Starting /dee2/code/volunteer_pipeline.sh SRR11389873 current disk space = 1544523649024 free memory = 1600822916 SRR11389873 SRAfilesize 5e3eb77e566811e095fcb0b825b34759 SRR11389873.sra SRR11389873.sra file validated SRR11389873 is paired end SRR11389873 is conventional basespace SRR11389873 read1 length is 39-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389873_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 39-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.234 32.0 32.0 32.0 32.0 32.0 2 31.42225 32.0 32.0 32.0 32.0 32.0 3 31.173 32.0 32.0 32.0 32.0 32.0 4 31.29225 32.0 32.0 32.0 32.0 32.0 5 31.33025 32.0 32.0 32.0 32.0 32.0 6 34.00775 36.0 36.0 36.0 32.0 36.0 7 34.45025 36.0 36.0 36.0 32.0 36.0 8 34.3425 36.0 36.0 36.0 32.0 36.0 9 34.19025 36.0 36.0 36.0 32.0 36.0 10-11 34.217875 36.0 36.0 36.0 32.0 36.0 12-13 34.206500000000005 36.0 36.0 36.0 32.0 36.0 14-15 34.316625 36.0 36.0 36.0 32.0 36.0 16-17 34.169 36.0 36.0 36.0 32.0 36.0 18-19 34.061625 36.0 36.0 36.0 32.0 36.0 20-21 34.1105 36.0 36.0 36.0 32.0 36.0 22-23 33.950874999999996 36.0 36.0 36.0 32.0 36.0 24-25 33.777625 36.0 36.0 36.0 32.0 36.0 26-27 33.672 36.0 36.0 36.0 29.5 36.0 28-29 33.498000000000005 36.0 36.0 36.0 27.0 36.0 30-31 33.441375 36.0 36.0 36.0 27.0 36.0 32-33 33.400625000000005 36.0 36.0 36.0 27.0 36.0 34-35 33.497749999999996 36.0 36.0 36.0 29.5 36.0 36-37 33.552875 36.0 36.0 36.0 27.0 36.0 38-39 33.333375000000004 36.0 36.0 36.0 27.0 36.0 40-41 33.21242810702676 36.0 36.0 36.0 24.0 36.0 42-43 33.16958175887143 36.0 34.0 36.0 24.0 36.0 44-45 33.066283141570786 36.0 36.0 36.0 20.5 36.0 46-47 33.12656328164083 36.0 34.0 36.0 20.5 36.0 48-49 32.74574787393696 36.0 34.0 36.0 14.0 36.0 50-51 32.72205332713892 36.0 32.0 36.0 14.0 36.0 52-53 32.66099574681011 36.0 34.0 36.0 14.0 36.0 54-55 32.46384788591443 36.0 32.0 36.0 14.0 36.0 56-57 32.8803452300573 36.0 32.0 36.0 14.0 36.0 58-59 32.583287026708355 36.0 32.0 36.0 14.0 36.0 60-61 32.199873331324056 36.0 32.0 36.0 14.0 36.0 62-63 31.98671679197995 36.0 32.0 36.0 14.0 36.0 64-65 31.910401002506266 36.0 32.0 36.0 14.0 36.0 66-67 31.532796245341693 36.0 32.0 36.0 14.0 36.0 68-69 31.64242879164337 36.0 32.0 36.0 14.0 36.0 70-71 31.573029730180117 36.0 32.0 36.0 14.0 36.0 72-73 31.34010697565423 36.0 32.0 36.0 14.0 36.0 74-75 31.173239621931188 36.0 32.0 36.0 14.0 36.0 76 30.25936296814841 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 8.0 25 22.0 26 30.0 27 58.0 28 98.0 29 184.0 30 252.0 31 383.0 32 569.0 33 845.0 34 1137.0 35 410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.1 9.525 10.25 42.125 2 28.475 10.424999999999999 36.375 24.725 3 27.800000000000004 15.8 19.375 37.025000000000006 4 32.225 23.35 16.45 27.975 5 31.900000000000002 26.900000000000002 20.3 20.9 6 25.986842105263158 27.631578947368425 23.405870445344128 22.975708502024293 7 19.3 23.3 34.949999999999996 22.45 8 22.775000000000002 19.25 29.45 28.525 9 22.225 19.7 32.225 25.85 10-11 25.362499999999997 27.175 21.55 25.912499999999998 12-13 27.1125 21.337500000000002 23.7375 27.8125 14-15 25.75 22.9875 24.025 27.237499999999997 16-17 27.175 22.0625 22.875 27.8875 18-19 26.0375 22.5625 23.724999999999998 27.675 20-21 24.95 22.9375 23.724999999999998 28.3875 22-23 26.4125 23.1375 23.200000000000003 27.250000000000004 24-25 25.5125 23.549999999999997 23.474999999999998 27.462500000000002 26-27 26.487500000000004 23.025000000000002 24.212500000000002 26.275 28-29 26.0125 21.9625 23.549999999999997 28.475 30-31 26.0125 23.5625 22.400000000000002 28.025 32-33 25.05 23.775 23.962500000000002 27.212500000000002 34-35 26.8625 22.6875 23.5375 26.9125 36-37 26.75 23.0 23.575 26.674999999999997 38-39 27.05 22.7625 23.525 26.6625 40-41 26.86100337795571 22.682347053671965 22.99512073063931 27.461528837733017 42-43 26.352705410821642 22.294589178356713 23.40931863727455 27.943386773547097 44-45 26.526526526526528 23.135635635635634 22.972972972972975 27.364864864864863 46-47 27.688844422211105 22.173586793396698 22.586293146573286 27.55127563781891 48-49 25.737868934467233 22.461230615307652 23.311655827913956 28.489244622311155 50-51 26.666666666666668 22.951844903064416 22.976860537836146 27.40462789243277 52-53 27.34550913184889 22.47935951963973 22.692019014260694 27.483112334250688 54-55 26.419814861145856 22.241681260945708 23.492619464598448 27.845884413309985 56-57 27.15894868585732 22.428035043804755 23.366708385481854 27.04630788485607 58-59 27.106548140728687 22.41141855515212 22.761988230875172 27.72004507324402 60-61 26.640781563126254 22.70791583166333 22.657815631262526 27.993486973947896 62-63 26.67919799498747 21.8671679197995 23.170426065162907 28.283208020050125 64-65 27.44360902255639 21.904761904761905 23.50877192982456 27.142857142857142 66-67 26.175253854832643 22.264009025949605 22.81559483515106 28.745142284066695 68-69 26.824680210684726 22.422874341610232 23.68949084524705 27.06295460245799 70-71 28.225401606425706 23.042168674698797 21.335341365461847 27.397088353413658 72-73 27.170903599295244 21.394412282909638 22.665492071482507 28.769192046312607 74-75 27.667460947842205 18.62589356632248 24.54328832406672 29.163357161768598 76 29.39733707077786 0.0 32.165381920112125 38.437281009110016 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 1.0 24 2.5 25 4.5 26 4.0 27 1.5 28 3.0 29 9.0 30 11.0 31 15.0 32 17.5 33 13.5 34 25.0 35 38.5 36 46.0 37 59.5 38 69.0 39 87.5 40 106.0 41 125.0 42 150.0 43 158.0 44 154.5 45 161.0 46 172.5 47 170.5 48 167.0 49 157.5 50 150.5 51 149.0 52 141.5 53 150.0 54 163.5 55 160.0 56 165.5 57 171.0 58 160.0 59 157.0 60 154.5 61 155.0 62 153.5 63 132.5 64 115.5 65 121.0 66 105.5 67 80.5 68 82.5 69 85.5 70 89.0 71 87.0 72 72.0 73 64.0 74 62.0 75 57.0 76 44.0 77 27.0 78 18.0 79 16.0 80 15.5 81 13.5 82 11.0 83 9.0 84 6.0 85 1.5 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.2 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.06251562890722681 42-43 0.16256096036013504 44-45 0.05002501250625312 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.10500525026251313 >>END_MODULE >>Sequence Length Distribution warn #Length Count 39 1.0 40 0.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 2.0 57 0.0 58 1.0 59 0.0 60 2.0 61 1.0 62 0.0 63 0.0 64 0.0 65 1.0 66 1.0 67 0.0 68 2.0 69 1.0 70 2.0 71 6.0 72 8.0 73 70.0 74 244.0 75 798.0 76 2857.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.39531329597555 96.575 2 1.3754457463066736 2.7 3 0.1782985226693836 0.525 4 0.05094243504839531 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389873 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389873_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.88525 32.0 32.0 32.0 32.0 32.0 2 30.71075 32.0 32.0 32.0 32.0 32.0 3 30.52125 32.0 32.0 32.0 32.0 32.0 4 30.661 32.0 32.0 32.0 32.0 32.0 5 30.578 32.0 32.0 32.0 32.0 32.0 6 33.75625 36.0 36.0 36.0 32.0 36.0 7 33.9435 36.0 36.0 36.0 32.0 36.0 8 33.81125 36.0 36.0 36.0 32.0 36.0 9 33.74175 36.0 36.0 36.0 32.0 36.0 10-11 33.647875 36.0 36.0 36.0 32.0 36.0 12-13 33.6105 36.0 36.0 36.0 32.0 36.0 14-15 33.609125 36.0 36.0 36.0 32.0 36.0 16-17 33.527625 36.0 36.0 36.0 26.5 36.0 18-19 33.444874999999996 36.0 36.0 36.0 27.0 36.0 20-21 33.344875 36.0 36.0 36.0 27.0 36.0 22-23 33.354749999999996 36.0 36.0 36.0 27.0 36.0 24-25 33.2085 36.0 36.0 36.0 21.0 36.0 26-27 33.1945 36.0 36.0 36.0 24.0 36.0 28-29 33.1995 36.0 36.0 36.0 21.0 36.0 30-31 33.042875 36.0 36.0 36.0 17.5 36.0 32-33 33.048125 36.0 36.0 36.0 17.5 36.0 34-35 32.848124999999996 36.0 36.0 36.0 14.0 36.0 36-37 32.58285284532464 36.0 36.0 36.0 14.0 36.0 38-39 32.71647029330659 36.0 34.0 36.0 14.0 36.0 40-41 32.67740722166499 36.0 34.0 36.0 14.0 36.0 42-43 32.636534603811434 36.0 32.0 36.0 14.0 36.0 44-45 32.396564694082244 36.0 34.0 36.0 14.0 36.0 46-47 32.60406218655968 36.0 36.0 36.0 14.0 36.0 48-49 32.3015295887663 36.0 34.0 36.0 14.0 36.0 50-51 31.8546551367169 36.0 32.0 36.0 14.0 36.0 52-53 32.06395786305493 36.0 32.0 36.0 14.0 36.0 54-55 31.853398545272135 36.0 32.0 36.0 14.0 36.0 56-57 31.747263514670827 36.0 32.0 36.0 14.0 36.0 58-59 31.468811600910293 36.0 32.0 36.0 14.0 36.0 60-61 31.406657885415328 36.0 32.0 36.0 14.0 36.0 62-63 31.140291384074352 36.0 32.0 36.0 14.0 36.0 64-65 30.978271791007288 36.0 32.0 36.0 14.0 36.0 66-67 30.960310253201165 36.0 32.0 36.0 14.0 36.0 68-69 30.808226629978325 36.0 27.0 36.0 14.0 36.0 70-71 30.80732190220882 36.0 29.5 36.0 14.0 36.0 72-73 30.530758648401406 36.0 27.0 36.0 14.0 36.0 74-75 30.868825361274446 36.0 29.5 36.0 14.0 36.0 76 29.414625488107916 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 0.0 4 6.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 3.0 16 4.0 17 1.0 18 2.0 19 2.0 20 8.0 21 11.0 22 10.0 23 17.0 24 34.0 25 40.0 26 77.0 27 102.0 28 139.0 29 212.0 30 294.0 31 388.0 32 520.0 33 718.0 34 982.0 35 417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.70110330992979 18.229689067201605 9.804413239719159 38.26479438314945 2 31.16850551654965 22.442326980942827 28.68605817452357 17.703109327983952 3 25.501504513540624 25.175526579739216 18.55566700100301 30.767301905717154 4 30.090270812437314 28.836509528585758 16.223671013039116 24.849548645937812 5 31.311105540235644 29.20531461519178 18.350463775382302 21.133116069190272 6 25.24442216094259 31.91276009024818 17.874153923289047 24.968663825520178 7 23.293172690763054 16.114457831325304 32.329317269076306 28.263052208835344 8 25.910118001506405 20.01004268139593 22.847100175746924 31.23273914135074 9 24.253075571177504 20.913884007029875 25.48330404217926 29.349736379613354 10-11 28.858722976370032 25.62845651080945 18.413775766716945 27.09904474610357 12-13 28.81015202914939 19.12300540268878 22.440005025757003 29.62683754240483 14-15 27.28531855955679 23.633845378997734 22.336942835557792 26.74389322588769 16-17 27.886189097318393 21.792773511267782 22.0949263502455 28.226111041168323 18-19 27.15023296814003 22.453091550182595 21.999748142551315 28.396927339126055 20-21 27.56668344237544 22.559134373427277 21.8797181680926 27.99446401610468 22-23 27.784762383706312 22.831279859190346 21.423183303997988 27.96077445310536 24-25 28.11754363933191 23.270124325003138 20.946879316840388 27.66545271882456 26-27 26.871859296482413 22.98994974874372 21.331658291457288 28.80653266331658 28-29 27.536413862380716 23.44299347061778 20.467101958814666 28.55349070818684 30-31 27.530771163024365 21.954282843506657 22.07987942727958 28.4350665661894 32-33 26.616446955430007 23.92969240426868 21.707470182046453 27.746390458254865 34-35 26.767106089139986 23.339610797237917 21.393596986817325 28.499686126804768 36-37 27.358372063811082 23.564878784072352 21.065192814972995 28.011556337143574 38-39 28.325587237784198 22.685592262278607 20.95214169074237 28.036678809194825 40-41 28.792258388840015 21.64132210632148 21.57848435339952 27.987935151438986 42-43 27.7784754489514 22.95617229687304 20.846414667838754 28.418937586336806 44-45 27.117366172405127 23.24704699673285 20.972606182457902 28.662980648404123 46-47 27.449748743718594 23.015075376884422 21.35678391959799 28.178391959798994 48-49 28.10145655449523 21.572074334505274 21.785534907081868 28.54093420391763 50-51 27.364058771819664 23.63430867763406 21.411528318472936 27.590104232073337 52-53 28.225097349579197 22.723275970355484 20.80140685843487 28.250219821630452 54-55 27.308176100628927 23.09433962264151 21.433962264150942 28.163522012578618 56-57 27.395190733979604 22.862898149313864 22.233413068110288 27.50849804859625 58-59 27.655285372306913 22.376212674814163 21.58246188736298 28.38604006551594 60-61 28.25456836798992 22.948960302457465 21.713925645872717 27.0825456836799 62-63 27.17062089853609 22.778899545684 21.668349318525998 28.38213023725391 64-65 27.162673392181592 21.916771752837327 22.156368221941992 28.764186633039092 66-67 26.942939916866106 22.735860939664946 22.017886383675524 28.303312759793425 68-69 27.23725613593455 23.108873505349276 21.97608558842039 27.677784770295784 70-71 28.666834677419356 22.79485887096774 21.333165322580644 27.205141129032256 72-73 27.5028477407923 22.997088976078977 21.756739653208452 27.743323629920262 74-75 27.972121699504086 19.608631550730465 22.664522182013137 29.754724567752312 76 29.953753112771253 0.0 29.455709711846318 40.59053717538242 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 12.0 1 7.5 2 1.5 3 1.0 4 2.0 5 1.5 6 1.5 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.5 20 2.5 21 2.5 22 2.0 23 0.5 24 1.0 25 2.0 26 3.0 27 5.5 28 4.5 29 2.5 30 5.5 31 12.0 32 17.0 33 18.5 34 26.0 35 31.5 36 44.0 37 63.5 38 63.0 39 70.0 40 89.5 41 114.0 42 134.0 43 140.5 44 144.0 45 138.5 46 134.0 47 148.5 48 162.0 49 150.5 50 139.0 51 134.5 52 136.5 53 141.5 54 145.0 55 156.0 56 170.0 57 165.5 58 155.0 59 164.5 60 172.0 61 161.5 62 150.0 63 141.5 64 135.0 65 128.5 66 123.0 67 120.5 68 112.5 69 111.5 70 93.5 71 74.0 72 78.0 73 80.5 74 78.5 75 76.0 76 65.5 77 48.5 78 34.0 79 26.0 80 18.5 81 9.5 82 8.0 83 8.5 84 8.0 85 4.0 86 1.5 87 2.5 88 1.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.5 95 1.0 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.3 3 0.3 4 0.3 5 0.27499999999999997 6 0.27499999999999997 7 0.4 8 0.42500000000000004 9 0.42500000000000004 10-11 0.5499999999999999 12-13 0.5125000000000001 14-15 0.7250000000000001 16-17 0.7125 18-19 0.7374999999999999 20-21 0.65 22-23 0.575 24-25 0.46249999999999997 26-27 0.5 28-29 0.44999999999999996 30-31 0.475 32-33 0.43750000000000006 34-35 0.43750000000000006 36-37 0.21308598646277263 38-39 0.21308598646277263 40-41 0.2382146439317954 42-43 0.1629889669007021 44-45 0.22567703109327986 46-47 0.20060180541624875 48-49 0.15045135406218654 50-51 0.15047021943573666 52-53 0.16302984700275897 54-55 0.3009781790820165 56-57 0.33877038895859474 58-59 0.37655328228944396 60-61 0.3766478342749529 62-63 0.4772670183371013 64-65 0.40190906807334836 66-67 0.25128785023244127 68-69 0.15081060701269322 70-71 0.1509813789632612 72-73 0.15164918488563123 74-75 0.16057808109193095 76 0.21299254526091588 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 11.0 36 0.0 37 0.0 38 0.0 39 1.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 2.0 57 0.0 58 1.0 59 0.0 60 1.0 61 1.0 62 0.0 63 0.0 64 0.0 65 1.0 66 1.0 67 0.0 68 1.0 69 2.0 70 4.0 71 4.0 72 23.0 73 79.0 74 259.0 75 790.0 76 2817.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.36734693877551 96.39999999999999 2 1.4285714285714286 2.8000000000000003 3 0.17857142857142858 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025510204081632654 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085511 spots for SRR11389873.sra Written 2085511 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra Read 2085499 spots for SRR11389873.sra Written 2085499 spots for SRR11389873.sra SRR ids: ['SRR11389873.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3h53ltd9 SRR11389873.sra spots: 41709992 blocks: [[1, 2085499], [2085500, 4170998], [4170999, 6256497], [6256498, 8341996], [8341997, 10427495], [10427496, 12512994], [12512995, 14598493], [14598494, 16683992], [16683993, 18769491], [18769492, 20854990], [20854991, 22940489], [22940490, 25025988], [25025989, 27111487], [27111488, 29196986], [29196987, 31282485], [31282486, 33367984], [33367985, 35453483], [35453484, 37538982], [37538983, 39624481], [39624482, 41709992]] SRR11389873 file size 7964345 SRR11389873 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389873 SRR11389873_1.fastq SRR11389873_2.fastq Input file: SRR11389873_1.fastq Paired file: SRR11389873_2.fastq trimmed: SRR11389873-trimmed-pair1.fastq, SRR11389873-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:46:09 2024 >> started Sat Dec 7 08:46:48 2024 >> done (39.202s) 41709992 read pairs processed; of these: 320 ( 0.00%) short read pairs filtered out after trimming by size control 73743 ( 0.18%) empty read pairs filtered out after trimming by size control 41635929 (99.82%) read pairs available; of these: 16641 ( 0.04%) trimmed read pairs available after processing 41619288 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 6 0.00% 21 3 0.00% 22 4 0.00% 23 8 0.00% 24 9 0.00% 25 15 0.00% 26 12 0.00% 27 10 0.00% 28 15 0.00% 29 16 0.00% 30 19 0.00% 31 13 0.00% 32 16 0.00% 33 20 0.00% 34 20 0.00% 35 914 0.00% 36 993 0.00% 37 1057 0.00% 38 1206 0.00% 39 1395 0.00% 40 1671 0.00% 41 1723 0.00% 42 1942 0.00% 43 2043 0.00% 44 2245 0.01% 45 2203 0.01% 46 2365 0.01% 47 2563 0.01% 48 2693 0.01% 49 2851 0.01% 50 3145 0.01% 51 3361 0.01% 52 3635 0.01% 53 3898 0.01% 54 4094 0.01% 55 4757 0.01% 56 4858 0.01% 57 5277 0.01% 58 5477 0.01% 59 6130 0.01% 60 6506 0.02% 61 6698 0.02% 62 7236 0.02% 63 7746 0.02% 64 8416 0.02% 65 8998 0.02% 66 9733 0.02% 67 10605 0.03% 68 10496 0.03% 69 11402 0.03% 70 13299 0.03% 71 17679 0.04% 72 44727 0.11% 73 317118 0.76% 74 2658783 6.39% 75 17515211 42.07% 76 20908593 50.22% 41635929 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=22 prefix-density=0.93 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=21 fanout-score=63.77 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=12.3 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=24 prefix-density=0.68 prefix-fanout=2.2 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=152.07 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=5.5 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR11389873 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:47:15 Started mapping on | Dec 07 08:47:15 Finished on | Dec 07 08:49:50 Mapping speed, Million of reads per hour | 967.03 Number of input reads | 41635929 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 38948978 Uniquely mapped reads % | 93.55% Average mapped length | 150.21 Number of splices: Total | 18204975 Number of splices: Annotated (sjdb) | 17439584 Number of splices: GT/AG | 17974993 Number of splices: GC/AG | 203806 Number of splices: AT/AC | 4601 Number of splices: Non-canonical | 21575 Mismatch rate per base, % | 0.87% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1239270 % of reads mapped to multiple loci | 2.98% Number of reads mapped to too many loci | 74824 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.72% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1447681 1447681 1447681 N_multimapping 1239270 1239270 1239270 N_noFeature 874645 38057194 1115400 N_ambiguous 856986 3823 212224 UnstrandedReadsAssigned:37217347 PositiveStrandReadsAssigned:887961 NegativeStrandReadsAssigned:37621354 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389873 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389873-trimmed-pair1.fastq SRR11389873-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,635,929 reads, 38,385,106 reads pseudoaligned [quant] estimated average fragment length: 208.676 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52973 SRR11389873.ke.tsv 35125 SRR11389873.se.tsv 88098 total ==> SRR11389873.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 728.561 0 0 PNS24247 1044 836.324 64.2946 2.61177 PNS24249 1928 1720.32 245.309 4.84438 PNS24246 1044 836.324 64.2946 2.61177 PNS24248 1044 836.324 64.2946 2.61177 PNS24244 1471 1263.32 23.8069 0.640212 PNS24243 293 103.961 0 0 KQK14069 1603 1395.32 677.549 16.4968 KQK14071 474 268.949 49.2171 6.217 ==> SRR11389873.se.tsv <== BRADI_1g14170v3 774 BRADI_1g53295v3 29 BRADI_1g59795v3 257 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 340 BRADI_1g74790v3 322 BRADI_1g09890v3 0 BRADI_1g77505v3 437 BRADI_1g48960v3 0 SRR11389873 completed mapping pipeline successfully