Starting /dee2/code/volunteer_pipeline.sh SRR11389877 current disk space = 1544393003008 free memory = 1476011404 SRR11389877 SRAfilesize cec4b2c8a0ec0f25c8a8f22ff1933046 SRR11389877.sra SRR11389877.sra file validated SRR11389877 is paired end SRR11389877 is conventional basespace SRR11389877 read1 length is 55-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389877_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 55-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4035 32.0 32.0 32.0 32.0 32.0 2 31.514 32.0 32.0 32.0 32.0 32.0 3 31.46325 32.0 32.0 32.0 32.0 32.0 4 31.55125 32.0 32.0 32.0 32.0 32.0 5 31.527 32.0 32.0 32.0 32.0 32.0 6 34.703 36.0 36.0 36.0 32.0 36.0 7 34.76375 36.0 36.0 36.0 32.0 36.0 8 34.75325 36.0 36.0 36.0 32.0 36.0 9 34.831 36.0 36.0 36.0 32.0 36.0 10-11 34.727875 36.0 36.0 36.0 32.0 36.0 12-13 34.8435 36.0 36.0 36.0 32.0 36.0 14-15 34.80175 36.0 36.0 36.0 32.0 36.0 16-17 34.671375 36.0 36.0 36.0 32.0 36.0 18-19 34.741 36.0 36.0 36.0 32.0 36.0 20-21 34.696125 36.0 36.0 36.0 32.0 36.0 22-23 34.674875 36.0 36.0 36.0 32.0 36.0 24-25 34.557625 36.0 36.0 36.0 32.0 36.0 26-27 34.433625 36.0 36.0 36.0 32.0 36.0 28-29 34.350875 36.0 36.0 36.0 32.0 36.0 30-31 34.401375 36.0 36.0 36.0 32.0 36.0 32-33 34.421875 36.0 36.0 36.0 32.0 36.0 34-35 34.459875 36.0 36.0 36.0 32.0 36.0 36-37 34.295625 36.0 36.0 36.0 32.0 36.0 38-39 34.257875 36.0 36.0 36.0 32.0 36.0 40-41 34.215875 36.0 36.0 36.0 32.0 36.0 42-43 34.267250000000004 36.0 36.0 36.0 32.0 36.0 44-45 34.08625 36.0 36.0 36.0 32.0 36.0 46-47 34.06975 36.0 36.0 36.0 32.0 36.0 48-49 34.163125 36.0 36.0 36.0 32.0 36.0 50-51 33.973124999999996 36.0 36.0 36.0 32.0 36.0 52-53 34.01075 36.0 36.0 36.0 32.0 36.0 54-55 33.871875 36.0 36.0 36.0 29.5 36.0 56-57 33.986252753783745 36.0 36.0 36.0 32.0 36.0 58-59 33.94584792396198 36.0 36.0 36.0 29.5 36.0 60-61 33.55590295147574 36.0 36.0 36.0 27.0 36.0 62-63 33.71335667833917 36.0 36.0 36.0 27.0 36.0 64-65 33.43812764478264 36.0 36.0 36.0 27.0 36.0 66-67 33.384105131414266 36.0 34.0 36.0 27.0 36.0 68-69 33.22984476715072 36.0 32.0 36.0 27.0 36.0 70-71 33.215991635248464 36.0 32.0 36.0 27.0 36.0 72-73 33.30143849004074 36.0 34.0 36.0 27.0 36.0 74-75 33.20577918158476 36.0 32.0 36.0 27.0 36.0 76 32.39985719385933 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 2.0 24 3.0 25 4.0 26 23.0 27 31.0 28 52.0 29 92.0 30 113.0 31 180.0 32 300.0 33 545.0 34 1267.0 35 1385.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.2 10.4 9.6 41.8 2 27.800000000000004 9.700000000000001 37.8 24.7 3 27.125 16.7 20.474999999999998 35.699999999999996 4 32.4 22.275 18.25 27.075 5 30.25 25.3 23.075000000000003 21.375 6 25.04391468005019 28.20577164366374 23.43789209535759 23.312421580928483 7 19.125 21.95 36.199999999999996 22.725 8 20.3 20.45 31.75 27.500000000000004 9 21.7 17.175 32.300000000000004 28.825 10-11 24.590573821727716 27.803475434429302 22.62782847855982 24.978122265283158 12-13 25.162499999999998 21.65 24.637500000000003 28.549999999999997 14-15 24.837500000000002 23.549999999999997 25.45 26.1625 16-17 25.95 22.9875 24.375 26.687499999999996 18-19 25.4 22.912499999999998 23.8375 27.85 20-21 24.75 22.6375 25.275 27.3375 22-23 26.1625 23.150000000000002 23.6875 27.0 24-25 25.162499999999998 22.9625 24.425 27.450000000000003 26-27 24.8 23.599999999999998 24.3125 27.287499999999998 28-29 25.525 23.4125 23.3375 27.725 30-31 25.7375 23.525 23.4625 27.275 32-33 25.6 23.0375 23.8125 27.55 34-35 25.9875 22.7125 23.962500000000002 27.3375 36-37 25.362499999999997 23.2375 23.25 28.15 38-39 25.362499999999997 23.8625 23.45 27.325 40-41 27.075 22.9625 22.425 27.537499999999998 42-43 25.374999999999996 23.3125 23.6875 27.625 44-45 25.5625 23.775 23.599999999999998 27.0625 46-47 25.8625 23.8875 22.7625 27.487499999999997 48-49 25.162499999999998 23.825 23.5625 27.450000000000003 50-51 25.874999999999996 23.1875 23.325000000000003 27.6125 52-53 26.5625 22.6875 23.275000000000002 27.474999999999998 54-55 26.224999999999998 23.1375 22.6125 28.025 56-57 24.78429411029136 23.546329873702636 24.471676878829562 27.19769913717644 58-59 25.937968984492244 23.186593296648326 23.06153076538269 27.813906953476735 60-61 25.700350175087543 22.71135567783892 23.6368184092046 27.951475737868936 62-63 26.375687843921963 22.861430715357677 23.336668334167083 27.426213106553277 64-65 25.822594770424125 23.407981984236205 22.920055048167146 27.849368197172524 66-67 25.982478097622025 22.665832290362953 23.779724655819777 27.571964956195245 68-69 25.963945918878316 21.84526790185278 23.547821732598898 28.642964446670007 70-71 26.584022038567497 22.702228900576007 23.741547708489858 26.972201352366643 72-73 26.61046804227479 22.257171615500752 23.829894313034725 27.30246602918973 74-75 26.983284690899445 19.461395595648714 25.41788272751393 28.137436985937914 76 30.167797215280256 0.0 32.0599785790789 37.77222420564084 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 2.5 25 3.0 26 7.5 27 9.0 28 6.0 29 7.5 30 13.0 31 18.5 32 26.0 33 34.0 34 34.0 35 37.0 36 58.5 37 79.0 38 97.0 39 117.0 40 127.0 41 135.5 42 149.0 43 159.5 44 170.5 45 179.5 46 182.0 47 185.5 48 187.0 49 177.0 50 165.0 51 158.5 52 155.0 53 139.0 54 128.5 55 133.5 56 127.0 57 125.5 58 126.0 59 126.5 60 131.5 61 139.0 62 139.0 63 125.5 64 106.0 65 98.5 66 104.0 67 101.5 68 90.5 69 82.0 70 81.5 71 77.5 72 67.0 73 55.5 74 48.0 75 44.5 76 36.0 77 28.5 78 28.0 79 25.0 80 18.0 81 15.5 82 11.0 83 3.5 84 3.0 85 2.0 86 0.5 87 1.0 88 1.0 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.375 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 55 1.0 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 1.0 65 1.0 66 0.0 67 1.0 68 0.0 69 0.0 70 2.0 71 6.0 72 24.0 73 69.0 74 248.0 75 844.0 76 2801.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.50139700279401 96.95 2 1.4224028448056898 2.8000000000000003 3 0.05080010160020319 0.15 4 0.025400050800101596 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389877 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389877_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.18825 32.0 32.0 32.0 32.0 32.0 2 30.90025 32.0 32.0 32.0 32.0 32.0 3 30.918 32.0 32.0 32.0 32.0 32.0 4 30.97975 32.0 32.0 32.0 32.0 32.0 5 30.98 32.0 32.0 32.0 32.0 32.0 6 34.1715 36.0 36.0 36.0 32.0 36.0 7 34.545 36.0 36.0 36.0 32.0 36.0 8 34.2255 36.0 36.0 36.0 32.0 36.0 9 34.34275 36.0 36.0 36.0 32.0 36.0 10-11 34.152375000000006 36.0 36.0 36.0 32.0 36.0 12-13 34.0955 36.0 36.0 36.0 32.0 36.0 14-15 34.150375 36.0 36.0 36.0 32.0 36.0 16-17 34.093 36.0 36.0 36.0 32.0 36.0 18-19 34.173249999999996 36.0 36.0 36.0 32.0 36.0 20-21 33.977374999999995 36.0 36.0 36.0 32.0 36.0 22-23 34.02375 36.0 36.0 36.0 32.0 36.0 24-25 33.883375 36.0 36.0 36.0 32.0 36.0 26-27 33.8185 36.0 36.0 36.0 32.0 36.0 28-29 33.95875 36.0 36.0 36.0 32.0 36.0 30-31 33.855125 36.0 36.0 36.0 32.0 36.0 32-33 33.778499999999994 36.0 36.0 36.0 32.0 36.0 34-35 33.792375 36.0 36.0 36.0 32.0 36.0 36-37 33.853264948711534 36.0 36.0 36.0 32.0 36.0 38-39 33.671628721541154 36.0 36.0 36.0 27.0 36.0 40-41 33.54229229229229 36.0 36.0 36.0 27.0 36.0 42-43 33.628003003003 36.0 36.0 36.0 29.5 36.0 44-45 33.432807807807805 36.0 36.0 36.0 24.0 36.0 46-47 33.3216966966967 36.0 36.0 36.0 24.0 36.0 48-49 33.34697197197197 36.0 36.0 36.0 21.0 36.0 50-51 33.08533533533533 36.0 36.0 36.0 21.0 36.0 52-53 33.22122122122122 36.0 36.0 36.0 24.0 36.0 54-55 33.13876376376376 36.0 34.0 36.0 24.0 36.0 56-57 33.12767035409183 36.0 34.0 36.0 24.0 36.0 58-59 32.71782674011017 36.0 32.0 36.0 21.0 36.0 60-61 32.916249374061096 36.0 32.0 36.0 21.0 36.0 62-63 32.96056584877316 36.0 32.0 36.0 21.0 36.0 64-65 32.79688452788372 36.0 32.0 36.0 21.0 36.0 66-67 32.81420696567277 36.0 32.0 36.0 17.5 36.0 68-69 32.48020050125314 36.0 32.0 36.0 21.0 36.0 70-71 32.40233973832257 36.0 32.0 36.0 21.0 36.0 72-73 32.29654060935344 36.0 32.0 36.0 21.0 36.0 74-75 32.21623423727782 36.0 32.0 36.0 17.5 36.0 76 30.795560329394917 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 7.0 19 3.0 20 3.0 21 6.0 22 5.0 23 16.0 24 12.0 25 29.0 26 51.0 27 48.0 28 99.0 29 125.0 30 163.0 31 243.0 32 377.0 33 646.0 34 1222.0 35 937.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.77566349524287 20.605908863294943 9.163745618427642 36.45468202303455 2 29.10821643286573 24.34869739478958 27.980961923847698 18.562124248496996 3 25.519139354515886 27.87090317738304 18.939204403302476 27.670753064798596 4 29.697272954716038 31.023267450587944 15.986990242682012 23.29246935201401 5 30.472854640980735 30.522892169126848 18.11358518889167 20.89066800100075 6 24.44333249937453 33.82536902677008 19.489617212909682 22.241681260945708 7 23.992994746059544 16.46234676007005 33.675256442331744 25.869402051538653 8 26.019514635976982 20.815611708781585 22.66700025018764 30.497873405053788 9 24.54340755566675 21.56617463097323 24.59344508381286 29.29697272954716 10-11 28.024521456274236 27.27386463155261 19.11672713624421 25.58488677592894 12-13 28.564275879334083 21.16660408061084 22.568531731130303 27.70058830892477 14-15 26.975579211020662 23.95742016280526 22.517219787100814 26.54978083907326 16-17 27.138384470882905 23.180964308077645 21.60300563556669 28.07764558547276 18-19 27.33876017532874 23.681903569192237 22.11646837820914 26.86286787726988 20-21 27.851591877663573 22.78766608172474 22.286287290047632 27.074454750564055 22-23 27.666499749624435 23.272408612919378 22.25838758137206 26.802704056084124 24-25 27.23286984842791 23.04897908054616 22.27232869848428 27.44582237254165 26-27 27.132656895903796 24.138794939245898 22.134535888763622 26.59401227608668 28-29 27.210117705985475 22.764838467317805 21.97595792637115 28.049085900325572 30-31 26.802704056084124 22.959439158738107 22.821732598898347 27.41612418627942 32-33 27.376330619912338 23.71947401377583 21.90356919223544 27.00062617407639 34-35 27.351283656856605 23.481527864746397 21.81590482154039 27.351283656856605 36-37 27.535687453042822 22.764838467317805 22.514400200350615 27.18507387928876 38-39 27.358136039083053 24.201428034573468 21.42051860202931 27.019917324314168 40-41 27.60045061960195 22.868944799098763 21.917636750531983 27.612967830767303 42-43 26.893702266182544 22.97483410542131 23.074996869913612 27.056466758482532 44-45 27.408242515345112 23.93836903419767 21.4956783164224 27.157710134034822 46-47 27.29777109942399 23.553719008264462 22.301527673428502 26.84698221888305 48-49 27.238572323105824 22.95554164057608 22.429555416405762 27.376330619912338 50-51 27.27044970562445 23.299511461856444 22.209695603156707 27.220343229362392 52-53 27.156629522974836 23.250281707775134 21.885564041567548 27.707524727682486 54-55 27.979469203805706 23.209814722083124 21.795192789183776 27.01552328492739 56-57 27.194190559659447 22.78702892199825 22.398898209590584 27.61988230875172 58-59 28.0185370741483 22.58266533066132 22.044088176352705 27.354709418837675 60-61 27.64838467317806 22.96518908089156 22.07613323315803 27.31029301277235 62-63 27.78612572001002 23.077886301026798 22.526922113698973 26.609065865264213 64-65 28.18842395389627 21.999498872463043 22.688549235780506 27.123527937860185 66-67 27.706766917293237 23.107769423558896 22.080200501253135 27.105263157894736 68-69 27.89269148802808 24.05666290585433 21.424094271029208 26.62655133508838 70-71 28.456712672521956 22.434127979924718 22.283563362609787 26.82559598494354 72-73 27.192540322580644 23.412298387096776 22.177419354838708 27.21774193548387 74-75 27.30794923179693 19.67935871743487 24.315297261189045 28.697394789579157 76 30.40830945558739 0.0 31.733524355300858 37.85816618911175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 2.5 20 1.0 21 0.5 22 2.0 23 2.5 24 3.0 25 5.0 26 5.5 27 5.5 28 7.0 29 7.0 30 6.0 31 12.0 32 20.0 33 24.5 34 32.0 35 41.5 36 58.5 37 72.0 38 74.0 39 84.0 40 106.5 41 129.5 42 139.5 43 153.0 44 165.5 45 174.0 46 176.0 47 164.0 48 151.5 49 147.0 50 149.5 51 146.5 52 140.5 53 146.5 54 155.0 55 147.5 56 148.5 57 154.0 58 147.0 59 139.5 60 141.0 61 132.5 62 115.0 63 122.5 64 125.5 65 114.5 66 117.0 67 120.5 68 114.0 69 103.5 70 92.5 71 85.0 72 81.0 73 72.5 74 64.5 75 60.5 76 47.5 77 30.0 78 21.0 79 19.0 80 18.5 81 14.0 82 9.0 83 6.0 84 5.0 85 2.5 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 2.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.2 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.08750000000000001 12-13 0.13749999999999998 14-15 0.1875 16-17 0.1875 18-19 0.1875 20-21 0.27499999999999997 22-23 0.15 24-25 0.21250000000000002 26-27 0.21250000000000002 28-29 0.17500000000000002 30-31 0.15 32-33 0.1875 34-35 0.1875 36-37 0.10007505629221916 38-39 0.13760320240180135 40-41 0.03753753753753754 42-43 0.06256256256256257 44-45 0.11261261261261261 46-47 0.07507507507507508 48-49 0.08758758758758758 50-51 0.11261261261261261 52-53 0.06256256256256257 54-55 0.050050050050050046 56-57 0.025034422330704718 58-59 0.050075112669003496 60-61 0.025037556334501748 62-63 0.025037556334501748 64-65 0.037570444583594244 66-67 0.025056376847907794 68-69 0.03759398496240602 70-71 0.025087807325639738 72-73 0.02519526329050139 74-75 0.026712969146520632 76 0.03580379520229145 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 1.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 1.0 65 1.0 66 0.0 67 1.0 68 0.0 69 1.0 70 6.0 71 4.0 72 20.0 73 78.0 74 275.0 75 813.0 76 2793.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.50063532401525 96.89999999999999 2 1.372299872935197 2.7 3 0.10165184243964422 0.3 4 0.025412960609911054 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 646750 spots for SRR11389877.sra Written 646750 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra Read 646742 spots for SRR11389877.sra Written 646742 spots for SRR11389877.sra SRR ids: ['SRR11389877.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xd7dxhoe SRR11389877.sra spots: 12934848 blocks: [[1, 646742], [646743, 1293484], [1293485, 1940226], [1940227, 2586968], [2586969, 3233710], [3233711, 3880452], [3880453, 4527194], [4527195, 5173936], [5173937, 5820678], [5820679, 6467420], [6467421, 7114162], [7114163, 7760904], [7760905, 8407646], [8407647, 9054388], [9054389, 9701130], [9701131, 10347872], [10347873, 10994614], [10994615, 11641356], [11641357, 12288098], [12288099, 12934848]] SRR11389877 file size 2455376 SRR11389877 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389877 SRR11389877_1.fastq SRR11389877_2.fastq Input file: SRR11389877_1.fastq Paired file: SRR11389877_2.fastq trimmed: SRR11389877-trimmed-pair1.fastq, SRR11389877-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:53:43 2024 >> started Sat Dec 7 08:55:15 2024 >> done (91.357s) 12934848 read pairs processed; of these: 773 ( 0.01%) short read pairs filtered out after trimming by size control 7558 ( 0.06%) empty read pairs filtered out after trimming by size control 12926517 (99.94%) read pairs available; of these: 5489 ( 0.04%) trimmed read pairs available after processing 12921028 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 4 0.00% 22 5 0.00% 23 5 0.00% 24 10 0.00% 25 11 0.00% 26 10 0.00% 27 10 0.00% 28 13 0.00% 29 11 0.00% 30 14 0.00% 31 19 0.00% 32 22 0.00% 33 22 0.00% 34 13 0.00% 35 162 0.00% 36 177 0.00% 37 184 0.00% 38 247 0.00% 39 254 0.00% 40 269 0.00% 41 285 0.00% 42 348 0.00% 43 329 0.00% 44 394 0.00% 45 378 0.00% 46 425 0.00% 47 461 0.00% 48 486 0.00% 49 528 0.00% 50 543 0.00% 51 664 0.01% 52 665 0.01% 53 785 0.01% 54 841 0.01% 55 889 0.01% 56 1019 0.01% 57 1091 0.01% 58 1208 0.01% 59 1305 0.01% 60 1325 0.01% 61 1348 0.01% 62 1457 0.01% 63 1607 0.01% 64 1738 0.01% 65 1890 0.01% 66 2022 0.02% 67 2190 0.02% 68 2259 0.02% 69 2571 0.02% 70 3034 0.02% 71 4156 0.03% 72 13014 0.10% 73 101344 0.78% 74 853138 6.60% 75 5530137 42.78% 76 6389175 49.43% 12926517 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=21 prefix-density=0.70 prefix-fanout=2.1 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=88.84 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=14.5 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=11 prefix-density=0.46 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=18 fanout-score=124.15 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=17.5 sequence=GCCGCCGCCGCC SRR11389877 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:59:01 Started mapping on | Dec 07 08:59:02 Finished on | Dec 07 09:11:09 Mapping speed, Million of reads per hour | 64.01 Number of input reads | 12926517 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 11783187 Uniquely mapped reads % | 91.16% Average mapped length | 150.34 Number of splices: Total | 5358265 Number of splices: Annotated (sjdb) | 5133075 Number of splices: GT/AG | 5285349 Number of splices: GC/AG | 64643 Number of splices: AT/AC | 1619 Number of splices: Non-canonical | 6654 Mismatch rate per base, % | 0.81% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 600613 % of reads mapped to multiple loci | 4.65% Number of reads mapped to too many loci | 37658 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.89% % of reads unmapped: other | 1.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 542719 542719 542719 N_multimapping 600613 600613 600613 N_noFeature 300161 11497707 375124 N_ambiguous 273941 1318 66124 UnstrandedReadsAssigned:11209085 PositiveStrandReadsAssigned:284162 NegativeStrandReadsAssigned:11341939 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389877 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389877-trimmed-pair1.fastq SRR11389877-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,926,517 reads, 11,778,897 reads pseudoaligned [quant] estimated average fragment length: 214.402 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52973 SRR11389877.ke.tsv 35125 SRR11389877.se.tsv 88098 total ==> SRR11389877.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 722.693 23.7092 3.70683 PNS24247 1044 830.598 32.0766 4.36351 PNS24249 1928 1714.6 167.517 11.0392 PNS24246 1044 830.598 32.0766 4.36351 PNS24248 1044 830.598 32.0766 4.36351 PNS24244 1471 1257.6 22.5436 2.02544 PNS24243 293 99.1962 0 0 KQK14069 1603 1389.6 430.61 35.0134 KQK14071 474 262.884 22.9694 9.87246 ==> SRR11389877.se.tsv <== BRADI_1g14170v3 461 BRADI_1g53295v3 13 BRADI_1g59795v3 151 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 98 BRADI_1g74790v3 178 BRADI_1g09890v3 0 BRADI_1g77505v3 112 BRADI_1g48960v3 0 SRR11389877 completed mapping pipeline successfully