Starting /dee2/code/volunteer_pipeline.sh SRR11389880 current disk space = 1544394051584 free memory = 1606137300 SRR11389880 SRAfilesize 505982106e41023244d45939a2229112 SRR11389880.sra SRR11389880.sra file validated SRR11389880 is paired end SRR11389880 is conventional basespace SRR11389880 read1 length is 36-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389880_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.39275 32.0 32.0 32.0 32.0 32.0 2 31.36625 32.0 32.0 32.0 32.0 32.0 3 31.335 32.0 32.0 32.0 32.0 32.0 4 31.476 32.0 32.0 32.0 32.0 32.0 5 31.413 32.0 32.0 32.0 32.0 32.0 6 34.42575 36.0 36.0 36.0 32.0 36.0 7 34.583 36.0 36.0 36.0 32.0 36.0 8 34.55225 36.0 36.0 36.0 32.0 36.0 9 34.605 36.0 36.0 36.0 32.0 36.0 10-11 34.616625 36.0 36.0 36.0 32.0 36.0 12-13 34.65825 36.0 36.0 36.0 32.0 36.0 14-15 34.545500000000004 36.0 36.0 36.0 32.0 36.0 16-17 34.530125 36.0 36.0 36.0 32.0 36.0 18-19 34.5235 36.0 36.0 36.0 32.0 36.0 20-21 34.569500000000005 36.0 36.0 36.0 32.0 36.0 22-23 34.50975 36.0 36.0 36.0 32.0 36.0 24-25 34.4175 36.0 36.0 36.0 32.0 36.0 26-27 34.26575 36.0 36.0 36.0 32.0 36.0 28-29 34.142875000000004 36.0 36.0 36.0 32.0 36.0 30-31 34.183625 36.0 36.0 36.0 32.0 36.0 32-33 34.22725 36.0 36.0 36.0 32.0 36.0 34-35 34.21475 36.0 36.0 36.0 32.0 36.0 36-37 34.11912571892974 36.0 36.0 36.0 32.0 36.0 38-39 34.1807951987997 36.0 36.0 36.0 32.0 36.0 40-41 34.088772193048264 36.0 36.0 36.0 32.0 36.0 42-43 33.96861715428857 36.0 36.0 36.0 32.0 36.0 44-45 33.98224556139034 36.0 36.0 36.0 32.0 36.0 46-47 33.98449612403101 36.0 36.0 36.0 32.0 36.0 48-49 33.9756287558633 36.0 36.0 36.0 32.0 36.0 50-51 33.80052526263131 36.0 36.0 36.0 32.0 36.0 52-53 33.75712856428214 36.0 36.0 36.0 32.0 36.0 54-55 33.64123227780056 36.0 36.0 36.0 27.0 36.0 56-57 33.78653653653654 36.0 36.0 36.0 32.0 36.0 58-59 33.80826032540676 36.0 36.0 36.0 29.5 36.0 60-61 33.42451176765148 36.0 36.0 36.0 27.0 36.0 62-63 33.48597896845268 36.0 36.0 36.0 24.0 36.0 64-65 33.22233350025037 36.0 34.0 36.0 27.0 36.0 66-67 33.29318978467701 36.0 34.0 36.0 27.0 36.0 68-69 33.0969006414706 36.0 32.0 36.0 27.0 36.0 70-71 32.9747140270516 36.0 32.0 36.0 24.0 36.0 72-73 33.016121822762784 36.0 34.0 36.0 21.0 36.0 74-75 32.98365201656088 36.0 32.0 36.0 24.0 36.0 76 32.183093525179856 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 4.0 25 7.0 26 23.0 27 38.0 28 61.0 29 97.0 30 141.0 31 215.0 32 362.0 33 584.0 34 1274.0 35 1191.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.300000000000004 9.75 9.475 41.475 2 28.825 9.775 36.3 25.1 3 27.075 15.875 20.325 36.725 4 33.15 22.175 17.45 27.224999999999998 5 30.55 26.525 21.275 21.65 6 24.591811102738006 28.887214267771917 23.813112283345895 22.707862346144182 7 19.075 22.825 34.725 23.375 8 20.575 20.849999999999998 30.425 28.15 9 21.55 19.075 32.175 27.200000000000003 10-11 24.875 27.8625 22.225 25.0375 12-13 26.0375 21.1375 25.074999999999996 27.750000000000004 14-15 25.974999999999998 23.5375 24.7 25.7875 16-17 25.5 23.5125 23.5625 27.425 18-19 25.624999999999996 23.325000000000003 24.1375 26.9125 20-21 25.775 22.9375 23.65 27.6375 22-23 25.637500000000003 23.6875 24.3875 26.2875 24-25 26.35 22.2125 24.087500000000002 27.35 26-27 25.45 23.1375 23.724999999999998 27.6875 28-29 25.674999999999997 23.1875 23.275000000000002 27.8625 30-31 25.525 22.5 23.875 28.1 32-33 26.0 23.9375 23.8125 26.25 34-35 26.35 23.95 23.0875 26.6125 36-37 25.51568946118265 23.452931616452055 23.265408176022003 27.765970746343292 38-39 25.418854713678417 23.718429607401852 23.69342335583896 27.169292323080768 40-41 26.756689172293076 23.63090772693173 22.893223305826456 26.71917979494874 42-43 25.868967241810452 22.88072018004501 24.36859214803701 26.881720430107524 44-45 26.9567391847962 22.50562640660165 23.268317079269817 27.26931732933233 46-47 26.219054763690924 23.418354588647162 23.305826456614152 27.056764191047762 48-49 25.884706765036892 22.65849693635113 23.471301738151805 27.98549456046017 50-51 26.413206603301653 22.22361180590295 23.82441220610305 27.538769384692348 52-53 26.900950475237618 22.973986993496748 22.461230615307652 27.66383191595798 54-55 25.906930197648236 22.604453340005005 23.329997498123593 28.15861896422317 56-57 26.18868868868869 23.01051051051051 23.123123123123122 27.677677677677675 58-59 26.357947434292868 22.74092615769712 23.14142678347935 27.759699624530665 60-61 26.251877816725088 22.759138708062093 22.84677015523285 28.14221331997997 62-63 27.1407110665999 22.195793690535805 23.109664496745115 27.55383074611918 64-65 26.53980971457186 22.44616925388082 23.42263395092639 27.591387080620933 66-67 25.78868302453681 22.070605908863293 23.923385077616423 28.217325988983475 68-69 26.86866157505947 22.361337172905973 23.46312758232127 27.306873669713283 70-71 27.56201453269857 23.365071410674016 22.851415685291908 26.221498371335507 72-73 26.518294983025275 22.670690305545076 22.771281277505345 28.039733433924308 74-75 26.666666666666668 19.63036303630363 24.91089108910891 28.79207920792079 76 28.093525179856115 0.0 31.83453237410072 40.07194244604316 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 2.0 23 2.5 24 2.0 25 1.0 26 2.0 27 5.5 28 8.0 29 7.0 30 10.5 31 15.5 32 16.0 33 21.0 34 27.0 35 42.5 36 61.0 37 64.5 38 81.0 39 105.0 40 111.5 41 138.5 42 174.0 43 180.0 44 176.5 45 194.0 46 214.5 47 193.0 48 171.0 49 164.0 50 156.0 51 148.0 52 132.0 53 128.5 54 135.0 55 136.0 56 138.0 57 142.0 58 142.0 59 141.0 60 132.5 61 132.5 62 140.0 63 132.0 64 117.0 65 112.0 66 118.0 67 112.5 68 103.0 69 107.5 70 89.0 71 64.0 72 61.5 73 57.0 74 45.0 75 38.5 76 39.0 77 35.0 78 28.0 79 20.0 80 13.0 81 10.5 82 9.0 83 7.0 84 6.5 85 4.0 86 2.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.475 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 2.0 55 0.0 56 0.0 57 1.0 58 0.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 1.0 70 2.0 71 5.0 72 17.0 73 60.0 74 241.0 75 887.0 76 2780.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.60193187595323 96.975 2 1.1692933401118455 2.3 3 0.1779359430604982 0.525 4 0.05083884087442806 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389880 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389880_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.02575 32.0 32.0 32.0 32.0 32.0 2 30.874 32.0 32.0 32.0 32.0 32.0 3 30.751 32.0 32.0 32.0 32.0 32.0 4 30.8325 32.0 32.0 32.0 32.0 32.0 5 30.962 32.0 32.0 32.0 32.0 32.0 6 33.912 36.0 36.0 36.0 32.0 36.0 7 34.2155 36.0 36.0 36.0 32.0 36.0 8 34.07325 36.0 36.0 36.0 32.0 36.0 9 34.01875 36.0 36.0 36.0 32.0 36.0 10-11 33.83375 36.0 36.0 36.0 32.0 36.0 12-13 33.87875 36.0 36.0 36.0 32.0 36.0 14-15 33.84225 36.0 36.0 36.0 32.0 36.0 16-17 33.740625 36.0 36.0 36.0 29.5 36.0 18-19 33.810625 36.0 36.0 36.0 32.0 36.0 20-21 33.5595 36.0 36.0 36.0 27.0 36.0 22-23 33.71325 36.0 36.0 36.0 29.5 36.0 24-25 33.6455 36.0 36.0 36.0 29.5 36.0 26-27 33.40975 36.0 36.0 36.0 27.0 36.0 28-29 33.447 36.0 36.0 36.0 27.0 36.0 30-31 33.403999999999996 36.0 36.0 36.0 27.0 36.0 32-33 33.456875 36.0 36.0 36.0 27.0 36.0 34-35 33.509249999999994 36.0 36.0 36.0 27.0 36.0 36-37 33.550074080551155 36.0 36.0 36.0 29.5 36.0 38-39 33.44809904952476 36.0 36.0 36.0 27.0 36.0 40-41 33.305902951475744 36.0 36.0 36.0 27.0 36.0 42-43 33.41570785392696 36.0 36.0 36.0 27.0 36.0 44-45 33.140695347673834 36.0 36.0 36.0 21.0 36.0 46-47 33.032391195597796 36.0 36.0 36.0 21.0 36.0 48-49 32.994867993165954 36.0 36.0 36.0 21.0 36.0 50-51 32.712034025519145 36.0 32.0 36.0 21.0 36.0 52-53 32.81473605203903 36.0 32.0 36.0 21.0 36.0 54-55 32.62050877958218 36.0 32.0 36.0 17.5 36.0 56-57 32.65269086357948 36.0 32.0 36.0 21.0 36.0 58-59 32.400851276915375 36.0 32.0 36.0 14.0 36.0 60-61 32.44089656899574 36.0 32.0 36.0 21.0 36.0 62-63 32.53844227397947 36.0 32.0 36.0 21.0 36.0 64-65 32.474079639368895 36.0 32.0 36.0 14.0 36.0 66-67 32.3320811419985 36.0 32.0 36.0 14.0 36.0 68-69 31.97708351840169 36.0 32.0 36.0 14.0 36.0 70-71 31.879446878596198 36.0 32.0 36.0 14.0 36.0 72-73 31.7552507429364 36.0 32.0 36.0 14.0 36.0 74-75 31.730923141670612 36.0 32.0 36.0 14.0 36.0 76 30.715010877447426 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 3.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 4.0 17 1.0 18 1.0 19 3.0 20 4.0 21 7.0 22 12.0 23 8.0 24 21.0 25 39.0 26 53.0 27 77.0 28 114.0 29 138.0 30 216.0 31 306.0 32 414.0 33 682.0 34 1172.0 35 720.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.37353014761071 19.68976732549412 8.681511133350012 40.25519139354516 2 30.01002004008016 24.34869739478958 28.2314629258517 17.409819639278556 3 24.90622655663916 27.481870467616904 17.92948237059265 29.68242060515129 4 27.506876719179797 30.707676919229808 17.179294823705927 24.60615153788447 5 30.307576894223555 30.107526881720432 18.779694923730933 20.80520130032508 6 24.006001500375092 32.85821455363841 18.104526131532882 25.03125781445361 7 22.755688922230558 16.479119779944988 32.85821455363841 27.906976744186046 8 22.680670167541887 20.930232558139537 24.056014003500874 32.3330832708177 9 23.93098274568642 20.280070017504375 26.106526631657918 29.68242060515129 10-11 27.79237023139462 26.416510318949342 18.874296435272043 26.91682301438399 12-13 27.8292438657987 20.24286429644467 23.460190285428144 28.467701552328496 14-15 26.740981963927858 23.70991983967936 22.14428857715431 27.404809619238478 16-17 29.32114228456914 22.88326653306613 21.142284569138276 26.65330661322645 18-19 26.86286787726988 22.592360676268004 21.66562304320601 28.879148403256107 20-21 27.480245829675155 22.61382164806221 21.974162799448138 27.931769722814497 22-23 27.356955051959435 22.398898209590584 23.100037561036686 27.144109177413295 24-25 26.80696480020043 23.337091319052988 21.98421645997745 27.871727420769133 26-27 27.29550294375548 23.49993736690467 21.520731554553425 27.68382813478642 28-29 27.811169546706736 23.002754820936637 21.487603305785125 27.698472326571498 30-31 27.20100187852223 22.95554164057608 22.179085785848464 27.664370695053226 32-33 28.415779586725108 22.917971195992486 21.7407639323732 26.925485284909207 34-35 27.367234468937873 23.471943887775552 22.307114228456914 26.853707414829657 36-37 27.67689417658109 22.993112085159677 21.42767689417658 27.90231684408265 38-39 26.813682495927825 22.641273023430646 22.62874326525498 27.91630121538654 40-41 26.903807615230463 22.983466933867735 20.766533066132265 29.346192384769537 42-43 28.35671342685371 22.82064128256513 21.8311623246493 26.991482965931862 44-45 27.672640681789694 23.18586289008648 21.769645318962276 27.37185110916155 46-47 27.65317629369753 23.8065405337677 21.313118656809923 27.227164515724844 48-49 27.42541990473803 23.301579343193783 21.54675357232389 27.726247179744295 50-51 28.02859292701279 22.974667669927264 21.582643591672937 27.414095811387007 52-53 27.6657060518732 22.390677859917304 21.801779225660944 28.14183686254855 54-55 27.352462097481517 22.653802781606313 21.964666081944618 28.029069038967545 56-57 27.781954887218046 23.27067669172932 21.265664160401002 27.681704260651628 58-59 27.94633901705115 23.08174523570712 21.163490471414242 27.80842527582748 60-61 27.45737211634905 23.7086258776329 21.063189568706118 27.770812437311935 62-63 27.820962888665996 22.454864593781345 21.752758274824473 27.971414242728184 64-65 27.74015550539253 22.297466766992727 21.682969651366943 28.279408076247805 66-67 28.046639919759276 22.63039117352056 22.15396188565697 27.16900702106319 68-69 27.197492163009407 23.122257053291538 21.442006269592476 28.23824451410658 70-71 28.616233847697902 22.443858988834524 22.230585873792496 26.70932128967507 72-73 27.23034274193548 22.983870967741936 22.05141129032258 27.734375 74-75 28.55998932336848 18.991058321099693 23.528626718270385 28.920325637261445 76 30.10167029774873 0.0 31.98983297022513 37.908496732026144 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.5 10 1.0 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 1.5 25 3.0 26 3.5 27 2.5 28 2.5 29 5.0 30 9.5 31 10.0 32 15.0 33 24.0 34 23.5 35 42.0 36 64.0 37 68.0 38 67.5 39 86.0 40 106.5 41 113.0 42 121.0 43 134.0 44 158.5 45 164.5 46 150.5 47 151.5 48 157.0 49 150.5 50 151.5 51 145.0 52 132.0 53 132.0 54 134.0 55 131.5 56 142.0 57 158.5 58 164.0 59 143.0 60 144.5 61 170.0 62 169.0 63 142.5 64 130.0 65 135.0 66 123.0 67 118.0 68 111.5 69 95.0 70 93.0 71 98.5 72 95.5 73 87.5 74 67.0 75 52.0 76 42.5 77 33.0 78 26.0 79 19.5 80 17.0 81 11.5 82 5.5 83 2.5 84 2.5 85 3.0 86 2.0 87 1.0 88 0.5 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.2 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.0625 12-13 0.15 14-15 0.2 16-17 0.2 18-19 0.1875 20-21 0.3375 22-23 0.1625 24-25 0.21250000000000002 26-27 0.21250000000000002 28-29 0.17500000000000002 30-31 0.1875 32-33 0.1875 34-35 0.2 36-37 0.1500562711016631 38-39 0.18759379689844924 40-41 0.1500750375187594 42-43 0.1500750375187594 44-45 0.2126063031515758 46-47 0.18759379689844924 48-49 0.21263289555972484 50-51 0.2501876407305479 52-53 0.16262196647485613 54-55 0.13763763763763764 56-57 0.1251564455569462 58-59 0.15022533800701052 60-61 0.12521913348359628 62-63 0.12521913348359628 64-65 0.15026296018031557 66-67 0.12521913348359628 68-69 0.12523481527864747 70-71 0.10026319087604962 72-73 0.1132787916928886 74-75 0.11996800853105838 76 0.145032632342277 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 2.0 55 0.0 56 0.0 57 1.0 58 0.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 1.0 70 3.0 71 4.0 72 23.0 73 68.0 74 284.0 75 851.0 76 2758.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.68087265347539 97.25 2 1.1669203450025367 2.3 3 0.15220700152207 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833116 spots for SRR11389880.sra Written 833116 spots for SRR11389880.sra Read 833120 spots for SRR11389880.sra Written 833120 spots for SRR11389880.sra SRR ids: ['SRR11389880.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pdkr76qn SRR11389880.sra spots: 16662324 blocks: [[1, 833116], [833117, 1666232], [1666233, 2499348], [2499349, 3332464], [3332465, 4165580], [4165581, 4998696], [4998697, 5831812], [5831813, 6664928], [6664929, 7498044], [7498045, 8331160], [8331161, 9164276], [9164277, 9997392], [9997393, 10830508], [10830509, 11663624], [11663625, 12496740], [12496741, 13329856], [13329857, 14162972], [14162973, 14996088], [14996089, 15829204], [15829205, 16662324]] SRR11389880 file size 3169716 SRR11389880 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389880 SRR11389880_1.fastq SRR11389880_2.fastq Input file: SRR11389880_1.fastq Paired file: SRR11389880_2.fastq trimmed: SRR11389880-trimmed-pair1.fastq, SRR11389880-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:59:44 2024 >> started Sat Dec 7 08:59:58 2024 >> done (13.982s) 16662324 read pairs processed; of these: 1004 ( 0.01%) short read pairs filtered out after trimming by size control 9869 ( 0.06%) empty read pairs filtered out after trimming by size control 16651451 (99.93%) read pairs available; of these: 5445 ( 0.03%) trimmed read pairs available after processing 16646006 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 2 0.00% 22 4 0.00% 23 10 0.00% 24 2 0.00% 25 4 0.00% 26 3 0.00% 27 5 0.00% 28 5 0.00% 29 3 0.00% 30 5 0.00% 31 11 0.00% 32 7 0.00% 33 6 0.00% 34 9 0.00% 35 175 0.00% 36 159 0.00% 37 180 0.00% 38 215 0.00% 39 261 0.00% 40 263 0.00% 41 282 0.00% 42 336 0.00% 43 329 0.00% 44 353 0.00% 45 392 0.00% 46 422 0.00% 47 403 0.00% 48 400 0.00% 49 439 0.00% 50 538 0.00% 51 551 0.00% 52 599 0.00% 53 668 0.00% 54 617 0.00% 55 815 0.00% 56 857 0.01% 57 861 0.01% 58 913 0.01% 59 1048 0.01% 60 1074 0.01% 61 1126 0.01% 62 1125 0.01% 63 1424 0.01% 64 1438 0.01% 65 1561 0.01% 66 1724 0.01% 67 1896 0.01% 68 1858 0.01% 69 2089 0.01% 70 2729 0.02% 71 4048 0.02% 72 15216 0.09% 73 127929 0.77% 74 1084246 6.51% 75 7098224 42.63% 76 8291591 49.80% 16651451 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=17 prefix-density=0.57 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=21.29 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=5.0 sequence=TTCTTGGCGAACGTCTCTGGGTCAGCTGACAACCCCGCGGTGTCCCAGCCGTAGTC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=4.59 fanout-score-rank=15 prefix-density=0.57 prefix-fanout=3.4 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.18 sequence-density-rank=23 fanout-score=107.25 fanout-score-rank=1 prefix-density=1.19 prefix-fanout=16.1 sequence=GCCGCCGCCGCC SRR11389880 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:00:26 Started mapping on | Dec 07 09:00:26 Finished on | Dec 07 09:01:33 Mapping speed, Million of reads per hour | 894.70 Number of input reads | 16651451 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 15192285 Uniquely mapped reads % | 91.24% Average mapped length | 150.39 Number of splices: Total | 6952072 Number of splices: Annotated (sjdb) | 6680198 Number of splices: GT/AG | 6858909 Number of splices: GC/AG | 82683 Number of splices: AT/AC | 2080 Number of splices: Non-canonical | 8400 Mismatch rate per base, % | 0.83% Deletion rate per base | 0.01% Deletion average length | 1.70 Insertion rate per base | 0.00% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 784840 % of reads mapped to multiple loci | 4.71% Number of reads mapped to too many loci | 41176 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.94% % of reads unmapped: other | 0.86% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 674333 674333 674333 N_multimapping 784840 784840 784840 N_noFeature 339771 14835468 423536 N_ambiguous 356815 1398 86758 UnstrandedReadsAssigned:14495699 PositiveStrandReadsAssigned:355419 NegativeStrandReadsAssigned:14681991 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389880 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389880-trimmed-pair1.fastq SRR11389880-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,651,451 reads, 15,255,955 reads pseudoaligned [quant] estimated average fragment length: 222.997 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52973 SRR11389880.ke.tsv 35125 SRR11389880.se.tsv 88098 total ==> SRR11389880.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 714.24 0 0 PNS24247 1044 822.003 16.0126 1.64677 PNS24249 1928 1706 104.5 5.1782 PNS24246 1044 822.003 16.0126 1.64677 PNS24248 1044 822.003 16.0126 1.64677 PNS24244 1471 1249 5.46211 0.369692 PNS24243 293 94.3917 0 0 KQK14069 1603 1381 223.549 13.6843 KQK14071 474 255.024 8.17685 2.71049 ==> SRR11389880.se.tsv <== BRADI_1g14170v3 243 BRADI_1g53295v3 8 BRADI_1g59795v3 228 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 205 BRADI_1g74790v3 97 BRADI_1g09890v3 0 BRADI_1g77505v3 178 BRADI_1g48960v3 0 SRR11389880 completed mapping pipeline successfully