Starting /dee2/code/volunteer_pipeline.sh SRR11389876 current disk space = 1544403779584 free memory = 1602629568 SRR11389876 SRAfilesize c818d661b81eff5bfe23ab1886607dca SRR11389876.sra SRR11389876.sra file validated SRR11389876 is paired end SRR11389876 is conventional basespace SRR11389876 read1 length is 53-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389876_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 53-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2025 32.0 32.0 32.0 32.0 32.0 2 31.34025 32.0 32.0 32.0 32.0 32.0 3 31.231 32.0 32.0 32.0 32.0 32.0 4 31.32 32.0 32.0 32.0 32.0 32.0 5 31.364 32.0 32.0 32.0 32.0 32.0 6 34.07325 36.0 36.0 36.0 32.0 36.0 7 34.309 36.0 36.0 36.0 32.0 36.0 8 34.269 36.0 36.0 36.0 32.0 36.0 9 34.44 36.0 36.0 36.0 32.0 36.0 10-11 34.2615 36.0 36.0 36.0 32.0 36.0 12-13 34.39149999999999 36.0 36.0 36.0 32.0 36.0 14-15 34.267875000000004 36.0 36.0 36.0 32.0 36.0 16-17 34.20975 36.0 36.0 36.0 32.0 36.0 18-19 34.051625 36.0 36.0 36.0 32.0 36.0 20-21 34.135875 36.0 36.0 36.0 32.0 36.0 22-23 33.959125 36.0 36.0 36.0 32.0 36.0 24-25 33.919375 36.0 36.0 36.0 32.0 36.0 26-27 33.61425 36.0 36.0 36.0 29.5 36.0 28-29 33.662499999999994 36.0 36.0 36.0 32.0 36.0 30-31 33.592625 36.0 36.0 36.0 27.0 36.0 32-33 33.58925 36.0 36.0 36.0 29.5 36.0 34-35 33.406375 36.0 36.0 36.0 27.0 36.0 36-37 33.498374999999996 36.0 36.0 36.0 29.5 36.0 38-39 33.39375 36.0 36.0 36.0 27.0 36.0 40-41 33.28975 36.0 36.0 36.0 27.0 36.0 42-43 33.331125 36.0 36.0 36.0 24.0 36.0 44-45 33.266999999999996 36.0 36.0 36.0 27.0 36.0 46-47 33.051500000000004 36.0 36.0 36.0 14.0 36.0 48-49 32.884125 36.0 36.0 36.0 21.0 36.0 50-51 32.892625 36.0 32.0 36.0 14.0 36.0 52-53 32.71525 36.0 36.0 36.0 14.0 36.0 54-55 32.73193298324581 36.0 32.0 36.0 14.0 36.0 56-57 32.80395098774694 36.0 32.0 36.0 14.0 36.0 58-59 32.75007306004766 36.0 32.0 36.0 14.0 36.0 60-61 32.091190233265536 36.0 32.0 36.0 14.0 36.0 62-63 32.017897371714646 36.0 32.0 36.0 14.0 36.0 64-65 31.83637956935403 36.0 32.0 36.0 14.0 36.0 66-67 31.77222639619334 36.0 32.0 36.0 14.0 36.0 68-69 31.442189412634434 36.0 32.0 36.0 14.0 36.0 70-71 31.739716748706634 36.0 32.0 36.0 14.0 36.0 72-73 31.516334765554383 36.0 32.0 36.0 14.0 36.0 74-75 31.258371781583072 36.0 32.0 36.0 14.0 36.0 76 29.88656504785537 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 4.0 24 8.0 25 21.0 26 25.0 27 63.0 28 98.0 29 168.0 30 268.0 31 334.0 32 557.0 33 884.0 34 1107.0 35 462.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.5 10.174999999999999 9.475 43.85 2 28.075 10.775 37.75 23.400000000000002 3 26.400000000000002 16.775000000000002 19.55 37.275000000000006 4 33.35 22.400000000000002 17.549999999999997 26.700000000000003 5 30.025000000000002 26.05 23.025000000000002 20.9 6 25.264750378214828 27.93746848209783 24.357034795763994 22.440746343923347 7 17.675 22.400000000000002 37.65 22.275 8 21.575 21.099999999999998 31.2 26.125 9 21.575 18.175 32.25 28.000000000000004 10-11 24.9 29.2 21.7875 24.1125 12-13 26.0 21.637500000000003 24.25 28.1125 14-15 25.837500000000002 22.925 24.75 26.487500000000004 16-17 26.075 22.6875 24.6875 26.55 18-19 25.4 23.400000000000002 23.400000000000002 27.800000000000004 20-21 26.5625 23.599999999999998 24.0625 25.775 22-23 25.5375 24.2 22.75 27.5125 24-25 25.2625 23.5125 24.025 27.200000000000003 26-27 24.925 23.0875 24.375 27.6125 28-29 26.650000000000002 23.35 23.2125 26.787499999999998 30-31 25.35 23.7125 23.549999999999997 27.3875 32-33 25.3 22.8625 23.4875 28.349999999999998 34-35 25.374999999999996 22.9625 24.2 27.462500000000002 36-37 25.474999999999998 23.0625 22.9375 28.525 38-39 25.900000000000002 23.275000000000002 24.637500000000003 26.187500000000004 40-41 26.713356678339167 23.92446223111556 22.611305652826413 26.750875437718857 42-43 25.900900900900904 23.66116116116116 23.423423423423422 27.014514514514516 44-45 24.706176544136035 22.9057264316079 24.843710927731934 27.544386096524132 46-47 26.2625 23.65 22.6375 27.450000000000003 48-49 25.5625 23.05 23.8625 27.525 50-51 25.35 23.95 22.575 28.125 52-53 27.025 22.725 23.0625 27.187499999999996 54-55 25.381345336334082 22.643160790197552 23.55588897224306 28.419604901225306 56-57 25.49387346836709 23.10577644411103 24.143535883970994 27.25681420355089 58-59 26.579111944965604 22.28893058161351 23.389618511569733 27.74233896185116 60-61 25.209558363568124 23.32040535468535 23.095208307268862 28.374827974477668 62-63 27.04630788485607 22.002503128911137 23.892365456821025 27.058823529411764 64-65 26.464697045568354 22.84677015523285 23.00951427140711 27.679018527791687 66-67 25.870272977710997 23.29075882794891 23.541197094916104 27.29777109942399 68-69 26.111458985597995 23.40638697557921 23.656856606136508 26.825297432686284 70-71 26.055367656269574 23.512463985970186 22.861079794563448 27.571088563196795 72-73 26.53855815121829 22.49434815373022 22.645064054257723 28.322029640793772 74-75 27.602649006622514 19.76158940397351 24.370860927152318 28.26490066225166 76 29.91846862814605 0.0 32.32896136121943 37.75257001063453 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 2.0 22 3.0 23 3.0 24 2.5 25 4.0 26 4.5 27 5.0 28 7.0 29 8.5 30 14.0 31 20.5 32 24.5 33 31.5 34 44.0 35 54.0 36 61.5 37 71.5 38 83.5 39 104.5 40 122.0 41 144.0 42 161.5 43 164.0 44 179.0 45 177.5 46 169.0 47 186.0 48 177.0 49 155.0 50 149.0 51 147.0 52 147.0 53 134.0 54 122.0 55 129.5 56 140.5 57 125.0 58 105.0 59 121.0 60 141.0 61 137.0 62 129.5 63 117.0 64 115.0 65 117.0 66 112.5 67 116.0 68 117.5 69 106.5 70 86.0 71 76.5 72 77.0 73 60.5 74 46.0 75 48.0 76 42.0 77 28.5 78 18.5 79 15.0 80 13.0 81 9.5 82 7.0 83 7.0 84 5.0 85 2.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.8500000000000001 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.05 42-43 0.1 44-45 0.025 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 53 1.0 54 0.0 55 0.0 56 0.0 57 1.0 58 1.0 59 0.0 60 1.0 61 1.0 62 0.0 63 1.0 64 0.0 65 1.0 66 0.0 67 0.0 68 1.0 69 0.0 70 1.0 71 6.0 72 8.0 73 70.0 74 264.0 75 822.0 76 2821.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.55146124523507 96.95 2 1.2706480304955527 2.5 3 0.15247776365946633 0.44999999999999996 4 0.025412960609911054 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGGGC 15 0.0021058735 69.662506 52 >>END_MODULE SRR11389876 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389876_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.73025 32.0 32.0 32.0 32.0 32.0 2 30.5125 32.0 32.0 32.0 32.0 32.0 3 30.311 32.0 32.0 32.0 32.0 32.0 4 30.3525 32.0 32.0 32.0 32.0 32.0 5 30.419 32.0 32.0 32.0 32.0 32.0 6 33.53575 36.0 36.0 36.0 21.0 36.0 7 33.5745 36.0 36.0 36.0 32.0 36.0 8 33.71425 36.0 36.0 36.0 32.0 36.0 9 33.62475 36.0 36.0 36.0 32.0 36.0 10-11 33.622 36.0 36.0 36.0 32.0 36.0 12-13 33.541624999999996 36.0 36.0 36.0 26.5 36.0 14-15 33.440875 36.0 36.0 36.0 26.5 36.0 16-17 33.267 36.0 36.0 36.0 21.0 36.0 18-19 33.132 36.0 36.0 36.0 21.0 36.0 20-21 33.110625 36.0 36.0 36.0 17.5 36.0 22-23 33.048125 36.0 36.0 36.0 21.0 36.0 24-25 32.979875 36.0 36.0 36.0 17.5 36.0 26-27 32.959625 36.0 36.0 36.0 14.0 36.0 28-29 32.972125 36.0 36.0 36.0 17.5 36.0 30-31 32.873000000000005 36.0 36.0 36.0 14.0 36.0 32-33 32.782375 36.0 36.0 36.0 14.0 36.0 34-35 32.67675 36.0 36.0 36.0 14.0 36.0 36-37 32.460912052117266 36.0 34.0 36.0 14.0 36.0 38-39 32.40541217739914 36.0 32.0 36.0 14.0 36.0 40-41 32.52560592159426 36.0 36.0 36.0 14.0 36.0 42-43 32.40526315789474 36.0 32.0 36.0 14.0 36.0 44-45 32.35551378446115 36.0 34.0 36.0 14.0 36.0 46-47 32.27832080200501 36.0 34.0 36.0 14.0 36.0 48-49 32.14085213032581 36.0 32.0 36.0 14.0 36.0 50-51 31.820175438596493 36.0 32.0 36.0 14.0 36.0 52-53 31.774937343358395 36.0 32.0 36.0 14.0 36.0 54-55 31.78265229380797 36.0 32.0 36.0 14.0 36.0 56-57 31.820757081975433 36.0 32.0 36.0 14.0 36.0 58-59 31.484513233706636 36.0 32.0 36.0 14.0 36.0 60-61 31.26714311477178 36.0 32.0 36.0 14.0 36.0 62-63 31.075658720200753 36.0 32.0 36.0 14.0 36.0 64-65 31.086094377510037 36.0 32.0 36.0 14.0 36.0 66-67 30.885638965603817 36.0 29.5 36.0 14.0 36.0 68-69 30.888665388927553 36.0 29.5 36.0 14.0 36.0 70-71 30.66417297900886 36.0 27.0 36.0 14.0 36.0 72-73 30.48763880561539 36.0 27.0 36.0 14.0 36.0 74-75 30.52222695657401 36.0 27.0 36.0 14.0 36.0 76 29.28734810578985 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 3.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 2.0 19 0.0 20 9.0 21 11.0 22 10.0 23 21.0 24 34.0 25 62.0 26 75.0 27 121.0 28 145.0 29 211.0 30 338.0 31 412.0 32 530.0 33 756.0 34 938.0 35 305.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.402056684223727 20.39127163280662 8.20165537998495 40.0050163029847 2 30.448959117130673 23.125156759468272 28.969149736644095 17.45673438675696 3 23.902683722096814 27.74015550539253 19.43817406571357 28.91898670679709 4 28.284854563691077 30.466399197592782 17.627883650952857 23.620862587763288 5 30.468554247055874 29.84214482585818 18.26609872212478 21.42320220496116 6 24.95615134051616 32.823853670759206 19.819594086695062 22.400400902029567 7 23.620862587763288 15.521564694082246 32.246740220661984 28.610832497492478 8 25.050150451354064 19.53360080240722 24.34804413239719 31.068204613841527 9 24.24090338770389 19.29736511919699 27.95483061480552 28.5069008782936 10-11 27.721280602636533 26.528562460765855 18.794726930320152 26.955430006277464 12-13 27.31609339693698 20.574943509917148 23.26136078332915 28.847602309816722 14-15 25.94547053649956 23.922603342128408 23.030531473803244 27.10139464756879 16-17 28.32914572864322 22.72613065326633 21.4321608040201 27.51256281407035 18-19 26.940467219291637 22.582265762371264 22.808339613162524 27.668927405174582 20-21 27.913108990457058 23.355097940733298 22.124560522350578 26.607232546459063 22-23 27.796610169491526 23.31450094161959 21.431261770244824 27.45762711864407 24-25 27.152899824253073 23.2237007280944 22.68390660306302 26.93949284458951 26-27 27.278433341702236 23.31157419030881 22.77178006527743 26.638212402711524 28-29 27.86844087371328 23.07306050715541 21.50389153904092 27.55460708009038 30-31 27.190559879487825 22.94752698970625 22.88476023098167 26.977152899824254 32-33 27.617373838814963 23.550087873462214 22.344966105950288 26.487572181772535 34-35 27.54205372834547 22.93497363796134 22.784333417022346 26.73863921667085 36-37 26.7762992719056 23.675621390911374 21.81772533266382 27.73035400451921 38-39 26.618975903614455 24.17168674698795 22.665662650602407 26.543674698795183 40-41 28.630601230074053 22.59319693736664 22.216643655077192 26.559558177482113 42-43 27.830780818478534 23.374340949033392 21.554104946020587 27.240773286467483 44-45 27.479286969620887 23.273914135074065 22.231985940246048 27.014812955059003 46-47 27.981421039417526 23.449661059502887 21.91815214662315 26.65076575445644 48-49 27.752696262854275 22.86180085277151 21.64534737898169 27.74015550539253 50-51 27.77708045688465 23.12037153257186 21.827538596711435 27.27500941383206 52-53 27.902598217647796 22.86933601104556 21.47608886657462 27.751976904732018 54-55 26.996484178804618 23.568558513309895 22.852837769964843 26.582119537920647 56-57 28.890842858937322 22.534857429971108 22.57254113804798 26.00175857304359 58-59 28.57142857142857 22.51539138082674 21.748963437617792 27.1642166101269 60-61 27.47266557747895 23.224833479954757 21.65388965690587 27.648611285660422 62-63 27.845554018362474 23.443592001006163 23.116589108288267 25.594264872343103 64-65 26.999496981891348 23.2897384305835 22.572937625754527 27.13782696177062 66-67 27.829476861167002 23.56639839034205 21.793259557344065 26.81086519114688 68-69 27.31615336266499 23.40666247642992 22.199874292897547 27.077309868007543 70-71 27.96077445310536 22.743273824490824 22.102087000251448 27.193864722152377 72-73 26.680141485598785 23.34512379989894 22.549267306720566 27.425467407781706 74-75 28.580928314935495 20.069158132730415 23.67336081925788 27.67655273307621 76 29.767441860465116 0.0 31.019677996422185 39.2128801431127 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 9.0 1 4.5 2 0.5 3 1.0 4 1.0 5 1.0 6 1.0 7 1.0 8 1.0 9 0.5 10 0.0 11 0.5 12 1.0 13 2.0 14 1.5 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 2.0 24 3.5 25 4.5 26 7.0 27 7.0 28 7.5 29 11.5 30 13.0 31 13.5 32 20.5 33 25.0 34 30.5 35 44.0 36 53.0 37 66.5 38 86.5 39 100.5 40 107.5 41 128.5 42 156.5 43 162.5 44 158.5 45 160.0 46 159.5 47 151.5 48 151.0 49 149.0 50 139.0 51 132.5 52 134.0 53 136.5 54 130.0 55 131.5 56 131.5 57 130.5 58 141.0 59 139.5 60 141.0 61 152.0 62 142.5 63 134.0 64 137.5 65 128.5 66 124.0 67 128.0 68 125.5 69 118.0 70 87.5 71 64.0 72 82.0 73 79.5 74 55.5 75 49.0 76 39.5 77 29.0 78 24.5 79 22.0 80 19.5 81 13.5 82 9.0 83 8.5 84 4.5 85 1.0 86 1.5 87 2.0 88 1.5 89 1.5 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 3.0 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.325 3 0.325 4 0.3 5 0.22499999999999998 6 0.22499999999999998 7 0.3 8 0.3 9 0.375 10-11 0.43750000000000006 12-13 0.42500000000000004 14-15 0.5125000000000001 16-17 0.5 18-19 0.475 20-21 0.44999999999999996 22-23 0.43750000000000006 24-25 0.42500000000000004 26-27 0.42500000000000004 28-29 0.42500000000000004 30-31 0.42500000000000004 32-33 0.42500000000000004 34-35 0.42500000000000004 36-37 0.20045101478326235 38-39 0.17539463793535454 40-41 0.17541661445934095 42-43 0.17543859649122806 44-45 0.17543859649122806 46-47 0.17543859649122806 48-49 0.07518796992481204 50-51 0.16290726817042606 52-53 0.16290726817042606 54-55 0.17548257708698922 56-57 0.21308598646277263 58-59 0.2006269592476489 60-61 0.20067728583970904 62-63 0.2383939774153074 64-65 0.2008032128514056 66-67 0.17574692442882248 68-69 0.12554927809165098 70-71 0.07537688442211055 72-73 0.11356466876971609 74-75 0.079734219269103 76 0.10721944245889921 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 9.0 36 0.0 37 0.0 38 0.0 39 0.0 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 1.0 58 1.0 59 0.0 60 1.0 61 1.0 62 0.0 63 1.0 64 0.0 65 1.0 66 0.0 67 0.0 68 1.0 69 0.0 70 4.0 71 4.0 72 23.0 73 61.0 74 255.0 75 837.0 76 2798.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62595419847328 96.89999999999999 2 1.2468193384223918 2.45 3 0.05089058524173028 0.15 4 0.0 0.0 5 0.02544529262086514 0.125 6 0.02544529262086514 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02544529262086514 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra Read 1324380 spots for SRR11389876.sra Written 1324380 spots for SRR11389876.sra SRR ids: ['SRR11389876.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w72222j6 SRR11389876.sra spots: 26487600 blocks: [[1, 1324380], [1324381, 2648760], [2648761, 3973140], [3973141, 5297520], [5297521, 6621900], [6621901, 7946280], [7946281, 9270660], [9270661, 10595040], [10595041, 11919420], [11919421, 13243800], [13243801, 14568180], [14568181, 15892560], [15892561, 17216940], [17216941, 18541320], [18541321, 19865700], [19865701, 21190080], [21190081, 22514460], [22514461, 23838840], [23838841, 25163220], [25163221, 26487600]] SRR11389876 file size 5051658 SRR11389876 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389876 SRR11389876_1.fastq SRR11389876_2.fastq Input file: SRR11389876_1.fastq Paired file: SRR11389876_2.fastq trimmed: SRR11389876-trimmed-pair1.fastq, SRR11389876-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:50:11 2024 >> started Sat Dec 7 08:50:32 2024 >> done (21.412s) 26487600 read pairs processed; of these: 214 ( 0.00%) short read pairs filtered out after trimming by size control 9758 ( 0.04%) empty read pairs filtered out after trimming by size control 26477628 (99.96%) read pairs available; of these: 12287 ( 0.05%) trimmed read pairs available after processing 26465341 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 10 0.00% 21 3 0.00% 22 5 0.00% 23 11 0.00% 24 9 0.00% 25 15 0.00% 26 19 0.00% 27 18 0.00% 28 20 0.00% 29 17 0.00% 30 25 0.00% 31 25 0.00% 32 27 0.00% 33 24 0.00% 34 22 0.00% 35 248 0.00% 36 232 0.00% 37 272 0.00% 38 303 0.00% 39 324 0.00% 40 415 0.00% 41 438 0.00% 42 490 0.00% 43 486 0.00% 44 509 0.00% 45 584 0.00% 46 545 0.00% 47 622 0.00% 48 677 0.00% 49 696 0.00% 50 756 0.00% 51 821 0.00% 52 980 0.00% 53 946 0.00% 54 1020 0.00% 55 1128 0.00% 56 1247 0.00% 57 1433 0.01% 58 1467 0.01% 59 1622 0.01% 60 1731 0.01% 61 1656 0.01% 62 1910 0.01% 63 2095 0.01% 64 2274 0.01% 65 2387 0.01% 66 2716 0.01% 67 2976 0.01% 68 2961 0.01% 69 3231 0.01% 70 4155 0.02% 71 6017 0.02% 72 23139 0.09% 73 202291 0.76% 74 1724155 6.51% 75 11295649 42.66% 76 13179769 49.78% 26477628 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.56 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=26 fanout-score=9.31 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=4.7 sequence=GCGCCGAGCATGGCCCA criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=14 prefix-density=0.70 prefix-fanout=2.5 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=156.98 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=2.3 sequence=CCGCTCCAACACTTCAGTTCTCACTCCACAGCTCAGAGTCAGAGCTACTAGCAATGGCAGCGGCGACCATGGCGCTCTCCTCCCCCGCGATGGCCGGCACCCCGGTGAAGGTCTCCAGGGCCACCCCCTTCGGCGAGGGCCGCATCAC SRR11389876 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:50:58 Started mapping on | Dec 07 08:50:59 Finished on | Dec 07 08:52:51 Mapping speed, Million of reads per hour | 851.07 Number of input reads | 26477628 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 24469599 Uniquely mapped reads % | 92.42% Average mapped length | 150.25 Number of splices: Total | 10611822 Number of splices: Annotated (sjdb) | 10199311 Number of splices: GT/AG | 10472181 Number of splices: GC/AG | 122566 Number of splices: AT/AC | 3576 Number of splices: Non-canonical | 13499 Mismatch rate per base, % | 0.95% Deletion rate per base | 0.01% Deletion average length | 1.87 Insertion rate per base | 0.00% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 929274 % of reads mapped to multiple loci | 3.51% Number of reads mapped to too many loci | 51054 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.21% % of reads unmapped: other | 0.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1078755 1078755 1078755 N_multimapping 929274 929274 929274 N_noFeature 561105 23932631 699591 N_ambiguous 534036 2264 140953 UnstrandedReadsAssigned:23374458 PositiveStrandReadsAssigned:534704 NegativeStrandReadsAssigned:23629055 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389876 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389876-trimmed-pair1.fastq SRR11389876-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,477,628 reads, 24,320,382 reads pseudoaligned [quant] estimated average fragment length: 218.625 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52973 SRR11389876.ke.tsv 35125 SRR11389876.se.tsv 88098 total ==> SRR11389876.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 718.615 20.7058 1.57278 PNS24247 1044 826.375 48.9078 3.23054 PNS24249 1928 1710.37 234.822 7.49413 PNS24246 1044 826.375 48.9078 3.23054 PNS24248 1044 826.375 48.9078 3.23054 PNS24244 1471 1253.37 22.7488 0.990722 PNS24243 293 97.3093 0 0 KQK14069 1603 1385.37 636.12 25.0637 KQK14071 474 259.687 56.2607 11.8257 ==> SRR11389876.se.tsv <== BRADI_1g14170v3 740 BRADI_1g53295v3 9 BRADI_1g59795v3 308 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 303 BRADI_1g74790v3 222 BRADI_1g09890v3 1 BRADI_1g77505v3 304 BRADI_1g48960v3 0 SRR11389876 completed mapping pipeline successfully