Starting /dee2/code/volunteer_pipeline.sh SRR11389875 current disk space = 1544467787776 free memory = 1602658604 SRR11389875 SRAfilesize 1ec2ce300f6615be4a732dd33ead5a38 SRR11389875.sra SRR11389875.sra file validated SRR11389875 is paired end SRR11389875 is conventional basespace SRR11389875 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389875_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2025 32.0 32.0 32.0 32.0 32.0 2 31.22625 32.0 32.0 32.0 32.0 32.0 3 31.17 32.0 32.0 32.0 32.0 32.0 4 31.2845 32.0 32.0 32.0 32.0 32.0 5 31.299 32.0 32.0 32.0 32.0 32.0 6 33.72725 36.0 36.0 36.0 32.0 36.0 7 34.31925 36.0 36.0 36.0 32.0 36.0 8 34.163 36.0 36.0 36.0 32.0 36.0 9 34.31625 36.0 36.0 36.0 32.0 36.0 10-11 34.254875 36.0 36.0 36.0 32.0 36.0 12-13 34.178375 36.0 36.0 36.0 32.0 36.0 14-15 34.236999999999995 36.0 36.0 36.0 32.0 36.0 16-17 34.144625000000005 36.0 36.0 36.0 32.0 36.0 18-19 34.04625 36.0 36.0 36.0 32.0 36.0 20-21 33.917 36.0 36.0 36.0 32.0 36.0 22-23 33.891125 36.0 36.0 36.0 32.0 36.0 24-25 33.74275 36.0 36.0 36.0 29.5 36.0 26-27 33.587999999999994 36.0 36.0 36.0 29.5 36.0 28-29 33.614000000000004 36.0 36.0 36.0 29.5 36.0 30-31 33.429 36.0 36.0 36.0 27.0 36.0 32-33 33.382 36.0 36.0 36.0 27.0 36.0 34-35 33.44525 36.0 36.0 36.0 29.5 36.0 36-37 33.426606651662915 36.0 36.0 36.0 27.0 36.0 38-39 33.164176862124485 36.0 36.0 36.0 17.5 36.0 40-41 33.348174087043525 36.0 36.0 36.0 27.0 36.0 42-43 33.122561280640326 36.0 36.0 36.0 17.5 36.0 44-45 33.17146073036518 36.0 36.0 36.0 27.0 36.0 46-47 33.042563135922315 36.0 36.0 36.0 17.5 36.0 48-49 32.66445556946182 36.0 32.0 36.0 14.0 36.0 50-51 32.79148936170213 36.0 36.0 36.0 14.0 36.0 52-53 32.61977471839799 36.0 32.0 36.0 14.0 36.0 54-55 32.691989987484355 36.0 34.0 36.0 14.0 36.0 56-57 32.8936170212766 36.0 32.0 36.0 14.0 36.0 58-59 32.48485607008761 36.0 32.0 36.0 14.0 36.0 60-61 32.13761582769847 36.0 32.0 36.0 14.0 36.0 62-63 32.07950323386568 36.0 32.0 36.0 14.0 36.0 64-65 31.860689463366725 36.0 32.0 36.0 14.0 36.0 66-67 31.558998567525087 36.0 32.0 36.0 14.0 36.0 68-69 31.556057185854026 36.0 32.0 36.0 14.0 36.0 70-71 31.43330319858526 36.0 32.0 36.0 14.0 36.0 72-73 31.375623257612556 36.0 32.0 36.0 14.0 36.0 74-75 31.014632625211636 36.0 32.0 36.0 14.0 36.0 76 30.083752695902227 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 6.0 25 19.0 26 32.0 27 67.0 28 121.0 29 189.0 30 255.0 31 393.0 32 536.0 33 819.0 34 1153.0 35 406.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.408852213053265 9.402350587646911 9.402350587646911 45.78644661165291 2 28.532133033258315 9.802450612653162 37.2093023255814 24.456114028507127 3 25.95648912228057 16.90422605651413 20.205051262815704 36.93423355838959 4 31.30782695673918 23.755938984746187 18.104526131532882 26.831707926981746 5 29.607401850462615 26.03150787696924 22.680670167541887 21.680420105026258 6 25.278622087132725 30.344478216818644 22.112462006079028 22.264437689969604 7 20.630157539384847 23.005751437859466 34.658664666166544 21.705426356589147 8 21.280320080020005 20.880220055013755 30.48262065516379 27.35683920980245 9 21.555388847211805 18.35458864716179 32.208052013003254 27.881970492623154 10-11 24.831207801950487 27.369342335583895 22.355588897224308 25.44386096524131 12-13 26.11902975743936 21.742935733933482 23.455863965991497 28.68217054263566 14-15 26.056514128532132 23.705926481620406 24.63115778944736 25.6064016004001 16-17 26.106526631657918 22.868217054263564 23.093273318329583 27.93198299574894 18-19 25.818954738684667 22.518129532383096 24.58114528632158 27.081770442610654 20-21 25.756439109777446 22.930732683170792 24.15603900975244 27.156789197299325 22-23 25.806451612903224 22.74318579644911 23.818454613653415 27.631907976994246 24-25 25.95648912228057 22.718179544886222 23.55588897224306 27.769442360590148 26-27 26.281570392598148 22.793198299574893 23.568392098024507 27.35683920980245 28-29 25.95648912228057 23.643410852713178 23.40585146286572 26.994248562140534 30-31 25.006251562890725 24.06851712928232 23.793448362090523 27.131782945736433 32-33 25.23130782695674 23.030757689422355 24.643660915228807 27.094273568392097 34-35 26.094023505876468 22.843210802700675 24.431107776944234 26.63165791447862 36-37 25.418854713678417 22.768192048012004 23.455863965991497 28.35708927231808 38-39 25.75965987245217 22.921095410779042 23.77141428035513 27.547830436413655 40-41 25.512756378189096 23.649324662331164 23.961980990495245 26.87593796898449 42-43 25.544158118588946 22.779584688516387 24.20565424068051 27.47060295221416 44-45 25.71285642821411 23.261630815407706 24.212106053026513 26.813406703351678 46-47 26.1195896922692 23.967975981986488 22.52939704778584 27.383037277958465 48-49 25.06883604505632 23.429286608260323 23.14142678347935 28.360450563204004 50-51 26.5081351689612 23.654568210262827 23.2540675844806 26.583229036295368 52-53 26.132665832290364 23.229036295369212 23.391739674593243 27.246558197747184 54-55 25.14392991239049 23.541927409261575 23.491864831038797 27.822277847309135 56-57 26.107634543178975 22.84105131414268 22.853566958698373 28.197747183979978 58-59 25.707133917396746 23.429286608260323 23.642052565707132 27.221526908635795 60-61 26.13323315802655 22.05108940646131 23.42849987478087 28.38717756073128 62-63 25.347526612398248 23.368816530995616 23.95742016280526 27.326236693800876 64-65 26.982337467117624 22.79844669923588 22.021796317173994 28.197419516472504 66-67 26.52626300614266 22.81559483515106 22.539801930550333 28.118340228155947 68-69 26.874843240531725 22.72385252069225 23.187860546777024 27.213443691998997 70-71 25.95659264835027 24.099861999749088 22.933132605695647 27.01041274620499 72-73 25.918470055359837 23.163059889280323 23.07498741821842 27.84348263714142 74-75 26.47563713191602 19.199788723095207 25.340023768651786 28.984550376336987 76 29.18763479511143 0.0 31.488138030194108 39.324227174694464 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 2.0 27 5.0 28 6.5 29 5.0 30 9.0 31 14.5 32 17.5 33 20.5 34 33.0 35 40.5 36 44.5 37 61.0 38 86.5 39 114.5 40 132.0 41 139.0 42 139.0 43 156.5 44 182.5 45 185.0 46 187.0 47 201.0 48 199.0 49 175.5 50 162.5 51 156.0 52 145.5 53 145.5 54 143.0 55 131.5 56 128.0 57 128.5 58 129.0 59 142.5 60 141.5 61 131.5 62 133.0 63 129.0 64 120.5 65 112.0 66 108.0 67 113.0 68 110.0 69 94.0 70 74.0 71 60.5 72 60.0 73 59.0 74 45.0 75 34.0 76 34.0 77 32.0 78 21.0 79 13.5 80 11.5 81 6.0 82 4.5 83 5.0 84 4.0 85 2.5 86 1.5 87 1.0 88 0.5 89 1.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 1.3 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.02501250625312656 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 2.0 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 2.0 60 0.0 61 0.0 62 1.0 63 0.0 64 1.0 65 2.0 66 1.0 67 1.0 68 0.0 69 1.0 70 1.0 71 4.0 72 14.0 73 55.0 74 251.0 75 879.0 76 2782.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98862199747155 97.875 2 0.9102402022756004 1.7999999999999998 3 0.07585335018963338 0.22499999999999998 4 0.025284450063211124 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389875 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389875_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.819 32.0 32.0 32.0 32.0 32.0 2 30.6645 32.0 32.0 32.0 32.0 32.0 3 30.425 32.0 32.0 32.0 32.0 32.0 4 30.425 32.0 32.0 32.0 32.0 32.0 5 30.4535 32.0 32.0 32.0 32.0 32.0 6 33.55775 36.0 36.0 36.0 21.0 36.0 7 33.6525 36.0 36.0 36.0 32.0 36.0 8 33.53025 36.0 36.0 36.0 32.0 36.0 9 33.54775 36.0 36.0 36.0 32.0 36.0 10-11 33.447125 36.0 36.0 36.0 21.0 36.0 12-13 33.3475 36.0 36.0 36.0 21.0 36.0 14-15 33.36825 36.0 36.0 36.0 21.0 36.0 16-17 33.276624999999996 36.0 36.0 36.0 21.0 36.0 18-19 33.018625 36.0 36.0 36.0 17.5 36.0 20-21 33.040499999999994 36.0 36.0 36.0 21.0 36.0 22-23 33.003249999999994 36.0 36.0 36.0 17.5 36.0 24-25 32.935 36.0 36.0 36.0 17.5 36.0 26-27 32.936125000000004 36.0 36.0 36.0 14.0 36.0 28-29 32.76875 36.0 36.0 36.0 14.0 36.0 30-31 32.8785 36.0 36.0 36.0 14.0 36.0 32-33 32.704750000000004 36.0 36.0 36.0 14.0 36.0 34-35 32.727125 36.0 36.0 36.0 14.0 36.0 36-37 32.300425958406414 36.0 34.0 36.0 14.0 36.0 38-39 32.388823662765034 36.0 32.0 36.0 14.0 36.0 40-41 32.211528822055136 36.0 32.0 36.0 14.0 36.0 42-43 32.38305339684131 36.0 32.0 36.0 14.0 36.0 44-45 32.316119328152425 36.0 32.0 36.0 14.0 36.0 46-47 32.25394107561017 36.0 32.0 36.0 14.0 36.0 48-49 32.17754077791719 36.0 32.0 36.0 14.0 36.0 50-51 31.844040150564616 36.0 32.0 36.0 14.0 36.0 52-53 31.624843161856965 36.0 32.0 36.0 14.0 36.0 54-55 31.65934755332497 36.0 32.0 36.0 14.0 36.0 56-57 31.651693851944792 36.0 32.0 36.0 14.0 36.0 58-59 31.388240949998234 36.0 32.0 36.0 14.0 36.0 60-61 31.18897538925163 36.0 32.0 36.0 14.0 36.0 62-63 30.878571885466513 36.0 32.0 36.0 14.0 36.0 64-65 30.856423634121374 36.0 32.0 36.0 14.0 36.0 66-67 30.761597873501543 36.0 29.5 36.0 14.0 36.0 68-69 30.92606534985624 36.0 32.0 36.0 14.0 36.0 70-71 30.701291554357592 36.0 27.0 36.0 14.0 36.0 72-73 30.311734071256538 36.0 27.0 36.0 14.0 36.0 74-75 30.563013287627 36.0 27.0 36.0 14.0 36.0 76 29.350165868042758 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 5.0 5 0.0 6 2.0 7 2.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 4.0 16 3.0 17 0.0 18 2.0 19 5.0 20 6.0 21 5.0 22 13.0 23 18.0 24 42.0 25 62.0 26 82.0 27 125.0 28 151.0 29 227.0 30 307.0 31 390.0 32 530.0 33 732.0 34 931.0 35 341.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.543723377599598 19.143071911801552 8.74467551991982 41.56852919067903 2 32.280701754385966 23.709273182957393 28.37092731829574 15.639097744360903 3 24.486215538847116 27.518796992481203 19.724310776942357 28.270676691729324 4 29.416186419443747 29.5665246805312 15.88574292157354 25.131545978451513 5 31.621147582059635 30.593836131295415 17.815083938862443 19.96993234778251 6 22.876472062139815 33.29992483086946 18.767226259082936 25.056376847907792 7 22.202709483191168 16.38233818364275 33.968891118916204 27.446061214249873 8 24.52309236947791 20.758032128514056 23.970883534136547 30.747991967871485 9 24.604171902488062 19.05001256597135 27.821060567981903 28.524754963558685 10-11 28.582221102996723 25.912868295139763 18.698060941828253 26.806849660035255 12-13 27.539332913782253 20.490874764002516 23.91441157960982 28.05538074260541 14-15 27.20736629667003 21.94752774974773 23.625126135216952 27.219979818365285 16-17 27.767969735182852 23.026481715006305 22.06809583858764 27.137452711223204 18-19 25.841846386681798 22.512296632614454 23.43296758733762 28.212889393366126 20-21 26.97152935248173 23.343411438649532 22.625346434870245 27.05971277399849 22-23 28.082105528271 22.994585064853293 21.458254627880617 27.46505477899509 24-25 26.956959476466146 23.91140196325195 22.829096400704756 26.302542159577147 26-27 27.617010568696525 24.559637644690486 21.477101157523908 26.34625062908908 28-29 27.333333333333332 23.69811320754717 21.20754716981132 27.761006289308177 30-31 26.578616352201255 24.0 22.38993710691824 27.031446540880506 32-33 27.10010060362173 24.20774647887324 22.39688128772636 26.29527162977867 34-35 28.70614862316107 23.236514522821576 21.652206714447377 26.40513013956997 36-37 26.628930817610062 22.930817610062892 23.132075471698112 27.308176100628927 38-39 27.182389937106915 23.89937106918239 22.364779874213838 26.553459119496853 40-41 27.334507928517493 23.080795368738986 21.998489806191795 27.586206896551722 42-43 27.502515090543262 23.06338028169014 22.748993963782695 26.685110663983902 44-45 27.14573370249182 24.04983639567078 21.96073496098666 26.843694940850742 46-47 27.73722627737226 23.659702995217717 21.545431663730177 27.05763906367984 48-49 27.087525150905435 23.717303822937627 21.554325955734406 27.640845070422536 50-51 27.75541016607952 22.99949672873679 22.949169602415704 26.29592350276799 52-53 27.80923618975714 23.32955832389581 21.869888008053355 26.9913174782937 54-55 27.032136105860115 23.868935097668555 22.07939508506616 27.01953371140517 56-57 27.778478617383623 23.918254068373912 22.265674277784786 26.03759303645767 58-59 27.94803884474713 22.878042628326398 21.717744986757474 27.456173540168997 60-61 25.858152448258455 25.012619888944975 22.084805653710244 27.044422009086322 62-63 28.708617639625977 23.21202931513773 21.695729087692698 26.383623957543595 64-65 28.769891386713812 22.972972972972975 22.051022985602426 26.206112654710783 66-67 27.677557714141543 23.199192632774064 22.164753374542702 26.958496278541695 68-69 27.444556451612907 23.4375 22.467237903225808 26.65070564516129 70-71 27.284183994959044 23.780718336483933 22.104599873976056 26.83049779458097 72-73 27.309541888129583 22.728423184004047 23.48772462667679 26.474310301189576 74-75 28.630872483221477 20.13422818791946 23.59731543624161 27.63758389261745 76 28.418329637841833 0.0 31.1529933481153 40.42867701404287 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 11.0 1 5.5 2 0.0 3 2.5 4 5.0 5 3.0 6 2.0 7 1.5 8 1.0 9 2.0 10 2.0 11 1.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 2.5 25 4.5 26 2.5 27 6.5 28 11.0 29 8.5 30 12.5 31 19.0 32 19.5 33 18.0 34 24.5 35 38.0 36 46.5 37 53.0 38 67.5 39 91.5 40 121.0 41 138.5 42 139.5 43 138.5 44 154.5 45 169.0 46 167.0 47 166.5 48 165.0 49 165.0 50 160.0 51 155.0 52 152.5 53 141.5 54 140.0 55 154.5 56 149.0 57 147.0 58 153.5 59 141.0 60 136.5 61 137.5 62 144.0 63 137.0 64 120.5 65 120.0 66 116.5 67 115.5 68 114.0 69 94.0 70 77.5 71 76.0 72 80.0 73 74.0 74 53.5 75 40.5 76 39.5 77 33.0 78 21.0 79 15.5 80 14.0 81 11.0 82 6.0 83 2.5 84 3.0 85 3.5 86 2.5 87 1.5 88 0.5 89 1.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.5 99 2.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.25 3 0.25 4 0.22499999999999998 5 0.22499999999999998 6 0.22499999999999998 7 0.35000000000000003 8 0.4 9 0.525 10-11 0.7250000000000001 12-13 0.6875 14-15 0.8999999999999999 16-17 0.8750000000000001 18-19 0.8875 20-21 0.775 22-23 0.7374999999999999 24-25 0.675 26-27 0.65 28-29 0.625 30-31 0.625 32-33 0.6 34-35 0.5875 36-37 0.4009020295665247 38-39 0.38842250344568346 40-41 0.4260651629072682 42-43 0.32589621459012286 44-45 0.4011030333416896 46-47 0.3511412089290193 48-49 0.2258469259723965 50-51 0.27603513174404015 52-53 0.28858218318695106 54-55 0.43914680050188204 56-57 0.5395232120451694 58-59 0.5019450370184465 60-61 0.5022601707684581 62-63 0.6153459751349993 64-65 0.5401331491018717 66-67 0.37702651753173305 68-69 0.21375581541556646 70-71 0.2012325493648598 72-73 0.2020712301086133 74-75 0.18756698821007503 76 0.2580169553999263 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 9.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 1.0 42 0.0 43 0.0 44 0.0 45 1.0 46 2.0 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 2.0 60 0.0 61 0.0 62 1.0 63 0.0 64 1.0 65 1.0 66 1.0 67 1.0 68 1.0 69 0.0 70 1.0 71 4.0 72 24.0 73 76.0 74 278.0 75 880.0 76 2713.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.65208545269583 96.975 2 1.1698880976602237 2.3 3 0.10172939979654119 0.3 4 0.050864699898270596 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025432349949135298 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801937 spots for SRR11389875.sra Written 1801937 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra Read 1801924 spots for SRR11389875.sra Written 1801924 spots for SRR11389875.sra SRR ids: ['SRR11389875.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4buz8mfu SRR11389875.sra spots: 36038493 blocks: [[1, 1801924], [1801925, 3603848], [3603849, 5405772], [5405773, 7207696], [7207697, 9009620], [9009621, 10811544], [10811545, 12613468], [12613469, 14415392], [14415393, 16217316], [16217317, 18019240], [18019241, 19821164], [19821165, 21623088], [21623089, 23425012], [23425013, 25226936], [25226937, 27028860], [27028861, 28830784], [28830785, 30632708], [30632709, 32434632], [32434633, 34236556], [34236557, 36038493]] SRR11389875 file size 6878467 SRR11389875 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389875 SRR11389875_1.fastq SRR11389875_2.fastq Input file: SRR11389875_1.fastq Paired file: SRR11389875_2.fastq trimmed: SRR11389875-trimmed-pair1.fastq, SRR11389875-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:48:53 2024 >> started Sat Dec 7 08:49:25 2024 >> done (32.116s) 36038493 read pairs processed; of these: 294 ( 0.00%) short read pairs filtered out after trimming by size control 21878 ( 0.06%) empty read pairs filtered out after trimming by size control 36016321 (99.94%) read pairs available; of these: 13341 ( 0.04%) trimmed read pairs available after processing 36002980 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 5 0.00% 21 5 0.00% 22 7 0.00% 23 5 0.00% 24 6 0.00% 25 19 0.00% 26 11 0.00% 27 16 0.00% 28 12 0.00% 29 13 0.00% 30 21 0.00% 31 22 0.00% 32 18 0.00% 33 24 0.00% 34 14 0.00% 35 553 0.00% 36 597 0.00% 37 673 0.00% 38 788 0.00% 39 842 0.00% 40 951 0.00% 41 1022 0.00% 42 1254 0.00% 43 1319 0.00% 44 1467 0.00% 45 1560 0.00% 46 1582 0.00% 47 1718 0.00% 48 1856 0.01% 49 2026 0.01% 50 2164 0.01% 51 2272 0.01% 52 2553 0.01% 53 2824 0.01% 54 3078 0.01% 55 3534 0.01% 56 3801 0.01% 57 4156 0.01% 58 4379 0.01% 59 4797 0.01% 60 5006 0.01% 61 5482 0.02% 62 5753 0.02% 63 6341 0.02% 64 7008 0.02% 65 7577 0.02% 66 8242 0.02% 67 9149 0.03% 68 9135 0.03% 69 10307 0.03% 70 11814 0.03% 71 15996 0.04% 72 37363 0.10% 73 280517 0.78% 74 2389509 6.63% 75 15380744 42.70% 76 17774406 49.35% 36016321 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=22 prefix-density=0.34 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.18 sequence-density-rank=8 fanout-score=49.23 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=10.3 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.32 fanout-score-rank=18 prefix-density=0.31 prefix-fanout=4.0 sequence=AAGGAGATCAAGAACGGCCGCCTCGCCATGTTCTCCATGTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=21 fanout-score=154.80 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=18.4 sequence=CCGCCGCCGCCA SRR11389875 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:50:12 Started mapping on | Dec 07 08:50:12 Finished on | Dec 07 08:52:32 Mapping speed, Million of reads per hour | 926.13 Number of input reads | 36016321 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 33662638 Uniquely mapped reads % | 93.46% Average mapped length | 150.21 Number of splices: Total | 15191856 Number of splices: Annotated (sjdb) | 14522836 Number of splices: GT/AG | 14992300 Number of splices: GC/AG | 177120 Number of splices: AT/AC | 4445 Number of splices: Non-canonical | 17991 Mismatch rate per base, % | 0.90% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.00% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 998281 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 97940 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.58% % of reads unmapped: other | 0.91% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1355402 1355402 1355402 N_multimapping 998281 998281 998281 N_noFeature 782957 32848103 1021145 N_ambiguous 712312 3120 141901 UnstrandedReadsAssigned:32167369 PositiveStrandReadsAssigned:811415 NegativeStrandReadsAssigned:32499592 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389875 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389875-trimmed-pair1.fastq SRR11389875-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,016,321 reads, 33,088,016 reads pseudoaligned [quant] estimated average fragment length: 203.22 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,236 rounds 52973 SRR11389875.ke.tsv 35125 SRR11389875.se.tsv 88098 total ==> SRR11389875.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 733.887 33.4821 1.92543 PNS24247 1044 841.78 33.1384 1.66141 PNS24249 1928 1725.78 306.75 7.50142 PNS24246 1044 841.78 33.1384 1.66141 PNS24248 1044 841.78 33.1384 1.66141 PNS24244 1471 1268.78 28.3529 0.943094 PNS24243 293 109.103 0 0 KQK14069 1603 1400.78 145.748 4.39114 KQK14071 474 274.223 3.92327 0.603794 ==> SRR11389875.se.tsv <== BRADI_1g14170v3 173 BRADI_1g53295v3 30 BRADI_1g59795v3 299 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 256 BRADI_1g74790v3 366 BRADI_1g09890v3 2 BRADI_1g77505v3 424 BRADI_1g48960v3 0 SRR11389875 completed mapping pipeline successfully