Starting /dee2/code/volunteer_pipeline.sh SRR11389874 current disk space = 1544461594624 free memory = 1421398888 SRR11389874 SRAfilesize 2acc830d81a62ce956133c034484659a SRR11389874.sra SRR11389874.sra file validated SRR11389874 is paired end SRR11389874 is conventional basespace SRR11389874 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389874_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.207 32.0 32.0 32.0 32.0 32.0 2 31.3835 32.0 32.0 32.0 32.0 32.0 3 31.2155 32.0 32.0 32.0 32.0 32.0 4 31.366 32.0 32.0 32.0 32.0 32.0 5 31.376 32.0 32.0 32.0 32.0 32.0 6 34.16175 36.0 36.0 36.0 32.0 36.0 7 34.3065 36.0 36.0 36.0 32.0 36.0 8 34.353 36.0 36.0 36.0 32.0 36.0 9 34.37675 36.0 36.0 36.0 32.0 36.0 10-11 34.247125 36.0 36.0 36.0 32.0 36.0 12-13 34.22324999999999 36.0 36.0 36.0 32.0 36.0 14-15 34.265 36.0 36.0 36.0 32.0 36.0 16-17 34.140874999999994 36.0 36.0 36.0 32.0 36.0 18-19 34.158500000000004 36.0 36.0 36.0 32.0 36.0 20-21 34.019999999999996 36.0 36.0 36.0 32.0 36.0 22-23 33.954875 36.0 36.0 36.0 32.0 36.0 24-25 33.788624999999996 36.0 36.0 36.0 32.0 36.0 26-27 33.579125 36.0 36.0 36.0 27.0 36.0 28-29 33.58 36.0 36.0 36.0 27.0 36.0 30-31 33.562375 36.0 36.0 36.0 27.0 36.0 32-33 33.659375 36.0 36.0 36.0 29.5 36.0 34-35 33.5315 36.0 36.0 36.0 29.5 36.0 36-37 33.45536384096024 36.0 36.0 36.0 27.0 36.0 38-39 33.295573893473374 36.0 36.0 36.0 24.0 36.0 40-41 33.284446111527885 36.0 36.0 36.0 24.0 36.0 42-43 33.30157539384846 36.0 36.0 36.0 27.0 36.0 44-45 33.21055263815954 36.0 36.0 36.0 27.0 36.0 46-47 33.133408352088026 36.0 36.0 36.0 21.0 36.0 48-49 32.77094273568392 36.0 34.0 36.0 17.5 36.0 50-51 32.69854963740936 36.0 32.0 36.0 14.0 36.0 52-53 32.76856714178545 36.0 34.0 36.0 14.0 36.0 54-55 32.829539769884946 36.0 34.0 36.0 21.0 36.0 56-57 32.65604490386299 36.0 32.0 36.0 14.0 36.0 58-59 32.6188986232791 36.0 32.0 36.0 14.0 36.0 60-61 32.18484553851593 36.0 32.0 36.0 14.0 36.0 62-63 31.95479589281242 36.0 32.0 36.0 14.0 36.0 64-65 31.862093455264326 36.0 32.0 36.0 14.0 36.0 66-67 31.818876911506642 36.0 32.0 36.0 14.0 36.0 68-69 31.464693742627432 36.0 32.0 36.0 14.0 36.0 70-71 31.586626908105597 36.0 32.0 36.0 14.0 36.0 72-73 31.405390249252825 36.0 32.0 36.0 14.0 36.0 74-75 31.121599127588134 36.0 32.0 36.0 14.0 36.0 76 30.201760563380283 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 7.0 24 8.0 25 16.0 26 39.0 27 57.0 28 97.0 29 146.0 30 249.0 31 393.0 32 565.0 33 856.0 34 1149.0 35 415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.28432108027007 10.452613153288322 8.402100525131283 43.86096524131033 2 27.506876719179797 9.827456864216053 37.15928982245561 25.506376594148538 3 25.681420355088775 15.403850962740684 20.980245061265315 37.934483620905226 4 33.13328332083021 22.005501375343837 17.429357339334832 27.431857964491122 5 31.10777694423606 27.081770442610654 20.930232558139537 20.880220055013755 6 24.729559748427672 28.37735849056604 23.32075471698113 23.572327044025158 7 19.10477619404851 23.80595148787197 34.90872718179545 22.18054513628407 8 21.305326331582897 20.4801200300075 30.15753938484621 28.057014253563388 9 22.655663915978995 18.65466366591648 31.90797699424856 26.78169542385596 10-11 25.206301575393848 27.144286071517882 21.955488872218055 25.693923480870218 12-13 26.056514128532132 21.305326331582897 24.20605151287822 28.432108027006752 14-15 24.731182795698924 23.74343585896474 24.518629657414355 27.00675168792198 16-17 26.44411102775694 23.068267066766694 23.830957739434858 26.65666416604151 18-19 26.76919229807452 22.61815453863466 23.43085771442861 27.181795448862218 20-21 25.818954738684667 22.593148287071767 24.243560890222557 27.344336084021002 22-23 26.669167291822955 24.58114528632158 22.605651412853213 26.144036009002253 24-25 26.469117279319832 23.20580145036259 22.85571392848212 27.46936734183546 26-27 25.968992248062015 23.118279569892472 23.605901475368842 27.306826706676667 28-29 26.744186046511626 23.093273318329583 23.093273318329583 27.069267316829208 30-31 27.206801700425103 22.43060765191298 22.930732683170792 27.431857964491122 32-33 25.76894223555889 24.031007751937985 23.080770192548137 27.11927981995499 34-35 26.469117279319832 22.9057264316079 23.730932733183295 26.894223555888974 36-37 26.556639159789945 22.893223305826456 23.143285821455365 27.406851712928233 38-39 27.11927981995499 22.168042010502624 23.25581395348837 27.45686421605401 40-41 26.17558779389695 22.761380690345174 23.449224612306153 27.613806903451728 42-43 26.53239929947461 22.629472104078058 22.95471603702777 27.88341255941956 44-45 25.67533766883442 22.661330665332667 23.936968484242122 27.726363181590795 46-47 26.069017254313575 22.61815453863466 23.468367091772944 27.84446111527882 48-49 25.543885971492873 22.06801700425106 23.843460865216304 28.54463615903976 50-51 26.231557889472366 22.74318579644911 22.58064516129032 28.444611152788195 52-53 26.79419854963741 22.55563890972743 22.58064516129032 28.069517379344838 54-55 26.900950475237618 21.68584292146073 23.261630815407706 28.151575787893947 56-57 26.416510318949342 22.35146966854284 23.20200125078174 28.030018761726076 58-59 26.14518147684606 23.016270337922403 23.128911138923655 27.709637046307883 60-61 26.089133700550825 22.871807711567353 22.245868803204807 28.793189784677015 62-63 26.30853994490358 22.96518908089156 23.741547708489858 26.984723265715 64-65 28.03457346862082 22.15958912689465 22.77339346110485 27.03244394337968 66-67 27.01178240160441 22.612183504637752 22.549511155678115 27.826522938079716 68-69 26.407523510971785 22.658307210031346 23.56112852664577 27.373040752351095 70-71 27.273867770668677 22.381131602057458 23.309496926358047 27.035503700915818 72-73 26.463552813798312 22.220823366486215 22.77477023794536 28.540853581770115 74-75 26.84830048935326 19.653484988758102 24.560243354053696 28.93797116783494 76 30.866807610993657 0.0 29.844961240310074 39.28823114869627 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 2.0 20 3.5 21 3.0 22 2.5 23 2.0 24 1.0 25 0.5 26 1.0 27 2.5 28 5.0 29 6.5 30 12.5 31 16.0 32 13.0 33 16.0 34 27.5 35 44.0 36 48.5 37 44.5 38 69.5 39 102.0 40 113.5 41 127.5 42 142.0 43 155.5 44 172.0 45 178.0 46 182.5 47 178.0 48 168.0 49 165.5 50 153.5 51 143.0 52 144.0 53 151.5 54 154.0 55 137.5 56 128.5 57 143.5 58 154.5 59 149.5 60 146.5 61 152.0 62 151.0 63 137.0 64 129.5 65 128.0 66 115.0 67 105.5 68 88.0 69 81.0 70 73.5 71 61.5 72 70.0 73 66.5 74 54.0 75 49.5 76 41.0 77 33.0 78 25.5 79 14.5 80 14.0 81 15.0 82 9.5 83 5.0 84 3.5 85 1.5 86 1.0 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 1.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.625 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.025006251562890724 42-43 0.05001250312578145 44-45 0.025006251562890724 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.07042253521126761 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 1.0 57 2.0 58 0.0 59 0.0 60 2.0 61 0.0 62 0.0 63 1.0 64 1.0 65 2.0 66 0.0 67 1.0 68 1.0 69 1.0 70 1.0 71 5.0 72 17.0 73 62.0 74 241.0 75 820.0 76 2840.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.36609650242532 96.325 2 1.2764871074802144 2.5 3 0.2297676793464386 0.675 4 0.12764871074802145 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389874 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389874_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.92525 32.0 32.0 32.0 32.0 32.0 2 30.797 32.0 32.0 32.0 32.0 32.0 3 30.544 32.0 32.0 32.0 32.0 32.0 4 30.7875 32.0 32.0 32.0 32.0 32.0 5 30.71575 32.0 32.0 32.0 32.0 32.0 6 33.9 36.0 36.0 36.0 32.0 36.0 7 33.9695 36.0 36.0 36.0 32.0 36.0 8 33.78375 36.0 36.0 36.0 32.0 36.0 9 33.81775 36.0 36.0 36.0 32.0 36.0 10-11 33.577125 36.0 36.0 36.0 32.0 36.0 12-13 33.716125000000005 36.0 36.0 36.0 32.0 36.0 14-15 33.543625 36.0 36.0 36.0 32.0 36.0 16-17 33.56375 36.0 36.0 36.0 32.0 36.0 18-19 33.410875000000004 36.0 36.0 36.0 27.0 36.0 20-21 33.409375 36.0 36.0 36.0 27.0 36.0 22-23 33.350625 36.0 36.0 36.0 24.0 36.0 24-25 33.197874999999996 36.0 36.0 36.0 24.0 36.0 26-27 33.21275 36.0 36.0 36.0 21.0 36.0 28-29 33.0975 36.0 36.0 36.0 17.5 36.0 30-31 33.138999999999996 36.0 36.0 36.0 17.5 36.0 32-33 33.0775 36.0 36.0 36.0 17.5 36.0 34-35 32.889375 36.0 36.0 36.0 14.0 36.0 36-37 32.549787340505375 36.0 36.0 36.0 14.0 36.0 38-39 32.62321741305979 36.0 36.0 36.0 14.0 36.0 40-41 32.607080310232675 36.0 36.0 36.0 14.0 36.0 42-43 32.463588588588586 36.0 32.0 36.0 14.0 36.0 44-45 32.49987487487488 36.0 34.0 36.0 14.0 36.0 46-47 32.370745745745744 36.0 34.0 36.0 14.0 36.0 48-49 32.33358358358359 36.0 34.0 36.0 14.0 36.0 50-51 31.870995995995997 36.0 32.0 36.0 14.0 36.0 52-53 32.020270270270274 36.0 32.0 36.0 14.0 36.0 54-55 31.781602002503128 36.0 32.0 36.0 14.0 36.0 56-57 31.833773814664426 36.0 32.0 36.0 14.0 36.0 58-59 31.438251503006015 36.0 32.0 36.0 14.0 36.0 60-61 31.477584617857268 36.0 32.0 36.0 14.0 36.0 62-63 31.233333333333334 36.0 32.0 36.0 14.0 36.0 64-65 31.15971595533655 36.0 32.0 36.0 14.0 36.0 66-67 30.914826894129455 36.0 29.5 36.0 14.0 36.0 68-69 31.062514336104236 36.0 32.0 36.0 14.0 36.0 70-71 31.15719577626365 36.0 32.0 36.0 14.0 36.0 72-73 30.472247609376325 36.0 27.0 36.0 14.0 36.0 74-75 30.701935998234987 36.0 27.0 36.0 14.0 36.0 76 29.462969462969465 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 3.0 5 1.0 6 1.0 7 1.0 8 1.0 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 4.0 16 0.0 17 3.0 18 0.0 19 4.0 20 6.0 21 10.0 22 10.0 23 23.0 24 32.0 25 42.0 26 62.0 27 116.0 28 123.0 29 217.0 30 288.0 31 399.0 32 509.0 33 816.0 34 965.0 35 359.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.837296620775973 19.499374217772214 9.211514392991239 41.45181476846058 2 30.988735919899874 22.828535669586984 29.011264080100123 17.171464330413016 3 23.028785982478098 25.93241551939925 19.64956195244055 31.389236545682103 4 29.22922922922923 29.904904904904907 16.99199199199199 23.873873873873876 5 31.023267450587944 30.072554415811858 18.263697773329998 20.640480360270203 6 24.518388791593697 33.52514385789342 18.263697773329998 23.692769577182887 7 23.178973717146434 15.894868585732166 31.364205256570717 29.561952440550687 8 23.935903855783675 20.080120180270406 24.98748122183275 30.996494742113168 9 24.636591478696744 19.248120300751882 27.06766917293233 29.04761904761905 10-11 27.379907186755297 26.401605418286717 18.53756427944312 27.68092311551486 12-13 26.928383293615955 20.230778878715665 22.425686692587483 30.415151135080897 14-15 26.098970108013063 22.770660638030645 23.662396382818386 27.467972871137903 16-17 27.11864406779661 22.335216572504706 21.657250470809792 28.888888888888886 18-19 27.209944751381215 23.36765444500251 22.21245605223506 27.209944751381215 20-21 27.940253545876743 22.015815237856156 22.15388477469562 27.89004644157148 22-23 27.302383939774156 22.936010037641154 22.936010037641154 26.82559598494354 24-25 27.90872617853561 22.49247743229689 21.577231695085256 28.021564694082247 26-27 27.1039759187257 23.07788787156654 21.886366486893266 27.931769722814497 28-29 27.31945837512538 23.119358074222667 21.95336008024072 27.607823470411237 30-31 27.338851266616505 22.636067218459996 21.670428893905193 28.35465262101831 32-33 28.247241725175527 23.13189568706118 22.078736208625877 26.54212637913741 34-35 27.72066198595787 22.743229689067203 21.90320962888666 27.632898696088265 36-37 27.542957481500064 23.128057193026464 21.422300263388937 27.906685062084534 38-39 27.849529780564264 23.849529780564264 22.106583072100314 26.194357366771158 40-41 28.28295497303399 22.977549228646684 20.79518374513985 27.94431205317948 42-43 28.5481444332999 22.881143430290873 21.81544633901705 26.755265797392173 44-45 27.906685062084534 22.789414273171953 21.79857017433839 27.505330490405118 46-47 28.61442006269592 22.595611285266457 21.5423197492163 27.247648902821314 48-49 27.850162866449512 22.37534452518166 21.799047857679778 27.97544475068905 50-51 26.792878635907723 23.42026078234704 22.141424272818455 27.64543630892678 52-53 27.87111334002006 22.617853560682047 20.699598796389168 28.81143430290873 54-55 27.47238955823293 23.531626506024097 21.184738955823292 27.81124497991968 56-57 27.717800652774287 23.62540798393171 21.805171980918907 26.85161938237509 58-59 28.203517587939697 23.09045226130653 21.08040201005025 27.62562814070352 60-61 27.02023375644087 22.822671861254243 21.553349252230742 28.60374513007415 62-63 27.040623820903033 22.462583322852474 23.16689724562948 27.32989561061502 64-65 27.13782696177062 23.01307847082495 21.730382293762577 28.11871227364185 66-67 28.090028919904437 23.29938388029674 22.092292216773547 26.518294983025275 68-69 27.520744279607744 23.48503897410108 21.93864722152376 27.055569524767414 70-71 27.911368500566535 22.01938814050107 21.729825003147425 28.339418355784968 72-73 27.526309116267278 22.86040319513123 21.693926714847215 27.91936097375428 74-75 28.567603748326643 18.755020080321287 24.056224899598394 28.621151271753682 76 28.92794376098418 0.0 30.86115992970123 40.210896309314585 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 1.0 3 1.0 4 0.0 5 1.5 6 2.0 7 1.0 8 1.0 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 1.0 23 1.0 24 0.0 25 2.0 26 4.0 27 5.5 28 9.0 29 10.0 30 8.0 31 9.5 32 15.0 33 16.5 34 23.0 35 37.5 36 49.5 37 53.0 38 60.0 39 84.0 40 102.5 41 112.0 42 127.0 43 151.0 44 158.0 45 158.5 46 166.5 47 164.0 48 158.0 49 150.5 50 147.0 51 143.0 52 147.0 53 141.0 54 126.0 55 134.5 56 150.5 57 160.0 58 151.0 59 162.0 60 188.0 61 174.5 62 155.5 63 139.5 64 125.0 65 120.5 66 119.0 67 122.0 68 117.0 69 99.0 70 80.5 71 77.0 72 85.0 73 82.5 74 65.5 75 55.0 76 49.5 77 38.0 78 25.0 79 18.0 80 14.5 81 10.0 82 6.0 83 3.5 84 3.5 85 2.5 86 1.0 87 1.0 88 1.5 89 2.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 1.0 99 4.0 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.125 3 0.125 4 0.1 5 0.075 6 0.075 7 0.125 8 0.15 9 0.25 10-11 0.3375 12-13 0.3375 14-15 0.475 16-17 0.43750000000000006 18-19 0.44999999999999996 20-21 0.41250000000000003 22-23 0.375 24-25 0.3 26-27 0.3375 28-29 0.3 30-31 0.325 32-33 0.3 34-35 0.3 36-37 0.2626970227670753 38-39 0.2376782586940205 40-41 0.2626970227670753 42-43 0.20020020020020018 44-45 0.23773773773773776 46-47 0.21271271271271272 48-49 0.12512512512512514 50-51 0.20020020020020018 52-53 0.20020020020020018 54-55 0.2753441802252816 56-57 0.28789585680310426 58-59 0.30060120240480964 60-61 0.31320471059884736 62-63 0.3634085213032582 64-65 0.3134010279553717 66-67 0.23833416959357753 68-69 0.13810420590081607 70-71 0.1257387149503332 72-73 0.1519179642992784 74-75 0.10698047606311847 76 0.1404001404001404 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 1.0 57 2.0 58 0.0 59 0.0 60 2.0 61 0.0 62 0.0 63 1.0 64 1.0 65 2.0 66 0.0 67 3.0 68 1.0 69 2.0 70 7.0 71 13.0 72 21.0 73 59.0 74 282.0 75 749.0 76 2849.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.10547875064005 95.8 2 1.5360983102918586 3.0 3 0.2560163850486431 0.75 4 0.051203277009728626 0.2 5 0.051203277009728626 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit CGACGCCACACAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545495 spots for SRR11389874.sra Written 1545495 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra Read 1545484 spots for SRR11389874.sra Written 1545484 spots for SRR11389874.sra SRR ids: ['SRR11389874.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kyp39pla SRR11389874.sra spots: 30909691 blocks: [[1, 1545484], [1545485, 3090968], [3090969, 4636452], [4636453, 6181936], [6181937, 7727420], [7727421, 9272904], [9272905, 10818388], [10818389, 12363872], [12363873, 13909356], [13909357, 15454840], [15454841, 17000324], [17000325, 18545808], [18545809, 20091292], [20091293, 21636776], [21636777, 23182260], [23182261, 24727744], [24727745, 26273228], [26273229, 27818712], [27818713, 29364196], [29364197, 30909691]] SRR11389874 file size 5897542 SRR11389874 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389874 SRR11389874_1.fastq SRR11389874_2.fastq Input file: SRR11389874_1.fastq Paired file: SRR11389874_2.fastq trimmed: SRR11389874-trimmed-pair1.fastq, SRR11389874-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:51:35 2024 >> started Sat Dec 7 08:53:59 2024 >> done (143.957s) 30909691 read pairs processed; of these: 252 ( 0.00%) short read pairs filtered out after trimming by size control 21003 ( 0.07%) empty read pairs filtered out after trimming by size control 30888436 (99.93%) read pairs available; of these: 12588 ( 0.04%) trimmed read pairs available after processing 30875848 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 8 0.00% 21 5 0.00% 22 11 0.00% 23 9 0.00% 24 10 0.00% 25 16 0.00% 26 18 0.00% 27 21 0.00% 28 22 0.00% 29 32 0.00% 30 31 0.00% 31 33 0.00% 32 43 0.00% 33 39 0.00% 34 37 0.00% 35 469 0.00% 36 460 0.00% 37 528 0.00% 38 621 0.00% 39 699 0.00% 40 759 0.00% 41 948 0.00% 42 992 0.00% 43 1038 0.00% 44 1096 0.00% 45 1229 0.00% 46 1244 0.00% 47 1305 0.00% 48 1453 0.00% 49 1524 0.00% 50 1621 0.01% 51 1816 0.01% 52 2039 0.01% 53 2069 0.01% 54 2225 0.01% 55 2422 0.01% 56 2762 0.01% 57 2969 0.01% 58 3245 0.01% 59 3362 0.01% 60 3573 0.01% 61 3803 0.01% 62 4023 0.01% 63 4423 0.01% 64 4945 0.02% 65 5284 0.02% 66 5618 0.02% 67 6115 0.02% 68 6167 0.02% 69 6936 0.02% 70 8185 0.03% 71 11391 0.04% 72 31272 0.10% 73 234880 0.76% 74 1971649 6.38% 75 13036140 42.20% 76 15504795 50.20% 30888436 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=14 prefix-density=0.81 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=19.21 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=5.3 sequence=TTCTTGGCGAACGTCTCTGGGTCAGCTGACAACCCCGCGGTGTCCCAGCCGTAGTCACCGGGGAACTCGCCGGTCAGGTACGACGGCGTCTGCTCGGAGAACGGGCCCAGGTACTTGGGACGGTCAGGGCCGTACCAGATGCTCTGGGGTGCGCTCTTGACAGTCCGGCGCATGGTGA criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=13 prefix-density=0.63 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=145.27 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=5.5 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR11389874 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:57:29 Started mapping on | Dec 07 08:57:30 Finished on | Dec 07 09:13:46 Mapping speed, Million of reads per hour | 113.93 Number of input reads | 30888436 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 28705400 Uniquely mapped reads % | 92.93% Average mapped length | 150.25 Number of splices: Total | 12817706 Number of splices: Annotated (sjdb) | 12287188 Number of splices: GT/AG | 12659738 Number of splices: GC/AG | 140820 Number of splices: AT/AC | 2951 Number of splices: Non-canonical | 14197 Mismatch rate per base, % | 0.91% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1019063 % of reads mapped to multiple loci | 3.30% Number of reads mapped to too many loci | 67527 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1163973 1163973 1163973 N_multimapping 1019063 1019063 1019063 N_noFeature 621197 28054461 797925 N_ambiguous 621659 2371 152591 UnstrandedReadsAssigned:27462544 PositiveStrandReadsAssigned:648568 NegativeStrandReadsAssigned:27754884 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389874 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389874-trimmed-pair1.fastq SRR11389874-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,888,436 reads, 28,423,234 reads pseudoaligned [quant] estimated average fragment length: 210.109 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 SRR11389874.ke.tsv 35125 SRR11389874.se.tsv 88098 total ==> SRR11389874.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 727.022 40.6783 2.58014 PNS24247 1044 834.891 22.1386 1.22278 PNS24249 1928 1718.89 196.786 5.27926 PNS24246 1044 834.891 22.1386 1.22278 PNS24248 1044 834.891 22.1386 1.22278 PNS24244 1471 1261.89 9.12014 0.333279 PNS24243 293 103.188 0 0 KQK14069 1603 1393.89 241 7.9729 KQK14071 474 267.267 0 0 ==> SRR11389874.se.tsv <== BRADI_1g14170v3 242 BRADI_1g53295v3 12 BRADI_1g59795v3 146 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 320 BRADI_1g74790v3 170 BRADI_1g09890v3 0 BRADI_1g77505v3 280 BRADI_1g48960v3 0 SRR11389874 completed mapping pipeline successfully