 36.0 58-59 32.63538538538539 36.0 32.0 36.0 14.0 36.0 60-61 32.22852491860756 36.0 32.0 36.0 14.0 36.0 62-63 32.01576386495917 36.0 32.0 36.0 14.0 36.0 64-65 31.984713821404853 36.0 32.0 36.0 14.0 36.0 66-67 31.61469039859614 36.0 32.0 36.0 14.0 36.0 68-69 31.528124955211588 36.0 32.0 36.0 14.0 36.0 70-71 31.625240556005366 36.0 32.0 36.0 14.0 36.0 72-73 31.607668276003686 36.0 32.0 36.0 14.0 36.0 74-75 31.18770795173241 36.0 32.0 36.0 14.0 36.0 76 30.47572463768116 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 5.0 25 19.0 26 30.0 27 74.0 28 101.0 29 175.0 30 249.0 31 339.0 32 535.0 33 858.0 34 1179.0 35 433.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.050000000000004 9.9 9.575 41.475 2 27.3 10.875 38.5 23.325000000000003 3 26.55 16.575 21.349999999999998 35.525 4 31.825 23.5 16.05 28.625 5 29.425 26.625 22.575 21.375 6 24.715980812926027 29.43701085584448 23.73138096440293 22.11562736682656 7 18.175 22.7 36.1 23.025000000000002 8 19.6 21.925 30.7 27.775 9 20.775 19.15 32.425 27.650000000000002 10-11 25.2375 27.537499999999998 23.0 24.224999999999998 12-13 23.625 22.125 24.8125 29.4375 14-15 24.2625 23.4625 25.2875 26.987499999999997 16-17 23.9375 24.1125 24.8 27.150000000000002 18-19 24.375 23.5625 25.7 26.3625 20-21 25.8125 24.099999999999998 24.2875 25.8 22-23 24.3625 24.1875 24.525 26.924999999999997 24-25 24.65 24.2875 23.525 27.537499999999998 26-27 23.75 24.5 24.55 27.200000000000003 28-29 25.974999999999998 23.875 24.125 26.025 30-31 23.849999999999998 24.3 24.2625 27.5875 32-33 24.7 23.799999999999997 25.2375 26.2625 34-35 24.4875 23.375 24.9 27.237499999999997 36-37 25.25 23.7375 24.05 26.9625 38-39 24.775 24.15 24.337500000000002 26.737499999999997 40-41 24.99374843710928 24.006001500375092 23.48087021755439 27.51937984496124 42-43 25.50956608728273 23.583843941478055 23.996498687007627 26.910091284231584 44-45 24.684256596223584 24.296611229210953 24.246592472177067 26.7725397023884 46-47 25.343835958989747 23.718429607401852 24.293573393348336 26.644161040260066 48-49 24.90622655663916 23.13078269567392 24.93123280820205 27.031757939484873 50-51 24.16208104052026 24.299649824912457 24.399699849924964 27.138569284642323 52-53 25.887943971985994 24.224612306153077 23.17408704352176 26.713356678339167 54-55 25.8411507191995 22.73921200750469 24.002501563477175 27.417135709818634 56-57 24.91868901676257 23.642732049036777 24.31823867900926 27.120340255191394 58-59 25.55055055055055 23.723723723723726 23.873873873873876 26.851851851851855 60-61 25.90783871775607 23.40345604808415 23.22814926120711 27.460555972952665 62-63 24.602279844669926 24.076161843918324 24.489540273080294 26.832018038331455 64-65 24.89033713497932 23.524251159293144 25.366587291640556 26.218824414086978 66-67 26.134369516169464 23.263975933818 23.82802707445475 26.77362747555778 68-69 24.282311645982197 24.658392879528645 24.15695123480005 26.902344239689107 70-71 25.526843953838434 24.448068238835926 23.75815353738083 26.26693426994481 72-73 25.49835982841282 24.37547312641938 23.25258642442594 26.873580620741862 74-75 26.27016935591412 20.602747032937724 25.64341912254967 27.48366448859848 76 28.41609278724175 0.0 34.5777455599855 37.00616165277275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 0.5 23 0.0 24 0.5 25 2.0 26 5.5 27 9.0 28 11.0 29 12.0 30 15.0 31 15.5 32 17.5 33 22.5 34 33.5 35 47.5 36 61.0 37 84.0 38 104.0 39 125.0 40 144.5 41 164.0 42 181.5 43 198.0 44 223.5 45 218.0 46 196.5 47 204.0 48 211.0 49 188.5 50 164.0 51 152.0 52 144.5 53 135.0 54 124.0 55 126.5 56 135.5 57 134.5 58 123.0 59 127.0 60 127.0 61 110.0 62 106.0 63 104.0 64 99.0 65 90.5 66 84.5 67 86.0 68 85.0 69 74.5 70 62.0 71 60.0 72 58.0 73 49.0 74 41.0 75 36.5 76 32.0 77 30.0 78 19.5 79 9.0 80 8.5 81 8.5 82 7.5 83 5.0 84 4.0 85 3.0 86 1.5 87 0.5 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.975 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.025 42-43 0.0375 44-45 0.012503125781445362 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.036231884057971016 >>END_MODULE >>Sequence Length Distribution warn #Length Count 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 0.0 57 1.0 58 0.0 59 3.0 60 0.0 61 0.0 62 3.0 63 0.0 64 1.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 4.0 71 9.0 72 24.0 73 71.0 74 261.0 75 859.0 76 2760.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11683068382538 98.2 2 0.8327024981074944 1.6500000000000001 3 0.05046681806712087 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389872 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389872_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9725 32.0 32.0 32.0 32.0 32.0 2 30.657 32.0 32.0 32.0 32.0 32.0 3 30.49925 32.0 32.0 32.0 32.0 32.0 4 30.59875 32.0 32.0 32.0 32.0 32.0 5 30.595 32.0 32.0 32.0 32.0 32.0 6 33.66975 36.0 36.0 36.0 32.0 36.0 7 33.892 36.0 36.0 36.0 32.0 36.0 8 33.7645 36.0 36.0 36.0 32.0 36.0 9 33.74125 36.0 36.0 36.0 32.0 36.0 10-11 33.734625 36.0 36.0 36.0 32.0 36.0 12-13 33.623875 36.0 36.0 36.0 32.0 36.0 14-15 33.4425 36.0 36.0 36.0 21.0 36.0 16-17 33.442750000000004 36.0 36.0 36.0 26.5 36.0 18-19 33.252625 36.0 36.0 36.0 21.0 36.0 20-21 33.317875 36.0 36.0 36.0 24.0 36.0 22-23 33.2575 36.0 36.0 36.0 24.0 36.0 24-25 33.184625 36.0 36.0 36.0 17.5 36.0 26-27 33.33925 36.0 36.0 36.0 27.0 36.0 28-29 33.15675 36.0 36.0 36.0 21.0 36.0 30-31 33.011625 36.0 36.0 36.0 17.5 36.0 32-33 33.0105 36.0 36.0 36.0 14.0 36.0 34-35 32.9285 36.0 36.0 36.0 14.0 36.0 36-37 32.453543701477585 36.0 36.0 36.0 14.0 36.0 38-39 32.51540195341848 36.0 32.0 36.0 14.0 36.0 40-41 32.582644628099175 36.0 34.0 36.0 14.0 36.0 42-43 32.56867543656594 36.0 34.0 36.0 14.0 36.0 44-45 32.16503759398496 36.0 32.0 36.0 14.0 36.0 46-47 32.439849624060145 36.0 32.0 36.0 14.0 36.0 48-49 32.189473684210526 36.0 32.0 36.0 14.0 36.0 50-51 31.97192278766608 36.0 32.0 36.0 14.0 36.0 52-53 31.868764101278515 36.0 32.0 36.0 14.0 36.0 54-55 31.859975671562193 36.0 32.0 36.0 14.0 36.0 56-57 31.81933299899699 36.0 32.0 36.0 14.0 36.0 58-59 31.523074993729622 36.0 32.0 36.0 14.0 36.0 60-61 31.36702124843839 36.0 32.0 36.0 14.0 36.0 62-63 30.977351734822747 36.0 32.0 36.0 14.0 36.0 64-65 31.018714141201105 36.0 32.0 36.0 14.0 36.0 66-67 30.94031163608947 36.0 32.0 36.0 14.0 36.0 68-69 30.92285776413675 36.0 29.5 36.0 14.0 36.0 70-71 30.982253703825947 36.0 32.0 36.0 14.0 36.0 72-73 30.626856597645478 36.0 27.0 36.0 14.0 36.0 74-75 30.877008140529785 36.0 29.5 36.0 14.0 36.0 76 29.223372781065088 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 3.0 5 0.0 6 0.0 7 0.0 8 3.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 4.0 15 6.0 16 1.0 17 3.0 18 5.0 19 3.0 20 7.0 21 8.0 22 6.0 23 13.0 24 32.0 25 57.0 26 78.0 27 103.0 28 159.0 29 184.0 30 304.0 31 379.0 32 508.0 33 795.0 34 994.0 35 338.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.44188376753507 20.59118236472946 9.193386773547093 36.77354709418837 2 30.819343522926584 23.25231771485843 28.81483337509396 17.113505387121023 3 24.40491104986219 28.96517163618141 19.017790027562015 27.61212728639439 4 28.98296593186373 30.711422845691384 16.93386773547094 23.371743486973948 5 30.15276734284999 31.354871024292514 19.634360130227897 18.8580015026296 6 24.91860756323566 33.30828950663661 19.90984222389181 21.863260706235913 7 22.539444027047335 17.20510894064613 33.73403456048084 26.521412471825695 8 23.759398496240603 21.629072681704262 23.709273182957393 30.902255639097742 9 24.228743416102333 20.692249811888637 26.109857035364936 28.969149736644095 10-11 28.237951807228917 27.00803212851406 19.18925702811245 25.56475903614458 12-13 27.81473578511359 20.77318940630099 22.957198443579767 28.45487636500565 14-15 26.256281407035175 23.190954773869347 23.693467336683415 26.85929648241206 16-17 28.429648241206028 23.103015075376884 22.261306532663315 26.20603015075377 18-19 26.46652430599171 23.288531591508605 22.82376585856048 27.421178243939202 20-21 27.159718734304374 23.744349573078853 23.304871923656453 25.791059768960324 22-23 27.683615819209038 23.60326428123038 22.360326428123038 26.35279347143754 24-25 27.029740243443346 24.21884803614004 22.298908269544484 26.45250345087213 26-27 26.653281465679505 24.896473836114946 23.390638725059606 25.059605973145942 28-29 27.54641244355243 23.620170597089814 22.729553437029605 26.103863522328147 30-31 26.96023083678334 23.46004265462301 22.456404466189937 27.123322042403714 32-33 27.11651824909068 24.093816631130064 22.174840085287848 26.614825034491407 34-35 27.480245829675155 23.84297002383043 22.450771353317446 26.226012793176974 36-37 26.925972396486824 23.751568381430364 21.994981179422833 27.327478042659976 38-39 26.59974905897114 24.203262233375156 23.71392722710163 25.48306148055207 40-41 27.49058971141782 23.70138017565872 22.358845671267254 26.44918444165621 42-43 27.229399222375516 23.9307663363853 22.225009406747773 26.614825034491407 44-45 27.68921802435045 23.672649679929712 22.49278272875612 26.145349566963727 46-47 27.318358639728952 24.131007654661815 21.94754674363157 26.603086961977663 48-49 26.4233759719087 24.040632054176072 22.636067218459996 26.899924755455228 50-51 27.716436637390213 23.52572145545797 22.835633626097867 25.922208281053955 52-53 27.666248431618566 23.450439146800502 22.622333751568384 26.26097867001255 54-55 27.370933299836704 24.205501821379226 22.40924506971486 26.014319809069214 56-57 26.97914048755969 24.50364413169138 22.49308871575773 26.024126664991204 58-59 27.19959778783308 24.45952740070387 22.53645047762695 25.804424333836103 60-61 26.723704076497235 24.29542023150478 22.14393558127831 26.836940110719677 62-63 26.53318221886412 24.140536456365698 23.15829240649792 26.167988918272258 64-65 27.518891687657433 24.584382871536523 22.216624685138537 25.680100755667507 66-67 26.73043040523534 23.82330732443997 22.84168134910647 26.604580921218222 68-69 25.915209460309473 24.48106680085545 23.877217260032708 25.726506478802364 70-71 27.93303121852971 24.13141993957704 22.30614300100705 25.629405840886204 72-73 26.63208502024291 24.392712550607285 22.41902834008097 26.556174089068822 74-75 27.85560344827586 20.676185344827587 24.030172413793103 27.43803879310345 76 29.211403184005924 0.0 32.95075897815624 37.83783783783784 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 4.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.5 7 2.0 8 2.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 1.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.5 23 2.5 24 4.5 25 6.0 26 7.5 27 9.0 28 10.5 29 11.0 30 12.5 31 15.5 32 18.0 33 22.0 34 37.5 35 52.5 36 64.5 37 81.0 38 95.5 39 113.0 40 128.5 41 138.0 42 145.5 43 176.5 44 186.0 45 179.0 46 192.0 47 189.5 48 177.0 49 166.0 50 156.0 51 148.0 52 139.5 53 128.0 54 128.0 55 124.0 56 118.0 57 127.0 58 136.0 59 129.5 60 129.5 61 130.0 62 116.0 63 101.0 64 99.5 65 109.5 66 112.5 67 114.0 68 111.0 69 106.0 70 92.0 71 82.0 72 73.0 73 62.5 74 53.5 75 45.5 76 42.0 77 33.0 78 24.0 79 17.5 80 12.5 81 8.5 82 7.0 83 5.5 84 5.0 85 4.0 86 3.0 87 3.0 88 2.5 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 2.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.22499999999999998 3 0.22499999999999998 4 0.2 5 0.17500000000000002 6 0.17500000000000002 7 0.17500000000000002 8 0.25 9 0.325 10-11 0.4 12-13 0.41250000000000003 14-15 0.5 16-17 0.5 18-19 0.4875 20-21 0.44999999999999996 22-23 0.43750000000000006 24-25 0.3875 26-27 0.3875 28-29 0.35000000000000003 30-31 0.36250000000000004 32-33 0.3375 34-35 0.3375 36-37 0.20035061357375405 38-39 0.20035061357375405 40-41 0.20035061357375405 42-43 0.1252661906551422 44-45 0.16290726817042606 46-47 0.13784461152882205 48-49 0.07518796992481204 50-51 0.1002757583354224 52-53 0.1002757583354224 54-55 0.20057665789143786 56-57 0.22567703109327986 58-59 0.2257336343115124 60-61 0.2384837454499812 62-63 0.2762777847544895 64-65 0.2387234577208192 66-67 0.15079165619502388 68-69 0.08798391151332328 70-71 0.07547169811320754 72-73 0.08848438882568575 74-75 0.08075370121130553 76 0.11094674556213018 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 7.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 1.0 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 0.0 57 1.0 58 0.0 59 3.0 60 1.0 61 0.0 62 3.0 63 0.0 64 1.0 65 0.0 66 0.0 67 0.0 68 2.0 69 0.0 70 4.0 71 5.0 72 25.0 73 89.0 74 278.0 75 872.0 76 2704.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24280666330137 98.3 2 0.6814740030287734 1.35 3 0.025239777889954566 0.075 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025239777889954566 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926612 spots for SRR11389872.sra Written 1926612 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra Read 1926599 spots for SRR11389872.sra Written 1926599 spots for SRR11389872.sra SRR ids: ['SRR11389872.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ao9o9jso SRR11389872.sra spots: 38531993 blocks: [[1, 1926599], [1926600, 3853198], [3853199, 5779797], [5779798, 7706396], [7706397, 9632995], [9632996, 11559594], [11559595, 13486193], [13486194, 15412792], [15412793, 17339391], [17339392, 19265990], [19265991, 21192589], [21192590, 23119188], [23119189, 25045787], [25045788, 26972386], [26972387, 28898985], [28898986, 30825584], [30825585, 32752183], [32752184, 34678782], [34678783, 36605381], [36605382, 38531993]] SRR11389872 file size 7355138 SRR11389872 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389872 SRR11389872_1.fastq SRR11389872_2.fastq Input file: SRR11389872_1.fastq Paired file: SRR11389872_2.fastq trimmed: SRR11389872-trimmed-pair1.fastq, SRR11389872-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:45:45 2024 >> started Sat Dec 7 08:46:19 2024 >> done (34.308s) 38531993 read pairs processed; of these: 294 ( 0.00%) short read pairs filtered out after trimming by size control 55437 ( 0.14%) empty read pairs filtered out after trimming by size control 38476262 (99.86%) read pairs available; of these: 9585 ( 0.02%) trimmed read pairs available after processing 38466677 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 3 0.00% 21 2 0.00% 22 4 0.00% 23 6 0.00% 24 6 0.00% 25 7 0.00% 26 9 0.00% 27 5 0.00% 28 8 0.00% 29 14 0.00% 30 11 0.00% 31 20 0.00% 32 16 0.00% 33 12 0.00% 34 14 0.00% 35 563 0.00% 36 611 0.00% 37 659 0.00% 38 776 0.00% 39 914 0.00% 40 1056 0.00% 41 1140 0.00% 42 1255 0.00% 43 1469 0.00% 44 1435 0.00% 45 1524 0.00% 46 1699 0.00% 47 1884 0.00% 48 2001 0.01% 49 2170 0.01% 50 2426 0.01% 51 2621 0.01% 52 2850 0.01% 53 3239 0.01% 54 3433 0.01% 55 3805 0.01% 56 4212 0.01% 57 4440 0.01% 58 4873 0.01% 59 5378 0.01% 60 5688 0.01% 61 6061 0.02% 62 6728 0.02% 63 7582 0.02% 64 8154 0.02% 65 8789 0.02% 66 9495 0.02% 67 10364 0.03% 68 10552 0.03% 69 11594 0.03% 70 13805 0.04% 71 18215 0.05% 72 42428 0.11% 73 311978 0.81% 74 2631895 6.84% 75 16716705 43.45% 76 18599654 48.34% 38476262 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=24 prefix-density=0.29 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=116.57 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=16.1 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=26 prefix-density=0.35 prefix-fanout=2.1 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=27 fanout-score=176.56 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=21.3 sequence=CCGCCGCCGCCTCC SRR11389872 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:46:57 Started mapping on | Dec 07 08:46:57 Finished on | Dec 07 08:49:16 Mapping speed, Million of reads per hour | 996.51 Number of input reads | 38476262 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 35723751 Uniquely mapped reads % | 92.85% Average mapped length | 150.16 Number of splices: Total | 17375449 Number of splices: Annotated (sjdb) | 16535013 Number of splices: GT/AG | 17133507 Number of splices: GC/AG | 213424 Number of splices: AT/AC | 5576 Number of splices: Non-canonical | 22942 Mismatch rate per base, % | 0.89% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.01% Insertion average length | 1.96 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1422911 % of reads mapped to multiple loci | 3.70% Number of reads mapped to too many loci | 79503 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.53% % of reads unmapped: other | 0.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1329600 1329600 1329600 N_multimapping 1422911 1422911 1422911 N_noFeature 1082442 34800781 1345498 N_ambiguous 850535 4323 198112 UnstrandedReadsAssigned:33790774 PositiveStrandReadsAssigned:918647 NegativeStrandReadsAssigned:34180141 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389872 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389872-trimmed-pair1.fastq SRR11389872-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,476,262 reads, 35,210,603 reads pseudoaligned [quant] estimated average fragment length: 202.535 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,244 rounds 52973 SRR11389872.ke.tsv 35125 SRR11389872.se.tsv 88098 total ==> SRR11389872.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 734.662 0 0 PNS24247 1044 842.465 109.7 5.15018 PNS24249 1928 1726.47 352.278 8.07039 PNS24246 1044 842.465 109.7 5.15018 PNS24248 1044 842.465 109.7 5.15018 PNS24244 1471 1269.47 94.6208 2.94803 PNS24243 293 109.365 0 0 KQK14069 1603 1401.47 11449.6 323.127 KQK14071 474 274.913 773.334 111.26 ==> SRR11389872.se.tsv <== BRADI_1g14170v3 12977 BRADI_1g53295v3 35 BRADI_1g59795v3 495 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 220 BRADI_1g74790v3 271 BRADI_1g09890v3 0 BRADI_1g77505v3 642 BRADI_1g48960v3 0 SRR11389872 completed mapping pipeline successfully