Starting /dee2/code/volunteer_pipeline.sh SRR11389878 current disk space = 1544426078208 free memory = 1601309328 SRR11389878 SRAfilesize 3a29900aaf130fe39bd402de14f9ba20 SRR11389878.sra SRR11389878.sra file validated SRR11389878 is paired end SRR11389878 is conventional basespace SRR11389878 read1 length is 50-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389878_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2295 32.0 32.0 32.0 32.0 32.0 2 31.4815 32.0 32.0 32.0 32.0 32.0 3 31.27875 32.0 32.0 32.0 32.0 32.0 4 31.46025 32.0 32.0 32.0 32.0 32.0 5 31.411 32.0 32.0 32.0 32.0 32.0 6 34.485 36.0 36.0 36.0 32.0 36.0 7 34.68425 36.0 36.0 36.0 32.0 36.0 8 34.67075 36.0 36.0 36.0 32.0 36.0 9 34.62525 36.0 36.0 36.0 32.0 36.0 10-11 34.568625 36.0 36.0 36.0 32.0 36.0 12-13 34.659 36.0 36.0 36.0 32.0 36.0 14-15 34.597750000000005 36.0 36.0 36.0 32.0 36.0 16-17 34.540125 36.0 36.0 36.0 32.0 36.0 18-19 34.579 36.0 36.0 36.0 32.0 36.0 20-21 34.583749999999995 36.0 36.0 36.0 32.0 36.0 22-23 34.592875 36.0 36.0 36.0 32.0 36.0 24-25 34.451375 36.0 36.0 36.0 32.0 36.0 26-27 34.307 36.0 36.0 36.0 32.0 36.0 28-29 34.174625 36.0 36.0 36.0 32.0 36.0 30-31 34.19575 36.0 36.0 36.0 32.0 36.0 32-33 34.25975 36.0 36.0 36.0 32.0 36.0 34-35 34.0715 36.0 36.0 36.0 32.0 36.0 36-37 34.141625000000005 36.0 36.0 36.0 32.0 36.0 38-39 34.101625 36.0 36.0 36.0 32.0 36.0 40-41 34.081875 36.0 36.0 36.0 32.0 36.0 42-43 34.015249999999995 36.0 36.0 36.0 32.0 36.0 44-45 33.855125 36.0 36.0 36.0 32.0 36.0 46-47 33.921625 36.0 36.0 36.0 32.0 36.0 48-49 33.79675 36.0 36.0 36.0 32.0 36.0 50-51 33.773306840920455 36.0 36.0 36.0 32.0 36.0 52-53 33.78914457228614 36.0 36.0 36.0 32.0 36.0 54-55 33.497498749374685 36.0 36.0 36.0 27.0 36.0 56-57 33.66320660330165 36.0 36.0 36.0 32.0 36.0 58-59 33.76850925462732 36.0 36.0 36.0 29.5 36.0 60-61 33.41845922961481 36.0 36.0 36.0 27.0 36.0 62-63 33.532391195597796 36.0 36.0 36.0 27.0 36.0 64-65 33.177963981991 36.0 36.0 36.0 27.0 36.0 66-67 33.160205258996776 36.0 34.0 36.0 27.0 36.0 68-69 32.936192541052435 36.0 32.0 36.0 27.0 36.0 70-71 32.90613266583229 36.0 32.0 36.0 21.0 36.0 72-73 32.9121997695035 36.0 32.0 36.0 21.0 36.0 74-75 32.86141665775983 36.0 32.0 36.0 21.0 36.0 76 32.264497878359265 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 2.0 24 5.0 25 8.0 26 20.0 27 31.0 28 60.0 29 101.0 30 141.0 31 253.0 32 364.0 33 620.0 34 1182.0 35 1212.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.550000000000004 9.2 9.2 42.05 2 28.375 10.4 36.55 24.675 3 26.55 15.8 21.4 36.25 4 31.75 22.675 18.125 27.450000000000003 5 30.525000000000002 24.775 23.25 21.45 6 26.131790744466798 28.194164989939637 24.019114688128774 21.654929577464788 7 19.175 22.075 36.0 22.75 8 20.625 20.5 32.0 26.875 9 22.075 18.875 31.65 27.400000000000002 10-11 24.278034754344294 28.291036379547442 22.340292536567073 25.090636329541194 12-13 24.9 21.6625 24.962500000000002 28.475 14-15 25.0 23.875 24.5 26.625 16-17 25.85 23.325000000000003 22.8 28.025 18-19 25.4875 23.474999999999998 24.2 26.8375 20-21 24.9875 23.3875 24.4875 27.1375 22-23 25.85 23.175 24.1875 26.787499999999998 24-25 25.9875 22.05 23.7875 28.175 26-27 24.8 24.3875 24.4 26.4125 28-29 26.375 23.3875 23.400000000000002 26.8375 30-31 25.4625 22.400000000000002 24.2375 27.900000000000002 32-33 24.1375 23.5375 24.825 27.500000000000004 34-35 25.85 23.35 23.5625 27.237499999999997 36-37 25.9625 23.625 22.7 27.712500000000002 38-39 25.6125 23.9 23.4875 27.0 40-41 26.087500000000002 22.875 24.1625 26.875 42-43 26.0 23.200000000000003 22.825 27.975 44-45 25.5625 23.0625 23.525 27.85 46-47 25.837500000000002 24.2875 23.325000000000003 26.55 48-49 26.137500000000003 23.625 23.2375 27.0 50-51 25.568892223055762 23.755938984746187 22.843210802700675 27.831957989497376 52-53 25.962981490745374 23.036518259129565 22.611305652826413 28.38919459729865 54-55 26.225612806403202 22.723861930965484 22.786393196598297 28.264132066033014 56-57 25.48774387193597 23.21160580290145 23.06153076538269 28.23911955977989 58-59 26.313156578289142 23.1615807903952 23.71185592796398 26.813406703351678 60-61 25.937968984492244 22.773886943471737 23.09904952476238 28.189094547273637 62-63 24.64982491245623 23.986993496748372 23.81190595297649 27.55127563781891 64-65 25.662831415707853 23.949474737368686 22.56128064032016 27.826413206603302 66-67 25.35334584115072 22.63914946841776 23.377110694183862 28.630393996247655 68-69 25.509821093456775 23.29538346052796 23.920930814462654 27.27386463155261 70-71 26.946182728410513 22.803504380475594 23.153942428035045 27.096370463078852 72-73 26.88738399799348 22.473037371457234 22.86180085277151 27.77777777777778 74-75 26.290152711953656 20.089520800421273 24.56556082148499 29.054765666140074 76 28.995756718528998 0.0 31.577086280056577 39.42715700141443 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.5 23 2.5 24 2.5 25 3.0 26 2.0 27 2.5 28 6.0 29 9.5 30 12.5 31 17.5 32 25.0 33 28.5 34 35.0 35 47.5 36 66.0 37 75.0 38 81.5 39 102.0 40 135.5 41 150.5 42 153.0 43 162.5 44 173.5 45 177.5 46 171.0 47 184.5 48 182.0 49 180.5 50 191.0 51 169.0 52 148.0 53 145.5 54 142.0 55 140.0 56 123.0 57 116.5 58 130.0 59 136.5 60 134.5 61 132.5 62 127.0 63 114.5 64 107.5 65 108.0 66 101.0 67 85.0 68 89.0 69 95.0 70 77.5 71 62.5 72 57.0 73 51.5 74 52.5 75 48.5 76 38.0 77 36.5 78 25.5 79 13.0 80 18.0 81 17.5 82 10.0 83 6.0 84 5.5 85 3.5 86 1.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.6 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50 2.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 1.0 69 1.0 70 0.0 71 1.0 72 14.0 73 54.0 74 256.0 75 842.0 76 2828.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.73128647551383 97.275 2 1.0403450900786604 2.0500000000000003 3 0.2283684344075108 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389878 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389878_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.06475 32.0 32.0 32.0 32.0 32.0 2 30.8345 32.0 32.0 32.0 32.0 32.0 3 30.836 32.0 32.0 32.0 32.0 32.0 4 30.82475 32.0 32.0 32.0 32.0 32.0 5 30.83125 32.0 32.0 32.0 32.0 32.0 6 34.04 36.0 36.0 36.0 32.0 36.0 7 34.09725 36.0 36.0 36.0 32.0 36.0 8 33.94225 36.0 36.0 36.0 32.0 36.0 9 33.8985 36.0 36.0 36.0 32.0 36.0 10-11 33.87675 36.0 36.0 36.0 32.0 36.0 12-13 33.980625 36.0 36.0 36.0 32.0 36.0 14-15 33.85325 36.0 36.0 36.0 32.0 36.0 16-17 33.843125 36.0 36.0 36.0 32.0 36.0 18-19 33.958 36.0 36.0 36.0 32.0 36.0 20-21 33.64 36.0 36.0 36.0 29.5 36.0 22-23 33.79075 36.0 36.0 36.0 32.0 36.0 24-25 33.551625 36.0 36.0 36.0 27.0 36.0 26-27 33.51025 36.0 36.0 36.0 27.0 36.0 28-29 33.573499999999996 36.0 36.0 36.0 27.0 36.0 30-31 33.510125 36.0 36.0 36.0 27.0 36.0 32-33 33.392250000000004 36.0 36.0 36.0 27.0 36.0 34-35 33.610375000000005 36.0 36.0 36.0 27.0 36.0 36-37 33.458552466816926 36.0 36.0 36.0 27.0 36.0 38-39 33.474146389448066 36.0 36.0 36.0 27.0 36.0 40-41 33.43386773547094 36.0 36.0 36.0 27.0 36.0 42-43 33.41395290581163 36.0 36.0 36.0 27.0 36.0 44-45 33.10095190380761 36.0 36.0 36.0 21.0 36.0 46-47 33.03895290581163 36.0 36.0 36.0 21.0 36.0 48-49 33.15506012024048 36.0 36.0 36.0 21.0 36.0 50-51 32.84376792431982 36.0 32.0 36.0 21.0 36.0 52-53 32.840852130325814 36.0 32.0 36.0 21.0 36.0 54-55 32.699122807017545 36.0 32.0 36.0 21.0 36.0 56-57 32.8234335839599 36.0 34.0 36.0 21.0 36.0 58-59 32.42769423558897 36.0 32.0 36.0 17.5 36.0 60-61 32.59360902255639 36.0 32.0 36.0 21.0 36.0 62-63 32.5937343358396 36.0 32.0 36.0 21.0 36.0 64-65 32.43469541238406 36.0 32.0 36.0 17.5 36.0 66-67 32.361279690160984 36.0 32.0 36.0 17.5 36.0 68-69 31.981945680281378 36.0 32.0 36.0 14.0 36.0 70-71 32.02258743538614 36.0 32.0 36.0 17.5 36.0 72-73 31.969104039677134 36.0 32.0 36.0 14.0 36.0 74-75 31.953398703521614 36.0 32.0 36.0 17.5 36.0 76 30.571998549147626 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 3.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 3.0 17 1.0 18 3.0 19 0.0 20 2.0 21 8.0 22 10.0 23 11.0 24 21.0 25 40.0 26 43.0 27 80.0 28 117.0 29 138.0 30 202.0 31 288.0 32 415.0 33 663.0 34 1188.0 35 755.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.604010025062657 20.651629072681704 9.022556390977442 38.721804511278194 2 31.560461615654788 22.453587556447566 28.273958855995986 17.711991971901657 3 24.04207362885049 26.872026045579766 18.9832206361132 30.102679689456547 4 27.723516153268218 30.979213623841723 16.428750313047832 24.868519909842224 5 30.528424743300775 32.08114199849737 17.731029301277236 19.659403956924617 6 24.267468069120962 33.53368394690709 18.732782369146005 23.466065614825947 7 23.64137240170298 16.15326821938392 32.33158026546457 27.87377911344853 8 24.793388429752067 20.410718757826196 23.741547708489858 31.05434510393188 9 25.444527923866765 18.95817680941648 26.84698221888305 28.750313047833707 10-11 27.26703406813627 26.565631262525052 18.649799599198396 27.51753507014028 12-13 28.168484392628805 21.43663031214742 22.113576532531027 28.281308762692742 14-15 26.398294456985198 23.426134938550288 23.112616002006522 27.06295460245799 16-17 27.614747930775017 22.94958615500376 21.97140707298721 27.464258841234013 18-19 26.3481314271382 23.375971908703285 22.610985703536493 27.66491096062202 20-21 28.21800828833354 22.453849051864875 22.541755619741302 26.786387040060276 22-23 26.884012539184955 23.586206896551722 22.144200626959247 27.385579937304076 24-25 27.614747930775017 23.589164785553045 21.63280662151994 27.163280662151994 26-27 27.539503386004515 23.87760220717331 22.04665161775771 26.536242789064456 28-29 27.42663656884876 23.225482819162277 21.595184349134687 27.752696262854275 30-31 26.64242728184554 24.022066198595788 21.853059177532597 27.482447342026077 32-33 27.965889139704036 23.85252069224981 22.121896162528216 26.059694005517937 34-35 28.517682468021064 22.610985703536493 22.247303737145725 26.624028091296715 36-37 27.627288688236767 23.564083270629546 21.896162528216703 26.912465512916977 38-39 28.329571106094807 23.78981690494106 20.993227990970656 26.88738399799348 40-41 28.514106583072103 22.996865203761754 21.49216300940439 26.996865203761754 42-43 26.858934169278996 23.62382445141066 22.344827586206897 27.172413793103452 44-45 27.570210631895687 23.7086258776329 22.705616850551653 26.015546639919755 46-47 27.432296890672013 23.48294884653962 22.016048144433302 27.068706118355063 48-49 27.247648902821314 23.398119122257054 21.717868338557995 27.636363636363637 50-51 27.700414000752726 22.669677581231966 22.456404466189937 27.173503951825367 52-53 27.18604942918078 22.6069501944549 22.142767532304607 28.064232844059717 54-55 27.060594655626645 24.42604441098984 21.82913059841927 26.684230334964244 56-57 28.23632714500753 23.820873055694932 21.613146011038637 26.329653788258906 58-59 27.687868523397313 23.522770041400076 22.15531300966002 26.634048425542595 60-61 28.82589061716006 23.130958354239837 22.03963873557451 26.003512293025587 62-63 28.00351141208929 22.92450464008026 22.736393278154 26.33559066967645 64-65 28.548123980424144 22.88869368804116 21.520893462165894 27.042288869368804 66-67 27.47459540835529 22.933132605695647 22.43131351147911 27.160958474469954 68-69 27.305810013803487 23.390638725059606 22.574978039904632 26.728573221232278 70-71 27.771500313873194 22.28499686126805 22.9504080351538 26.99309478970496 72-73 26.765893037336024 22.300706357214935 22.540363269424823 28.393037336024218 74-75 27.706666666666667 20.546666666666667 23.24 28.506666666666668 76 30.05444646098004 0.0 31.32486388384755 38.62068965517241 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 3.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 1.0 18 2.0 19 1.5 20 0.5 21 0.0 22 0.0 23 1.5 24 4.0 25 4.5 26 2.5 27 6.0 28 8.5 29 7.0 30 11.5 31 12.0 32 11.5 33 18.0 34 27.5 35 37.5 36 48.0 37 56.5 38 63.0 39 93.5 40 122.0 41 133.5 42 135.0 43 133.0 44 154.5 45 162.0 46 158.5 47 173.5 48 173.5 49 163.5 50 165.0 51 161.5 52 161.5 53 153.5 54 132.0 55 128.0 56 144.5 57 147.5 58 136.0 59 145.5 60 166.0 61 166.5 62 160.0 63 144.0 64 121.5 65 112.5 66 106.5 67 109.0 68 110.0 69 97.0 70 78.5 71 68.0 72 70.0 73 71.0 74 58.5 75 46.0 76 41.5 77 30.0 78 19.5 79 16.0 80 12.5 81 11.5 82 8.5 83 3.0 84 2.0 85 3.0 86 3.0 87 3.5 88 3.5 89 2.0 90 0.5 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.5 98 0.5 99 2.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.35000000000000003 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.17500000000000002 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-11 0.2 12-13 0.2875 14-15 0.325 16-17 0.325 18-19 0.325 20-21 0.46249999999999997 22-23 0.3125 24-25 0.325 26-27 0.325 28-29 0.325 30-31 0.3 32-33 0.325 34-35 0.325 36-37 0.15026296018031557 38-39 0.1377582968065122 40-41 0.11272545090180361 42-43 0.11272545090180361 44-45 0.1002004008016032 46-47 0.1002004008016032 48-49 0.11272545090180361 50-51 0.13781007266349285 52-53 0.11278195488721805 54-55 0.11278195488721805 56-57 0.10025062656641603 58-59 0.11278195488721805 60-61 0.10025062656641603 62-63 0.07518796992481204 64-65 0.11281022812735021 66-67 0.07521624670928921 68-69 0.07523510971786833 70-71 0.05019450370184465 72-73 0.07562389715149988 74-75 0.053304904051172705 76 0.07254261878853827 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 7.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 2.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 1.0 67 0.0 68 1.0 69 1.0 70 3.0 71 8.0 72 16.0 73 71.0 74 272.0 75 859.0 76 2757.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.52379740391957 96.775 2 1.3489437515907354 2.65 3 0.050903537795876815 0.15 4 0.025451768897938407 0.1 5 0.0 0.0 6 0.025451768897938407 0.15 7 0.025451768897938407 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062535 spots for SRR11389878.sra Written 1062535 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra Read 1062520 spots for SRR11389878.sra Written 1062520 spots for SRR11389878.sra SRR ids: ['SRR11389878.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tjwxvaj1 SRR11389878.sra spots: 21250415 blocks: [[1, 1062520], [1062521, 2125040], [2125041, 3187560], [3187561, 4250080], [4250081, 5312600], [5312601, 6375120], [6375121, 7437640], [7437641, 8500160], [8500161, 9562680], [9562681, 10625200], [10625201, 11687720], [11687721, 12750240], [12750241, 13812760], [13812761, 14875280], [14875281, 15937800], [15937801, 17000320], [17000321, 18062840], [18062841, 19125360], [19125361, 20187880], [20187881, 21250415]] SRR11389878 file size 4048151 SRR11389878 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389878 SRR11389878_1.fastq SRR11389878_2.fastq Input file: SRR11389878_1.fastq Paired file: SRR11389878_2.fastq trimmed: SRR11389878-trimmed-pair1.fastq, SRR11389878-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:54:00 2024 >> started Sat Dec 7 08:54:32 2024 >> done (32.349s) 21250415 read pairs processed; of these: 1258 ( 0.01%) short read pairs filtered out after trimming by size control 11041 ( 0.05%) empty read pairs filtered out after trimming by size control 21238116 (99.94%) read pairs available; of these: 5584 ( 0.03%) trimmed read pairs available after processing 21232532 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 7 0.00% 23 4 0.00% 24 3 0.00% 25 8 0.00% 26 11 0.00% 27 3 0.00% 28 8 0.00% 29 6 0.00% 30 6 0.00% 31 11 0.00% 32 6 0.00% 33 8 0.00% 34 12 0.00% 35 278 0.00% 36 247 0.00% 37 303 0.00% 38 314 0.00% 39 337 0.00% 40 416 0.00% 41 400 0.00% 42 439 0.00% 43 464 0.00% 44 511 0.00% 45 531 0.00% 46 621 0.00% 47 651 0.00% 48 616 0.00% 49 681 0.00% 50 708 0.00% 51 770 0.00% 52 840 0.00% 53 929 0.00% 54 1005 0.00% 55 1177 0.01% 56 1223 0.01% 57 1355 0.01% 58 1470 0.01% 59 1633 0.01% 60 1681 0.01% 61 1716 0.01% 62 1882 0.01% 63 2046 0.01% 64 2285 0.01% 65 2392 0.01% 66 2534 0.01% 67 2932 0.01% 68 2848 0.01% 69 3270 0.02% 70 4159 0.02% 71 6121 0.03% 72 20379 0.10% 73 166642 0.78% 74 1410605 6.64% 75 9109405 42.89% 76 10479201 49.34% 21238116 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=16 prefix-density=0.59 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=19 fanout-score=92.98 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=15.2 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=11 prefix-density=0.45 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=26 fanout-score=144.73 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=18.9 sequence=GCCGCCGCCGCC SRR11389878 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:55:00 Started mapping on | Dec 07 08:55:00 Finished on | Dec 07 08:56:45 Mapping speed, Million of reads per hour | 728.16 Number of input reads | 21238116 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 19431180 Uniquely mapped reads % | 91.49% Average mapped length | 150.38 Number of splices: Total | 9068299 Number of splices: Annotated (sjdb) | 8689049 Number of splices: GT/AG | 8941396 Number of splices: GC/AG | 112975 Number of splices: AT/AC | 2987 Number of splices: Non-canonical | 10941 Mismatch rate per base, % | 0.78% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 990378 % of reads mapped to multiple loci | 4.66% Number of reads mapped to too many loci | 62765 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.58% % of reads unmapped: other | 0.97% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 816564 816564 816564 N_multimapping 990378 990378 990378 N_noFeature 475238 18958525 603461 N_ambiguous 443453 2033 102465 UnstrandedReadsAssigned:18512489 PositiveStrandReadsAssigned:470622 NegativeStrandReadsAssigned:18725254 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389878 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389878-trimmed-pair1.fastq SRR11389878-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,238,116 reads, 19,450,678 reads pseudoaligned [quant] estimated average fragment length: 214.291 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 SRR11389878.ke.tsv 35125 SRR11389878.se.tsv 88098 total ==> SRR11389878.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 722.899 43.4065 4.07321 PNS24247 1044 830.709 25.0363 2.04447 PNS24249 1928 1714.71 179.861 7.11552 PNS24246 1044 830.709 25.0363 2.04447 PNS24248 1044 830.709 25.0363 2.04447 PNS24244 1471 1257.71 14.6237 0.788746 PNS24243 293 99.4989 0 0 KQK14069 1603 1389.71 413.263 20.1726 KQK14071 474 263.402 1.1344e-06 2.92152e-07 ==> SRR11389878.se.tsv <== BRADI_1g14170v3 419 BRADI_1g53295v3 6 BRADI_1g59795v3 276 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 199 BRADI_1g74790v3 385 BRADI_1g09890v3 0 BRADI_1g77505v3 273 BRADI_1g48960v3 0 SRR11389878 completed mapping pipeline successfully