Starting /dee2/code/volunteer_pipeline.sh SRR11389879 current disk space = 1544408469504 free memory = 1601795616 SRR11389879 SRAfilesize 5a5b36dec393d4f5842019508167dfd7 SRR11389879.sra SRR11389879.sra file validated SRR11389879 is paired end SRR11389879 is conventional basespace SRR11389879 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389879_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2095 32.0 32.0 32.0 32.0 32.0 2 31.544 32.0 32.0 32.0 32.0 32.0 3 31.42475 32.0 32.0 32.0 32.0 32.0 4 31.43825 32.0 32.0 32.0 32.0 32.0 5 31.55325 32.0 32.0 32.0 32.0 32.0 6 34.535 36.0 36.0 36.0 32.0 36.0 7 34.73825 36.0 36.0 36.0 32.0 36.0 8 34.736 36.0 36.0 36.0 32.0 36.0 9 34.60775 36.0 36.0 36.0 32.0 36.0 10-11 34.67075 36.0 36.0 36.0 32.0 36.0 12-13 34.805875 36.0 36.0 36.0 32.0 36.0 14-15 34.70075 36.0 36.0 36.0 32.0 36.0 16-17 34.626625000000004 36.0 36.0 36.0 32.0 36.0 18-19 34.728375 36.0 36.0 36.0 32.0 36.0 20-21 34.67375 36.0 36.0 36.0 32.0 36.0 22-23 34.63825 36.0 36.0 36.0 32.0 36.0 24-25 34.471374999999995 36.0 36.0 36.0 32.0 36.0 26-27 34.421625000000006 36.0 36.0 36.0 32.0 36.0 28-29 34.2915 36.0 36.0 36.0 32.0 36.0 30-31 34.316625 36.0 36.0 36.0 32.0 36.0 32-33 34.300125 36.0 36.0 36.0 32.0 36.0 34-35 34.25075 36.0 36.0 36.0 32.0 36.0 36-37 34.317954488622156 36.0 36.0 36.0 32.0 36.0 38-39 34.15716429107277 36.0 36.0 36.0 32.0 36.0 40-41 34.17979494873718 36.0 36.0 36.0 32.0 36.0 42-43 34.11152788197049 36.0 36.0 36.0 32.0 36.0 44-45 34.20455113778445 36.0 36.0 36.0 32.0 36.0 46-47 33.954988747186796 36.0 36.0 36.0 32.0 36.0 48-49 34.04201050262566 36.0 36.0 36.0 32.0 36.0 50-51 34.0796449112278 36.0 36.0 36.0 32.0 36.0 52-53 33.95698959131979 36.0 36.0 36.0 32.0 36.0 54-55 33.826413206603306 36.0 36.0 36.0 27.0 36.0 56-57 33.860430215107556 36.0 36.0 36.0 32.0 36.0 58-59 33.84489477037744 36.0 36.0 36.0 29.5 36.0 60-61 33.51651651651652 36.0 36.0 36.0 27.0 36.0 62-63 33.50475475475476 36.0 36.0 36.0 27.0 36.0 64-65 33.54711971044887 36.0 36.0 36.0 27.0 36.0 66-67 33.46299589537201 36.0 34.0 36.0 27.0 36.0 68-69 33.124404911049865 36.0 32.0 36.0 27.0 36.0 70-71 33.119595818523514 36.0 32.0 36.0 27.0 36.0 72-73 33.180609026376544 36.0 34.0 36.0 27.0 36.0 74-75 33.1005106594812 36.0 32.0 36.0 27.0 36.0 76 32.13038869257951 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 1.0 24 1.0 25 7.0 26 17.0 27 23.0 28 48.0 29 97.0 30 146.0 31 199.0 32 326.0 33 582.0 34 1264.0 35 1287.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.78469617404351 9.577394348587147 8.877219304826205 42.760690172543136 2 27.231807951987996 9.502375593898476 37.034258564641156 26.231557889472366 3 25.531382845711427 15.328832208052013 21.030257564391096 38.10952738184546 4 33.758439609902474 19.30482620655164 18.879719929982496 28.057014253563388 5 31.13278319579895 24.431107776944234 22.58064516129032 21.85546386596649 6 25.727911646586342 28.11244979919679 23.94578313253012 22.213855421686745 7 18.65466366591648 22.655663915978995 35.408852213053265 23.280820205051263 8 20.530132533133283 21.13028257064266 31.15778944736184 27.181795448862218 9 20.180045011252815 19.629907476869217 33.558389597399355 26.63165791447862 10-11 24.18104526131533 27.694423605901473 23.443360840210055 24.681170292573142 12-13 26.78169542385596 21.330332583145786 24.418604651162788 27.46936734183546 14-15 24.93123280820205 23.74343585896474 25.11877969492373 26.206551637909474 16-17 25.543885971492873 23.218304576144035 23.893473368342086 27.344336084021002 18-19 25.1937984496124 23.068267066766694 23.768442110527634 27.969492373093274 20-21 25.968992248062015 22.405601400350086 25.406351587896975 26.219054763690924 22-23 26.70667666916729 23.768442110527634 23.443360840210055 26.081520380095025 24-25 24.88122030507627 23.080770192548137 24.243560890222557 27.79444861215304 26-27 24.568642160540136 23.418354588647162 24.69367341835459 27.319329832458116 28-29 25.84396099024756 22.518129532383096 23.393348337084273 28.244561140285075 30-31 25.693923480870218 22.99324831207802 22.493123280820203 28.81970492623156 32-33 25.11877969492373 23.93098274568642 23.305826456614152 27.644411102775695 34-35 25.893973493373345 23.093273318329583 23.893473368342086 27.11927981995499 36-37 25.418854713678417 22.155538884721178 24.281070267566893 28.14453613403351 38-39 25.693923480870218 23.055763940985248 24.493623405851466 26.756689172293076 40-41 25.44386096524131 23.593398349587396 23.48087021755439 27.481870467616904 42-43 25.893973493373345 23.13078269567392 23.755938984746187 27.219304826206553 44-45 25.95648912228057 22.20555138784696 24.5311327831958 27.306826706676667 46-47 26.569142285571395 23.418354588647162 23.468367091772944 26.544136034008503 48-49 25.818954738684667 21.867966991747938 23.85596399099775 28.457114278569644 50-51 24.868717179294826 23.755938984746187 23.1807951987997 28.19454863715929 52-53 26.49743653870201 23.096161060397648 23.008628235588347 27.397774165311993 54-55 25.56278139069535 23.011505752876438 23.699349674837418 27.726363181590795 56-57 25.100050025012504 22.411205602801402 24.224612306153077 28.264132066033014 58-59 25.816135084427767 22.63914946841776 24.04002501563477 27.504690431519702 60-61 25.788288288288285 22.81031031031031 23.56106106106106 27.84034034034034 62-63 25.400400400400404 22.56006006006006 24.024024024024023 28.015515515515517 64-65 26.041797021649355 23.32624202227506 23.538981354023274 27.09297960205231 66-67 26.3243581715717 22.21665623043206 23.080776455854725 28.378209142141515 68-69 26.309195690303184 22.437985467301427 24.480080180405913 26.772738661989475 70-71 27.331995987963893 22.179037111334 22.166499498495487 28.32246740220662 72-73 26.411772104137842 23.267513520311912 22.361967048170044 27.958747327380202 74-75 25.33051295610788 20.756213643574828 25.34373347435219 28.5695399259651 76 28.339222614840992 0.0 31.448763250883395 40.21201413427562 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 2.5 23 4.0 24 4.5 25 4.5 26 2.5 27 2.5 28 6.0 29 10.5 30 13.5 31 17.5 32 24.0 33 25.0 34 24.0 35 34.5 36 57.0 37 72.0 38 86.5 39 105.5 40 124.0 41 138.5 42 152.0 43 177.5 44 183.5 45 182.5 46 193.5 47 192.0 48 186.5 49 176.0 50 167.0 51 154.0 52 132.0 53 128.0 54 128.0 55 129.0 56 136.5 57 133.0 58 125.0 59 131.5 60 138.5 61 132.0 62 124.5 63 136.5 64 134.5 65 114.5 66 115.0 67 118.5 68 115.5 69 100.0 70 75.5 71 64.5 72 60.5 73 50.5 74 47.0 75 49.5 76 40.5 77 24.5 78 18.0 79 17.0 80 11.5 81 8.5 82 7.0 83 4.0 84 2.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.4 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 2.0 66 1.0 67 1.0 68 0.0 69 2.0 70 2.0 71 6.0 72 11.0 73 58.0 74 260.0 75 822.0 76 2830.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34647672348002 96.65 2 1.5517679979648944 3.05 3 0.10175527855507505 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389879 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389879_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.24625 32.0 32.0 32.0 32.0 32.0 2 30.94825 32.0 32.0 32.0 32.0 32.0 3 30.90275 32.0 32.0 32.0 32.0 32.0 4 30.97675 32.0 32.0 32.0 32.0 32.0 5 30.953 32.0 32.0 32.0 32.0 32.0 6 34.11975 36.0 36.0 36.0 32.0 36.0 7 34.40475 36.0 36.0 36.0 32.0 36.0 8 34.265 36.0 36.0 36.0 32.0 36.0 9 34.211 36.0 36.0 36.0 32.0 36.0 10-11 34.170625 36.0 36.0 36.0 32.0 36.0 12-13 34.235875 36.0 36.0 36.0 32.0 36.0 14-15 34.090375 36.0 36.0 36.0 32.0 36.0 16-17 33.91225 36.0 36.0 36.0 32.0 36.0 18-19 34.064875 36.0 36.0 36.0 32.0 36.0 20-21 33.878249999999994 36.0 36.0 36.0 32.0 36.0 22-23 33.971125 36.0 36.0 36.0 32.0 36.0 24-25 33.735875 36.0 36.0 36.0 32.0 36.0 26-27 33.820125 36.0 36.0 36.0 32.0 36.0 28-29 33.769125 36.0 36.0 36.0 29.5 36.0 30-31 33.75075 36.0 36.0 36.0 32.0 36.0 32-33 33.603125000000006 36.0 36.0 36.0 29.5 36.0 34-35 33.725 36.0 36.0 36.0 32.0 36.0 36-37 33.727158948685855 36.0 36.0 36.0 29.5 36.0 38-39 33.65381727158949 36.0 36.0 36.0 29.5 36.0 40-41 33.63579474342929 36.0 36.0 36.0 27.0 36.0 42-43 33.587061913270404 36.0 36.0 36.0 29.5 36.0 44-45 33.50663495242864 36.0 36.0 36.0 27.0 36.0 46-47 33.23447671507261 36.0 36.0 36.0 21.0 36.0 48-49 33.11442163244867 36.0 36.0 36.0 21.0 36.0 50-51 33.03630445668503 36.0 36.0 36.0 21.0 36.0 52-53 33.10829693074548 36.0 34.0 36.0 21.0 36.0 54-55 32.89068369646882 36.0 32.0 36.0 21.0 36.0 56-57 32.99887302779865 36.0 34.0 36.0 21.0 36.0 58-59 32.79550093801427 36.0 32.0 36.0 21.0 36.0 60-61 32.70608869957404 36.0 32.0 36.0 21.0 36.0 62-63 32.817952077638346 36.0 32.0 36.0 21.0 36.0 64-65 32.66228070175438 36.0 32.0 36.0 21.0 36.0 66-67 32.55911967153027 36.0 32.0 36.0 21.0 36.0 68-69 32.41608128449573 36.0 32.0 36.0 21.0 36.0 70-71 32.25945931604903 36.0 32.0 36.0 21.0 36.0 72-73 32.30647999066694 36.0 32.0 36.0 21.0 36.0 74-75 32.1678220879118 36.0 32.0 36.0 21.0 36.0 76 30.798198198198197 32.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 2.0 11 0.0 12 0.0 13 0.0 14 0.0 15 4.0 16 3.0 17 2.0 18 2.0 19 2.0 20 1.0 21 7.0 22 5.0 23 11.0 24 23.0 25 30.0 26 41.0 27 59.0 28 79.0 29 151.0 30 170.0 31 255.0 32 380.0 33 653.0 34 1228.0 35 885.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.45504633107939 20.91159529176058 8.74029551715502 38.89306286000501 2 32.02204961162616 24.05412177399148 27.411676271611125 16.512152342771238 3 24.505632040050063 27.008760951188986 19.249061326658325 29.236545682102626 4 27.63454317897372 31.08886107634543 16.670838548185234 24.60575719649562 5 31.66458072590738 30.037546933667088 17.822277847309138 20.475594493116393 6 24.330413016270338 33.41677096370463 19.374217772215268 22.878598247809762 7 24.93116395494368 15.74468085106383 31.314142678347935 28.010012515644554 8 24.730913642052567 21.27659574468085 22.878598247809762 31.11389236545682 9 23.654568210262827 21.026282853566958 26.23279098873592 29.086357947434294 10-11 29.07748153711353 25.259732131681062 19.163850294154464 26.498936037050946 12-13 26.728456913827653 20.97945891783567 22.49498997995992 29.797094188376754 14-15 27.552938228292195 23.430647788497684 22.979576494173664 26.03683748903646 16-17 27.44017040471119 22.22779100363363 21.95213632376895 28.37990226788623 18-19 27.549486344274616 22.41292909045352 22.62590829366074 27.411676271611125 20-21 27.269307923771315 23.971915747241727 21.82798395185557 26.930792377131397 22-23 28.213480330744172 23.966424455023805 21.648709596592333 26.171385617639693 24-25 27.678235810048868 23.44317754667335 21.300588898634256 27.57799774464353 26-27 27.7032953264002 23.230171657687006 21.977195840120288 27.089337175792505 28-29 28.213480330744172 23.001753946379353 21.57354046604861 27.211225256827866 30-31 27.590527502819196 23.067284801403332 21.95213632376895 27.39005137200852 32-33 26.785266850413432 23.703332498120773 22.788774743172137 26.72262590829366 34-35 28.802305186670008 22.563267351540965 21.49837133550489 27.136056126284142 36-37 27.68729641693811 23.565522425457278 21.548484089200702 27.19869706840391 38-39 28.229545169778227 23.39305851397068 22.202731487282296 26.1746648289688 40-41 28.81483337509396 22.400400902029567 21.335504885993487 27.44926083688299 42-43 28.22600851916813 22.525682786269105 22.225006264094212 27.023302430468554 44-45 27.39348370927318 23.546365914786968 22.518796992481203 26.54135338345865 46-47 28.79699248120301 22.05513784461153 21.54135338345865 27.60651629072682 48-49 27.105263157894736 22.932330827067666 21.779448621553886 28.18295739348371 50-51 28.000000000000004 23.260188087774296 21.981191222570533 26.75862068965517 52-53 27.994987468671678 22.531328320802004 21.503759398496243 27.969924812030072 54-55 27.130325814536345 22.832080200501252 21.854636591478695 28.18295739348371 56-57 27.61904761904762 22.719298245614038 22.468671679197996 27.192982456140353 58-59 29.267986964151415 21.847580847330157 21.43394334419654 27.450488844321885 60-61 27.244232698094283 23.608324974924773 21.72768304914744 27.4197592778335 62-63 27.745737211634903 22.768304914744235 22.55516549648947 26.930792377131397 64-65 27.94080762478054 22.91196388261851 21.269124655129172 27.878103837471784 66-67 28.38143036386449 22.55959849435383 22.22082810539523 26.838143036386448 68-69 27.827287561189905 22.90699133927451 21.58905485126145 27.676666248274127 70-71 27.615220394323746 23.194775838251918 21.73803842772824 27.451965339696095 72-73 27.58577194752775 22.540363269424823 22.9313824419778 26.942482341069628 74-75 27.36617274062208 21.0519289814444 23.081030570017354 28.500867707916168 76 29.343907714491706 0.0 31.506849315068493 39.14924297043979 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 1.5 19 2.0 20 2.5 21 2.0 22 0.5 23 0.5 24 1.0 25 1.0 26 1.5 27 4.5 28 6.5 29 6.0 30 7.5 31 11.0 32 16.0 33 21.5 34 26.0 35 40.5 36 59.5 37 64.0 38 65.0 39 78.5 40 98.5 41 120.5 42 131.5 43 149.5 44 163.5 45 154.5 46 148.0 47 164.0 48 177.5 49 170.5 50 167.5 51 153.0 52 142.0 53 148.0 54 155.5 55 151.0 56 141.0 57 138.0 58 138.0 59 132.0 60 139.0 61 152.0 62 151.0 63 149.0 64 138.5 65 123.0 66 118.5 67 121.5 68 119.0 69 107.0 70 90.5 71 82.0 72 84.5 73 72.0 74 61.5 75 63.0 76 51.0 77 28.5 78 19.0 79 22.0 80 16.5 81 13.0 82 9.5 83 5.5 84 4.5 85 3.5 86 2.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 1.0 99 3.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.22499999999999998 3 0.125 4 0.125 5 0.125 6 0.125 7 0.125 8 0.125 9 0.125 10-11 0.13749999999999998 12-13 0.2 14-15 0.2375 16-17 0.2375 18-19 0.22499999999999998 20-21 0.3 22-23 0.22499999999999998 24-25 0.2375 26-27 0.2375 28-29 0.22499999999999998 30-31 0.2375 32-33 0.22499999999999998 34-35 0.22499999999999998 36-37 0.10012515644555695 38-39 0.11264080100125157 40-41 0.10012515644555695 42-43 0.08762047815746651 44-45 0.10015022533800699 46-47 0.10015022533800699 48-49 0.10015022533800699 50-51 0.1627441161742614 52-53 0.0876424189307625 54-55 0.07513148009015778 56-57 0.07513148009015778 58-59 0.08766437069505323 60-61 0.07516913054372337 62-63 0.06264879087833605 64-65 0.07518796992481204 66-67 0.06269592476489029 68-69 0.06271951831409935 70-71 0.050207104305259195 72-73 0.05042864346949068 74-75 0.02669157880688643 76 0.036036036036036036 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 1.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 2.0 66 1.0 67 1.0 68 0.0 69 2.0 70 1.0 71 6.0 72 22.0 73 66.0 74 285.0 75 829.0 76 2775.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34394904458598 96.5 2 1.4777070063694266 2.9000000000000004 3 0.12738853503184713 0.375 4 0.025477707006369425 0.1 5 0.025477707006369425 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898779 spots for SRR11389879.sra Written 898779 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra Read 898769 spots for SRR11389879.sra Written 898769 spots for SRR11389879.sra SRR ids: ['SRR11389879.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__yy20mf2 SRR11389879.sra spots: 17975390 blocks: [[1, 898769], [898770, 1797538], [1797539, 2696307], [2696308, 3595076], [3595077, 4493845], [4493846, 5392614], [5392615, 6291383], [6291384, 7190152], [7190153, 8088921], [8088922, 8987690], [8987691, 9886459], [9886460, 10785228], [10785229, 11683997], [11683998, 12582766], [12582767, 13481535], [13481536, 14380304], [14380305, 15279073], [15279074, 16177842], [16177843, 17076611], [17076612, 17975390]] SRR11389879 file size 3420950 SRR11389879 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389879 SRR11389879_1.fastq SRR11389879_2.fastq Input file: SRR11389879_1.fastq Paired file: SRR11389879_2.fastq trimmed: SRR11389879-trimmed-pair1.fastq, SRR11389879-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:59:15 2024 >> started Sat Dec 7 08:59:29 2024 >> done (14.532s) 17975390 read pairs processed; of these: 1055 ( 0.01%) short read pairs filtered out after trimming by size control 10701 ( 0.06%) empty read pairs filtered out after trimming by size control 17963634 (99.93%) read pairs available; of these: 7414 ( 0.04%) trimmed read pairs available after processing 17956220 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 4 0.00% 21 5 0.00% 22 8 0.00% 23 13 0.00% 24 14 0.00% 25 19 0.00% 26 9 0.00% 27 10 0.00% 28 19 0.00% 29 8 0.00% 30 16 0.00% 31 19 0.00% 32 22 0.00% 33 14 0.00% 34 18 0.00% 35 241 0.00% 36 232 0.00% 37 231 0.00% 38 289 0.00% 39 304 0.00% 40 386 0.00% 41 394 0.00% 42 382 0.00% 43 439 0.00% 44 476 0.00% 45 519 0.00% 46 481 0.00% 47 570 0.00% 48 559 0.00% 49 609 0.00% 50 682 0.00% 51 738 0.00% 52 826 0.00% 53 860 0.00% 54 889 0.00% 55 1040 0.01% 56 1102 0.01% 57 1249 0.01% 58 1332 0.01% 59 1378 0.01% 60 1476 0.01% 61 1581 0.01% 62 1705 0.01% 63 1844 0.01% 64 1947 0.01% 65 2171 0.01% 66 2254 0.01% 67 2626 0.01% 68 2585 0.01% 69 2801 0.02% 70 3520 0.02% 71 5126 0.03% 72 16106 0.09% 73 137649 0.77% 74 1181991 6.58% 75 7670486 42.70% 76 8911354 49.61% 17963634 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=19 prefix-density=0.48 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=31.42 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=6.5 sequence=TTCTTGGCGAACGTCTCTGGGTCAGCTGACAACCCCGCGGTGTCCCAGCCGTAGTCACCGGGGAACTCGCCGGTCAGGTACGACGGCGTCTGCTCGGAGAACGGGCCCAGGTACTTGGGACGGTCAGGGCCGTACCAGATGCTCTGGGGTGCGCTCTTGACAGTCCGGCGCATGGTGA criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=23 prefix-density=0.36 prefix-fanout=2.3 sequence=TGAAGCAGATCGAGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=134.82 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=5.7 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR11389879 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:00:06 Started mapping on | Dec 07 09:00:07 Finished on | Dec 07 09:01:15 Mapping speed, Million of reads per hour | 951.02 Number of input reads | 17963634 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 16411565 Uniquely mapped reads % | 91.36% Average mapped length | 150.37 Number of splices: Total | 7710523 Number of splices: Annotated (sjdb) | 7402891 Number of splices: GT/AG | 7602848 Number of splices: GC/AG | 95904 Number of splices: AT/AC | 2335 Number of splices: Non-canonical | 9436 Mismatch rate per base, % | 0.78% Deletion rate per base | 0.01% Deletion average length | 1.70 Insertion rate per base | 0.00% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 774476 % of reads mapped to multiple loci | 4.31% Number of reads mapped to too many loci | 67775 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.64% % of reads unmapped: other | 1.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 777602 777602 777602 N_multimapping 774476 774476 774476 N_noFeature 388302 16022027 485376 N_ambiguous 374223 1652 84569 UnstrandedReadsAssigned:15649040 PositiveStrandReadsAssigned:387886 NegativeStrandReadsAssigned:15841620 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389879 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389879-trimmed-pair1.fastq SRR11389879-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,963,634 reads, 16,349,495 reads pseudoaligned [quant] estimated average fragment length: 218.079 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52973 SRR11389879.ke.tsv 35125 SRR11389879.se.tsv 88098 total ==> SRR11389879.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 719.07 0 0 PNS24247 1044 826.921 23.2194 2.24343 PNS24249 1928 1710.92 125.431 5.85735 PNS24246 1044 826.921 23.2194 2.24343 PNS24248 1044 826.921 23.2194 2.24343 PNS24244 1471 1253.92 14.9102 0.950031 PNS24243 293 97.6211 0 0 KQK14069 1603 1385.92 247.752 14.2825 KQK14071 474 259.633 17.9092 5.51112 ==> SRR11389879.se.tsv <== BRADI_1g14170v3 280 BRADI_1g53295v3 7 BRADI_1g59795v3 152 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 172 BRADI_1g74790v3 122 BRADI_1g09890v3 0 BRADI_1g77505v3 237 BRADI_1g48960v3 0 SRR11389879 completed mapping pipeline successfully