Starting /dee2/code/volunteer_pipeline.sh SRR11389881 current disk space = 1544352247808 free memory = 1601530288 SRR11389881 SRAfilesize 91852d10e4295245576ef6d3feaaaede SRR11389881.sra SRR11389881.sra file validated SRR11389881 is paired end SRR11389881 is conventional basespace SRR11389881 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389881_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.33875 32.0 32.0 32.0 32.0 32.0 2 31.4505 32.0 32.0 32.0 32.0 32.0 3 31.418 32.0 32.0 32.0 32.0 32.0 4 31.40425 32.0 32.0 32.0 32.0 32.0 5 31.5185 32.0 32.0 32.0 32.0 32.0 6 34.50075 36.0 36.0 36.0 32.0 36.0 7 34.52025 36.0 36.0 36.0 32.0 36.0 8 34.73775 36.0 36.0 36.0 32.0 36.0 9 34.58325 36.0 36.0 36.0 32.0 36.0 10-11 34.566625 36.0 36.0 36.0 32.0 36.0 12-13 34.541624999999996 36.0 36.0 36.0 32.0 36.0 14-15 34.565875000000005 36.0 36.0 36.0 32.0 36.0 16-17 34.556250000000006 36.0 36.0 36.0 32.0 36.0 18-19 34.705 36.0 36.0 36.0 32.0 36.0 20-21 34.581125 36.0 36.0 36.0 32.0 36.0 22-23 34.61175 36.0 36.0 36.0 32.0 36.0 24-25 34.391375 36.0 36.0 36.0 32.0 36.0 26-27 34.2265 36.0 36.0 36.0 32.0 36.0 28-29 34.22475 36.0 36.0 36.0 32.0 36.0 30-31 34.263875 36.0 36.0 36.0 32.0 36.0 32-33 34.1755 36.0 36.0 36.0 32.0 36.0 34-35 34.19275 36.0 36.0 36.0 32.0 36.0 36-37 34.08239559889972 36.0 36.0 36.0 32.0 36.0 38-39 33.99349837459365 36.0 36.0 36.0 32.0 36.0 40-41 34.044386096524136 36.0 36.0 36.0 32.0 36.0 42-43 34.04688672168042 36.0 36.0 36.0 32.0 36.0 44-45 33.89397349337334 36.0 36.0 36.0 32.0 36.0 46-47 33.8858464616154 36.0 36.0 36.0 32.0 36.0 48-49 33.97799449862465 36.0 36.0 36.0 32.0 36.0 50-51 33.845586396599145 36.0 36.0 36.0 32.0 36.0 52-53 33.83804717128744 36.0 36.0 36.0 32.0 36.0 54-55 33.6793845384038 36.0 36.0 36.0 27.0 36.0 56-57 33.68113585188892 36.0 36.0 36.0 32.0 36.0 58-59 33.70007507507508 36.0 36.0 36.0 29.5 36.0 60-61 33.39143110569894 36.0 36.0 36.0 27.0 36.0 62-63 33.343064339810496 36.0 36.0 36.0 24.0 36.0 64-65 33.15783923145715 36.0 34.0 36.0 27.0 36.0 66-67 33.29348370927318 36.0 34.0 36.0 27.0 36.0 68-69 32.93843221393504 36.0 32.0 36.0 24.0 36.0 70-71 32.93303826704593 36.0 32.0 36.0 24.0 36.0 72-73 33.073013051198245 36.0 34.0 36.0 24.0 36.0 74-75 32.99262107706831 36.0 32.0 36.0 27.0 36.0 76 32.33440056919246 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 7.0 25 10.0 26 19.0 27 37.0 28 66.0 29 98.0 30 141.0 31 225.0 32 343.0 33 605.0 34 1206.0 35 1240.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.259814953738434 8.60215053763441 9.877469367341837 42.26056514128532 2 28.95723930982746 10.75268817204301 36.58414603650913 23.705926481620406 3 26.481620405101275 16.179044761190298 20.730182545636406 36.60915228807202 4 33.18329582395599 23.005751437859466 17.804451112778192 26.006501625406354 5 29.582395598899723 25.481370342585645 22.930732683170792 22.005501375343837 6 24.50214267708596 28.081673808923618 23.720695739853795 23.695487774136627 7 20.555138784696176 22.80570142535634 33.85846461615404 22.780695173793447 8 20.655163790947736 20.10502625656414 30.682670667666915 28.557139284821204 9 22.05551387846962 19.4048512128032 32.10802700675169 26.431607901975497 10-11 25.618904726181547 26.331582895723933 22.95573893473368 25.09377344336084 12-13 25.36884221055264 21.717929482370593 24.44361090272568 28.469617404351087 14-15 25.056264066016503 22.88072018004501 25.018754688672168 27.04426106526632 16-17 26.86921730432608 22.655663915978995 23.69342335583896 26.78169542385596 18-19 25.393848462115532 23.15578894723681 23.905976494123532 27.544386096524132 20-21 25.331332833208304 23.280820205051263 24.081020255063766 27.306826706676667 22-23 26.531632908227053 23.93098274568642 22.88072018004501 26.65666416604151 24-25 25.531382845711427 22.818204551137786 23.48087021755439 28.169542385596397 26-27 24.88122030507627 23.905976494123532 23.78094523630908 27.431857964491122 28-29 26.081520380095025 23.330832708177045 23.50587646911728 27.081770442610654 30-31 26.18154538634659 23.36834208552138 23.118279569892472 27.33183295823956 32-33 24.668667166791696 23.15578894723681 24.36859214803701 27.806951737934483 34-35 26.30657664416104 22.768192048012004 23.655913978494624 27.26931732933233 36-37 25.656414103525883 22.9057264316079 23.680920230057513 27.7569392348087 38-39 25.018754688672168 22.31807951987997 24.493623405851466 28.169542385596397 40-41 26.319079769942487 22.943235808952238 23.080770192548137 27.656914228557138 42-43 26.206551637909474 21.817954488622153 23.3183295823956 28.657164291072768 44-45 25.51887971992998 22.968242060515127 24.006001500375092 27.506876719179797 46-47 26.294073518379594 23.193298324581146 23.168292073018254 27.344336084021002 48-49 25.93148287071768 22.74318579644911 23.705926481620406 27.619404851212803 50-51 25.881470367591895 23.40585146286572 22.380595148787197 28.33208302075519 52-53 26.975987993997 21.94847423711856 23.724362181090545 27.351175587793897 54-55 25.606705028771582 22.54190642982237 23.01726294721041 28.834125594195648 56-57 25.531648736552416 22.71703777833375 23.517638228671505 28.233675256442332 58-59 26.539039039039036 23.035535535535537 22.7977977977978 27.627627627627625 60-61 26.980352897009137 22.600425478663496 23.276185708922537 27.143035915404827 62-63 26.618254663828722 23.4380868911982 23.06247652435207 26.88118192062101 64-65 27.834147563572593 21.433045221094826 23.236878366528874 27.495928848803707 66-67 26.61654135338346 22.380952380952383 23.233082706766915 27.769423558897245 68-69 26.059162697417896 22.374028578591126 23.101027826522937 28.465780897468036 70-71 27.097178683385582 23.00940438871473 23.15987460815047 26.733542319749215 72-73 26.5393314903242 22.794672028147776 22.26690123146519 28.399095250062828 74-75 27.45253164556962 18.96097046413502 24.854957805907173 28.731540084388186 76 30.202774813233724 0.0 32.15937388829598 37.637851298470295 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 1.5 22 2.5 23 2.0 24 1.5 25 2.0 26 4.0 27 5.0 28 6.5 29 10.0 30 13.5 31 18.0 32 25.0 33 30.5 34 36.0 35 46.5 36 61.0 37 80.5 38 89.5 39 95.0 40 110.5 41 147.5 42 178.0 43 178.0 44 172.0 45 155.5 46 152.5 47 163.0 48 157.5 49 162.5 50 176.0 51 159.0 52 139.5 53 130.0 54 123.0 55 127.0 56 140.0 57 153.5 58 149.0 59 136.0 60 128.5 61 115.5 62 109.0 63 122.5 64 126.0 65 115.5 66 112.5 67 108.0 68 109.5 69 106.0 70 85.5 71 76.0 72 67.5 73 61.5 74 56.0 75 46.5 76 39.5 77 36.0 78 27.0 79 16.0 80 13.0 81 9.5 82 7.0 83 6.5 84 5.5 85 2.0 86 1.0 87 2.0 88 2.5 89 1.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.8250000000000001 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 2.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 1.0 61 1.0 62 1.0 63 1.0 64 1.0 65 1.0 66 0.0 67 0.0 68 2.0 69 0.0 70 1.0 71 3.0 72 10.0 73 47.0 74 270.0 75 846.0 76 2811.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34437086092716 96.525 2 1.477330616403464 2.9000000000000004 3 0.1273560876209883 0.375 4 0.05094243504839531 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389881 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389881_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.19775 32.0 32.0 32.0 32.0 32.0 2 30.732 32.0 32.0 32.0 32.0 32.0 3 30.87525 32.0 32.0 32.0 32.0 32.0 4 30.844 32.0 32.0 32.0 32.0 32.0 5 30.92475 32.0 32.0 32.0 32.0 32.0 6 34.015 36.0 36.0 36.0 32.0 36.0 7 34.33575 36.0 36.0 36.0 32.0 36.0 8 33.977 36.0 36.0 36.0 32.0 36.0 9 34.01175 36.0 36.0 36.0 32.0 36.0 10-11 33.905 36.0 36.0 36.0 32.0 36.0 12-13 33.9465 36.0 36.0 36.0 32.0 36.0 14-15 33.6485 36.0 36.0 36.0 29.5 36.0 16-17 33.81675 36.0 36.0 36.0 32.0 36.0 18-19 33.815 36.0 36.0 36.0 32.0 36.0 20-21 33.65875 36.0 36.0 36.0 29.5 36.0 22-23 33.72225 36.0 36.0 36.0 29.5 36.0 24-25 33.540000000000006 36.0 36.0 36.0 27.0 36.0 26-27 33.449 36.0 36.0 36.0 27.0 36.0 28-29 33.480125 36.0 36.0 36.0 27.0 36.0 30-31 33.511875 36.0 36.0 36.0 27.0 36.0 32-33 33.405375 36.0 36.0 36.0 27.0 36.0 34-35 33.4935 36.0 36.0 36.0 27.0 36.0 36-37 33.46044066099149 36.0 36.0 36.0 27.0 36.0 38-39 33.53755633450176 36.0 36.0 36.0 27.0 36.0 40-41 33.320105157736606 36.0 36.0 36.0 27.0 36.0 42-43 33.480090157776104 36.0 36.0 36.0 27.0 36.0 44-45 33.002880040070124 36.0 36.0 36.0 21.0 36.0 46-47 32.92299023290759 36.0 36.0 36.0 21.0 36.0 48-49 33.12158777861257 36.0 36.0 36.0 21.0 36.0 50-51 32.9053343350864 36.0 34.0 36.0 21.0 36.0 52-53 32.77214130616828 36.0 32.0 36.0 21.0 36.0 54-55 32.64983713355049 36.0 32.0 36.0 21.0 36.0 56-57 32.81007266349286 36.0 32.0 36.0 21.0 36.0 58-59 32.480195537728754 36.0 32.0 36.0 21.0 36.0 60-61 32.56250237300017 36.0 32.0 36.0 21.0 36.0 62-63 32.558255814085186 36.0 32.0 36.0 21.0 36.0 64-65 32.36493149511472 36.0 32.0 36.0 17.5 36.0 66-67 32.4315137740722 36.0 32.0 36.0 14.0 36.0 68-69 32.08665073231552 36.0 32.0 36.0 17.5 36.0 70-71 31.9646957765196 36.0 32.0 36.0 14.0 36.0 72-73 31.904980630552295 36.0 32.0 36.0 14.0 36.0 74-75 31.96840139052429 36.0 32.0 36.0 14.0 36.0 76 30.31714285714286 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 4.0 6 2.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 3.0 17 2.0 18 2.0 19 1.0 20 2.0 21 8.0 22 10.0 23 17.0 24 20.0 25 39.0 26 51.0 27 85.0 28 91.0 29 149.0 30 205.0 31 285.0 32 399.0 33 675.0 34 1123.0 35 818.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.805659904833462 20.63611319809667 8.890558477335336 38.66766841973453 2 29.63426853707415 23.22144288577154 29.13326653306613 18.011022044088175 3 25.212819228843266 27.1407110665999 19.479218828242363 28.16725087631447 4 28.367551326990487 31.422133199799703 15.748622934401602 24.461692538808215 5 30.045067601402103 32.799198798197295 17.926890335503252 19.228843264897346 6 23.309964947421133 32.924386579869804 19.00350525788683 24.76214321482223 7 22.608913370055085 15.923885828743115 32.34852278417627 29.11867801702554 8 23.084626940410615 20.555833750625936 23.660490736104155 32.69904857285929 9 25.162744116174263 20.931397095643465 24.13620430645969 29.769654481722586 10-11 28.1688376753507 25.751503006012022 19.05060120240481 27.029058116232463 12-13 28.57501254390366 20.14550928248871 22.39086803813347 28.888610135474156 14-15 27.27500941383206 23.132923308648174 22.279402535458768 27.312664742061 16-17 27.64809236947791 22.991967871485944 21.04668674698795 28.313253012048197 18-19 27.269303201506588 23.239171374764595 22.448210922787194 27.04331450094162 20-21 27.67857142857143 22.12022132796781 22.258551307847082 27.94265593561368 22-23 27.8203036767474 22.8761450621157 21.997741247333416 27.305810013803487 24-25 27.281858129315754 23.879472693032014 21.117388575015696 27.721280602636533 26-27 26.79221594475832 23.979912115505336 22.4105461393597 26.817325800376647 28-29 27.183734939759034 23.443775100401606 21.623995983935743 27.748493975903614 30-31 27.68574297188755 22.991967871485944 22.201305220883537 27.12098393574297 32-33 26.826512678885262 24.165202108963094 21.604318353000252 27.403966859151392 34-35 26.794678714859437 22.92921686746988 22.23895582329317 28.03714859437751 36-37 27.368553143430795 22.838499184339316 21.558539339942275 28.234408332287614 38-39 27.366306803916647 22.985187044941 22.1943258850113 27.454180266131058 40-41 28.582183186951067 22.622333751568384 21.20451693851945 27.590966122961103 42-43 27.183734939759034 23.2429718875502 22.966867469879517 26.606425702811244 44-45 27.394852479598242 22.937853107344633 21.89579409918393 27.771500313873194 46-47 27.02736630680392 23.299020838563898 21.45367813206126 28.219934722570926 48-49 27.95077850326469 22.865394274234053 21.20793571069814 27.975891511803113 50-51 27.798015324707954 24.35623665368672 21.328978771511117 26.516769250094207 52-53 28.50508346931091 22.216643655077192 20.82339651060625 28.45487636500565 54-55 27.06842435655995 23.540489642184557 21.519146264908976 27.87193973634652 56-57 28.01556420233463 23.158026860800803 21.877745701016693 26.948663235847874 58-59 27.90405626020344 23.018962702499056 21.38641215622253 27.690568881074974 60-61 27.32295328980412 23.10396785534907 21.860873932697135 27.712204922149674 62-63 27.688442211055275 22.688442211055275 22.57537688442211 27.047738693467338 64-65 27.772190093034947 23.384460648730197 21.49861704802615 27.3447322102087 66-67 28.14032440588457 22.733559663020245 21.55161574248711 27.57450018860807 68-69 27.42138364779874 22.540880503144653 22.67924528301887 27.358490566037734 70-71 27.825320916184243 22.980115781525296 21.79713063176441 27.39743267052605 72-73 26.825878190548398 23.199393479909023 21.822087439979782 28.152640889562804 74-75 28.291577825159912 19.736140724946697 23.32089552238806 28.65138592750533 76 29.563350035790982 0.0 31.424481030780242 39.012168933428775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.5 4 1.0 5 1.0 6 2.0 7 3.0 8 2.5 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 1.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 2.5 24 4.5 25 5.5 26 6.0 27 6.5 28 8.0 29 9.0 30 9.5 31 12.0 32 17.5 33 21.5 34 29.0 35 43.5 36 55.5 37 61.5 38 68.0 39 87.5 40 105.0 41 113.0 42 113.0 43 139.0 44 171.0 45 160.5 46 155.0 47 152.0 48 154.0 49 157.5 50 151.5 51 141.5 52 128.0 53 135.0 54 144.0 55 135.0 56 126.0 57 131.5 58 130.0 59 147.5 60 168.5 61 160.0 62 157.5 63 150.5 64 128.0 65 117.5 66 120.0 67 114.5 68 112.5 69 114.5 70 101.0 71 83.5 72 79.0 73 81.0 74 72.0 75 60.0 76 52.5 77 35.5 78 21.5 79 19.5 80 16.5 81 11.0 82 9.5 83 9.0 84 5.0 85 2.5 86 2.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.2 3 0.15 4 0.15 5 0.15 6 0.15 7 0.15 8 0.15 9 0.15 10-11 0.2 12-13 0.35000000000000003 14-15 0.41250000000000003 16-17 0.4 18-19 0.43750000000000006 20-21 0.6 22-23 0.3875 24-25 0.43750000000000006 26-27 0.43750000000000006 28-29 0.4 30-31 0.4 32-33 0.42500000000000004 34-35 0.4 36-37 0.23785678517776665 38-39 0.2754131196795193 40-41 0.2253380070105158 42-43 0.2253944402704733 44-45 0.26296018031555224 46-47 0.25043826696719257 48-49 0.27548209366391185 50-51 0.31304783370899075 52-53 0.2129258517034068 54-55 0.21297920320721622 56-57 0.18792282635930843 58-59 0.18801704687891702 60-61 0.1629685345367933 62-63 0.16305029474476357 64-65 0.18822938888191743 66-67 0.15065913370998116 68-69 0.15071590052750566 70-71 0.15079165619502388 72-73 0.16399646776838653 74-75 0.15965939329430548 76 0.2142857142857143 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 6.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 2.0 53 0.0 54 0.0 55 0.0 56 0.0 57 2.0 58 0.0 59 0.0 60 1.0 61 1.0 62 1.0 63 1.0 64 1.0 65 1.0 66 1.0 67 0.0 68 2.0 69 0.0 70 2.0 71 7.0 72 15.0 73 64.0 74 268.0 75 824.0 76 2800.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.175 #Duplication Level Percentage of deduplicated Percentage of total 1 98.52304558186911 96.72500000000001 2 1.2477718360071302 2.45 3 0.15278838808250572 0.44999999999999996 4 0.025464731347084286 0.1 5 0.025464731347084286 0.125 6 0.025464731347084286 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit AAACGATCTAGTGCAGCAGCAGCTTGCTCTCTCCTCCATCTAGTAGAAGAAGCAACAGCAATGGCGGCCACAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120443 spots for SRR11389881.sra Written 1120443 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra Read 1120435 spots for SRR11389881.sra Written 1120435 spots for SRR11389881.sra SRR ids: ['SRR11389881.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mj5uaycs SRR11389881.sra spots: 22408708 blocks: [[1, 1120435], [1120436, 2240870], [2240871, 3361305], [3361306, 4481740], [4481741, 5602175], [5602176, 6722610], [6722611, 7843045], [7843046, 8963480], [8963481, 10083915], [10083916, 11204350], [11204351, 12324785], [12324786, 13445220], [13445221, 14565655], [14565656, 15686090], [15686091, 16806525], [16806526, 17926960], [17926961, 19047395], [19047396, 20167830], [20167831, 21288265], [21288266, 22408708]] SRR11389881 file size 4269717 SRR11389881 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389881 SRR11389881_1.fastq SRR11389881_2.fastq Input file: SRR11389881_1.fastq Paired file: SRR11389881_2.fastq trimmed: SRR11389881-trimmed-pair1.fastq, SRR11389881-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:02:09 2024 >> started Sat Dec 7 09:02:28 2024 >> done (18.453s) 22408708 read pairs processed; of these: 1373 ( 0.01%) short read pairs filtered out after trimming by size control 12214 ( 0.05%) empty read pairs filtered out after trimming by size control 22395121 (99.94%) read pairs available; of these: 6681 ( 0.03%) trimmed read pairs available after processing 22388440 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 2 0.00% 21 2 0.00% 22 1 0.00% 23 7 0.00% 24 8 0.00% 25 12 0.00% 26 15 0.00% 27 6 0.00% 28 8 0.00% 29 7 0.00% 30 8 0.00% 31 1 0.00% 32 9 0.00% 33 8 0.00% 34 8 0.00% 35 267 0.00% 36 262 0.00% 37 298 0.00% 38 326 0.00% 39 382 0.00% 40 414 0.00% 41 439 0.00% 42 477 0.00% 43 588 0.00% 44 603 0.00% 45 655 0.00% 46 649 0.00% 47 688 0.00% 48 772 0.00% 49 817 0.00% 50 889 0.00% 51 1007 0.00% 52 1111 0.00% 53 1179 0.01% 54 1238 0.01% 55 1486 0.01% 56 1567 0.01% 57 1683 0.01% 58 1828 0.01% 59 2039 0.01% 60 2197 0.01% 61 2404 0.01% 62 2575 0.01% 63 2688 0.01% 64 2897 0.01% 65 3309 0.01% 66 3586 0.02% 67 3974 0.02% 68 4073 0.02% 69 4570 0.02% 70 5563 0.02% 71 7622 0.03% 72 22911 0.10% 73 174191 0.78% 74 1461810 6.53% 75 9559671 42.69% 76 11109313 49.61% 22395121 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=22 prefix-density=0.49 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=30 fanout-score=11.22 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=5.1 sequence=GCGCCGAGCATGGCCCA criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=4.74 fanout-score-rank=13 prefix-density=0.50 prefix-fanout=3.4 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.17 sequence-density-rank=21 fanout-score=104.20 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=15.5 sequence=GCCGCCGCCGCCTCC SRR11389881 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:03:00 Started mapping on | Dec 07 09:03:00 Finished on | Dec 07 09:04:20 Mapping speed, Million of reads per hour | 1007.78 Number of input reads | 22395121 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 20453434 Uniquely mapped reads % | 91.33% Average mapped length | 150.39 Number of splices: Total | 9378916 Number of splices: Annotated (sjdb) | 9006863 Number of splices: GT/AG | 9250818 Number of splices: GC/AG | 113649 Number of splices: AT/AC | 2881 Number of splices: Non-canonical | 11568 Mismatch rate per base, % | 0.78% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1066968 % of reads mapped to multiple loci | 4.76% Number of reads mapped to too many loci | 77228 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.41% % of reads unmapped: other | 1.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 874731 874731 874731 N_multimapping 1066968 1066968 1066968 N_noFeature 486482 19958270 598720 N_ambiguous 491141 1921 112456 UnstrandedReadsAssigned:19475811 PositiveStrandReadsAssigned:493243 NegativeStrandReadsAssigned:19742258 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389881 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389881-trimmed-pair1.fastq SRR11389881-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,395,121 reads, 20,487,786 reads pseudoaligned [quant] estimated average fragment length: 214.4 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52973 SRR11389881.ke.tsv 35125 SRR11389881.se.tsv 88098 total ==> SRR11389881.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 722.802 0.000108701 9.44313e-06 PNS24247 1044 830.6 39.3798 2.97703 PNS24249 1928 1714.6 133.99 4.90694 PNS24246 1044 830.6 39.3798 2.97703 PNS24248 1044 830.6 39.3798 2.97703 PNS24244 1471 1257.6 26.8706 1.34164 PNS24243 293 102.337 0 0 KQK14069 1603 1389.6 987.617 44.6272 KQK14071 474 263.313 87.6903 20.9113 ==> SRR11389881.se.tsv <== BRADI_1g14170v3 1143 BRADI_1g53295v3 14 BRADI_1g59795v3 382 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 319 BRADI_1g74790v3 147 BRADI_1g09890v3 0 BRADI_1g77505v3 255 BRADI_1g48960v3 0 SRR11389881 completed mapping pipeline successfully