Starting /dee2/code/volunteer_pipeline.sh SRR11389882 current disk space = 1544341622784 free memory = 1600601784 SRR11389882 SRAfilesize 5b62acc801822231e8c018ad2667cc4f SRR11389882.sra SRR11389882.sra file validated SRR11389882 is paired end SRR11389882 is conventional basespace SRR11389882 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389882_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.188 32.0 32.0 32.0 32.0 32.0 2 31.484 32.0 32.0 32.0 32.0 32.0 3 31.34625 32.0 32.0 32.0 32.0 32.0 4 31.3705 32.0 32.0 32.0 32.0 32.0 5 31.4385 32.0 32.0 32.0 32.0 32.0 6 34.37975 36.0 36.0 36.0 32.0 36.0 7 34.61175 36.0 36.0 36.0 32.0 36.0 8 34.50475 36.0 36.0 36.0 32.0 36.0 9 34.5405 36.0 36.0 36.0 32.0 36.0 10-11 34.591125000000005 36.0 36.0 36.0 32.0 36.0 12-13 34.590875 36.0 36.0 36.0 32.0 36.0 14-15 34.55737499999999 36.0 36.0 36.0 32.0 36.0 16-17 34.553625 36.0 36.0 36.0 32.0 36.0 18-19 34.566500000000005 36.0 36.0 36.0 32.0 36.0 20-21 34.571625 36.0 36.0 36.0 32.0 36.0 22-23 34.572 36.0 36.0 36.0 32.0 36.0 24-25 34.418000000000006 36.0 36.0 36.0 32.0 36.0 26-27 34.248374999999996 36.0 36.0 36.0 32.0 36.0 28-29 34.020624999999995 36.0 36.0 36.0 32.0 36.0 30-31 34.164 36.0 36.0 36.0 32.0 36.0 32-33 34.187625 36.0 36.0 36.0 32.0 36.0 34-35 34.09287500000001 36.0 36.0 36.0 32.0 36.0 36-37 34.0328832208052 36.0 36.0 36.0 32.0 36.0 38-39 34.01775443860965 36.0 36.0 36.0 32.0 36.0 40-41 33.922980745186294 36.0 36.0 36.0 32.0 36.0 42-43 33.85458864716179 36.0 36.0 36.0 32.0 36.0 44-45 33.9169792448112 36.0 36.0 36.0 32.0 36.0 46-47 33.90347502458406 36.0 36.0 36.0 32.0 36.0 48-49 33.866933466733364 36.0 36.0 36.0 32.0 36.0 50-51 33.712606303151574 36.0 36.0 36.0 32.0 36.0 52-53 33.8628064032016 36.0 36.0 36.0 32.0 36.0 54-55 33.57830873154866 36.0 36.0 36.0 27.0 36.0 56-57 33.66649987490618 36.0 36.0 36.0 32.0 36.0 58-59 33.73455091318489 36.0 36.0 36.0 29.5 36.0 60-61 33.295012613313844 36.0 36.0 36.0 24.0 36.0 62-63 33.34597097097097 36.0 36.0 36.0 24.0 36.0 64-65 33.116882934248395 36.0 36.0 36.0 21.0 36.0 66-67 33.224728621858404 36.0 34.0 36.0 27.0 36.0 68-69 33.03319502322108 36.0 32.0 36.0 27.0 36.0 70-71 32.86653314781522 36.0 32.0 36.0 24.0 36.0 72-73 33.00376742974835 36.0 34.0 36.0 21.0 36.0 74-75 32.89160580725039 36.0 32.0 36.0 24.0 36.0 76 32.34004313443566 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 3.0 23 1.0 24 4.0 25 15.0 26 15.0 27 34.0 28 79.0 29 88.0 30 153.0 31 245.0 32 314.0 33 634.0 34 1271.0 35 1143.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.484871217804454 9.30232558139535 9.552388097024256 41.66041510377595 2 27.28182045511378 11.10277569392348 37.05926481620405 24.55613903475869 3 26.431607901975497 17.254313578394598 19.80495123780945 36.509127281820454 4 32.58314578644661 23.080770192548137 17.129282320580145 27.206801700425103 5 32.03300825206302 25.406351587896975 20.955238809702426 21.605401350337583 6 24.936964195663137 28.668683812405447 22.31467473524962 24.079677256681794 7 18.854713678419603 22.305576394098527 36.03400850212553 22.80570142535634 8 20.80520130032508 20.78019504876219 30.307576894223555 28.107026756689173 9 21.530382595648913 18.804701175293822 31.83295823955989 27.831957989497376 10-11 24.843710927731934 27.70692673168292 22.093023255813954 25.35633908477119 12-13 25.693923480870218 21.94298574643661 23.543385846461614 28.81970492623156 14-15 25.6064016004001 22.88072018004501 24.243560890222557 27.26931732933233 16-17 26.86921730432608 22.66816704176044 23.618404601150285 26.84421105276319 18-19 25.618904726181547 23.0432608152038 24.20605151287822 27.131782945736433 20-21 25.343835958989747 23.99349837459365 23.705926481620406 26.9567391847962 22-23 25.71892973243311 23.15578894723681 23.905976494123532 27.219304826206553 24-25 25.30632658164541 22.543135783945985 24.618654663665918 27.53188297074269 26-27 26.11902975743936 22.83070767691923 23.455863965991497 27.59439859964991 28-29 25.918979744936234 23.118279569892472 23.080770192548137 27.881970492623154 30-31 26.231557889472366 23.055763940985248 22.893223305826456 27.819454863715933 32-33 24.968742185546386 22.980745186296573 23.78094523630908 28.26956739184796 34-35 25.131282820705174 22.53063265816454 24.756189047261813 27.581895473868467 36-37 25.30632658164541 22.80570142535634 22.73068267066767 29.15728932233058 38-39 25.743935983995996 23.093273318329583 23.95598899724931 27.206801700425103 40-41 25.85646411602901 23.918479619904975 22.930732683170792 27.294323580895224 42-43 26.36909227306827 23.78094523630908 21.955488872218055 27.894473618404604 44-45 26.244061015253813 22.518129532383096 23.55588897224306 27.68192048012003 46-47 26.947605352007002 23.146179817431538 22.796048518194322 27.11016631236714 48-49 25.850425212606304 22.39869934967484 24.087043521760883 27.66383191595798 50-51 25.50025012506253 22.423711855927962 23.574287143571787 28.501750875437722 52-53 27.288644322161083 22.886443221610804 22.848924462231114 26.975987993997 54-55 26.720040030022517 23.167375531648737 22.854640980735553 27.257943457593193 56-57 25.856892669502123 23.067300475356518 23.805354015511636 27.270452839629723 58-59 26.007005253940456 22.879659744808606 22.66700025018764 28.446334751063297 60-61 26.6733391717753 23.395471037157513 22.6072813711998 27.323908419867383 62-63 26.226226226226224 22.25975975975976 23.085585585585587 28.428428428428425 64-65 27.243148542109875 22.66299587035415 22.262545363533974 27.831310224002003 66-67 25.867033930136472 23.4380868911982 23.137598597721297 27.55728058094403 68-69 26.468746085431544 22.547914317925592 22.961292747087562 28.022046849555306 70-71 26.8671679197995 22.957393483709275 22.18045112781955 27.994987468671678 72-73 28.153266331658287 21.35678391959799 22.56281407035176 27.927135678391963 74-75 27.76966962982619 18.720976515855114 23.39126973596922 30.118084118349476 76 30.948957584471604 0.0 30.805176132278937 38.24586628324946 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 2.0 24 3.0 25 3.5 26 4.0 27 5.5 28 7.5 29 8.0 30 9.0 31 13.0 32 15.5 33 15.5 34 26.0 35 42.0 36 55.0 37 65.5 38 84.0 39 111.5 40 129.5 41 148.0 42 160.5 43 180.0 44 192.0 45 173.0 46 163.0 47 169.0 48 168.0 49 153.5 50 145.0 51 146.0 52 145.5 53 140.5 54 137.5 55 131.5 56 124.5 57 133.0 58 140.5 59 142.5 60 140.5 61 129.5 62 123.5 63 126.0 64 126.5 65 115.5 66 112.5 67 116.5 68 109.5 69 102.0 70 86.0 71 73.5 72 75.5 73 62.0 74 45.0 75 45.0 76 49.0 77 41.5 78 25.0 79 15.0 80 17.5 81 19.0 82 11.0 83 5.0 84 4.5 85 4.0 86 2.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.8500000000000001 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 1.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 1.0 65 1.0 66 1.0 67 1.0 68 1.0 69 0.0 70 2.0 71 4.0 72 10.0 73 70.0 74 273.0 75 850.0 76 2782.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.31718510963793 96.39999999999999 2 1.5043345232024476 2.9499999999999997 3 0.10198878123406425 0.3 4 0.025497195308516064 0.1 5 0.05099439061703213 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 5 0.125 No Hit GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389882 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389882_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.05475 32.0 32.0 32.0 32.0 32.0 2 30.89475 32.0 32.0 32.0 32.0 32.0 3 30.89225 32.0 32.0 32.0 32.0 32.0 4 30.801 32.0 32.0 32.0 32.0 32.0 5 30.83125 32.0 32.0 32.0 32.0 32.0 6 33.96525 36.0 36.0 36.0 32.0 36.0 7 34.2805 36.0 36.0 36.0 32.0 36.0 8 34.0095 36.0 36.0 36.0 32.0 36.0 9 34.147 36.0 36.0 36.0 32.0 36.0 10-11 34.006625 36.0 36.0 36.0 32.0 36.0 12-13 34.13775 36.0 36.0 36.0 32.0 36.0 14-15 33.938125 36.0 36.0 36.0 32.0 36.0 16-17 33.900625 36.0 36.0 36.0 32.0 36.0 18-19 33.934375 36.0 36.0 36.0 32.0 36.0 20-21 33.744749999999996 36.0 36.0 36.0 29.5 36.0 22-23 33.76625 36.0 36.0 36.0 32.0 36.0 24-25 33.567875 36.0 36.0 36.0 27.0 36.0 26-27 33.599625 36.0 36.0 36.0 29.5 36.0 28-29 33.6905 36.0 36.0 36.0 29.5 36.0 30-31 33.564750000000004 36.0 36.0 36.0 29.5 36.0 32-33 33.509874999999994 36.0 36.0 36.0 27.0 36.0 34-35 33.5095 36.0 36.0 36.0 27.0 36.0 36-37 33.55085170340681 36.0 36.0 36.0 27.0 36.0 38-39 33.504884769539075 36.0 36.0 36.0 27.0 36.0 40-41 33.521042084168336 36.0 36.0 36.0 27.0 36.0 42-43 33.51828657314629 36.0 36.0 36.0 27.0 36.0 44-45 33.21054609218437 36.0 36.0 36.0 21.0 36.0 46-47 33.2083319420098 36.0 36.0 36.0 21.0 36.0 48-49 33.04885993485342 36.0 36.0 36.0 21.0 36.0 50-51 33.039714357303936 36.0 34.0 36.0 21.0 36.0 52-53 32.83024304685543 36.0 32.0 36.0 21.0 36.0 54-55 32.905012531328325 36.0 34.0 36.0 21.0 36.0 56-57 32.780952380952385 36.0 32.0 36.0 21.0 36.0 58-59 32.55451127819549 36.0 32.0 36.0 21.0 36.0 60-61 32.54695048419261 36.0 32.0 36.0 21.0 36.0 62-63 32.65935305917753 36.0 32.0 36.0 21.0 36.0 64-65 32.47047890599312 36.0 32.0 36.0 17.5 36.0 66-67 32.406358578739514 36.0 32.0 36.0 14.0 36.0 68-69 32.13643813894795 36.0 32.0 36.0 21.0 36.0 70-71 32.16887461866159 36.0 32.0 36.0 21.0 36.0 72-73 31.98722483282844 36.0 32.0 36.0 14.0 36.0 74-75 31.87967104194959 36.0 32.0 36.0 14.0 36.0 76 30.647681635633443 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 0.0 5 0.0 6 2.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 0.0 13 0.0 14 2.0 15 3.0 16 4.0 17 4.0 18 7.0 19 3.0 20 4.0 21 4.0 22 7.0 23 15.0 24 21.0 25 30.0 26 34.0 27 75.0 28 98.0 29 136.0 30 180.0 31 288.0 32 394.0 33 663.0 34 1168.0 35 848.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.57103482836382 20.345778000501127 9.19569030318216 38.88749686795289 2 30.87719298245614 22.330827067669173 27.694235588972433 19.097744360902254 3 24.34869739478958 25.025050100200403 19.98997995991984 30.636272545090183 4 28.907815631262523 28.932865731462925 17.51002004008016 24.649298597194388 5 30.53607214428858 30.836673346693388 17.585170340681362 21.04208416833667 6 23.09619238476954 32.79058116232465 19.288577154308616 24.824649298597194 7 23.52204408817635 15.806613226452907 32.48997995991984 28.181362725450903 8 25.400801603206414 19.68937875751503 23.22144288577154 31.688376753507015 9 24.223446893787575 20.691382765531063 26.553106212424847 28.53206412825651 10-11 28.256513026052104 25.814128256513026 18.512024048096194 27.41733466933868 12-13 27.631578947368425 21.265664160401002 21.716791979949875 29.385964912280706 14-15 26.345502446368087 23.485133609333836 22.657132103876553 27.51223184042153 16-17 28.008533065629315 21.90990086585519 22.098130254737107 27.98343581377839 18-19 27.494039402685406 22.073033002886184 22.487137658426402 27.945789936002008 20-21 27.450980392156865 22.574157868275517 22.184514831573654 27.790346907993968 22-23 28.680712315023825 22.836719337848006 21.206420867820416 27.27614747930775 24-25 26.76286072772898 22.371392722710162 23.224592220828104 27.641154328732746 26-27 27.86144578313253 23.054718875502008 22.690763052208833 26.393072289156628 28-29 28.42633228840125 23.00940438871473 20.313479623824453 28.25078369905956 30-31 27.19177223128057 23.679919729085665 21.92399347798821 27.204314561645553 32-33 27.166687570550607 23.767716041640536 21.823654835068357 27.2419415527405 34-35 27.960361264425487 22.503763171098846 21.550426492724537 27.985449071751127 36-37 28.07171514543631 22.316950852557675 21.87813440320963 27.73319959879639 38-39 28.48895582329317 23.305722891566266 21.925200803212853 26.28012048192771 40-41 27.883650952858574 23.407723169508525 21.263791374122366 27.444834503510528 42-43 27.448275862068964 22.896551724137932 22.43260188087774 27.22257053291536 44-45 27.650232091331073 23.786225065863757 21.45276627775687 27.1107765650483 46-47 27.27728983688833 23.488080301129237 21.267252195734002 27.96737766624843 48-49 27.757560547120093 22.926339565817543 21.59618521771866 27.71991466934371 50-51 27.462311557788944 22.462311557788944 22.412060301507537 27.66331658291457 52-53 28.218318695106646 22.55959849435383 21.91969887076537 27.302383939774156 54-55 28.198695434019065 22.22779729051681 22.11490215755143 27.458605117912693 56-57 27.68439538384345 23.130958354239837 22.07727044656297 27.10737581535374 58-59 29.096612296110415 22.797992471769135 21.104140526976163 27.00125470514429 60-61 26.66583009160497 23.72945162504706 21.734220102898732 27.870498180449243 62-63 27.96737766624843 22.923462986198242 21.844416562107906 27.264742785445424 64-65 28.072818581293156 22.799748901443817 21.782799748901443 27.34463276836158 66-67 26.679221594475834 22.875078468298806 22.435655994978028 28.010043942247332 68-69 27.907560914343133 21.97940216026124 22.368751569957297 27.74428535543833 70-71 28.429648241206028 22.72613065326633 21.231155778894472 27.61306532663317 72-73 26.86774356385664 22.362443210499748 22.614840989399294 28.15497223624432 74-75 28.52362468210414 19.85008700307857 22.674340784366215 28.95194753045108 76 30.069419071976615 0.0 30.69053708439898 39.240043843624406 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 10.0 1 5.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 1.0 8 2.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.5 24 3.0 25 3.0 26 5.5 27 9.5 28 8.5 29 6.0 30 7.0 31 10.0 32 14.5 33 17.5 34 25.5 35 42.5 36 54.5 37 59.5 38 69.5 39 86.5 40 103.5 41 130.0 42 153.0 43 155.5 44 154.0 45 158.5 46 167.5 47 158.0 48 140.5 49 143.0 50 143.0 51 139.0 52 141.0 53 129.0 54 120.0 55 125.0 56 123.5 57 133.5 58 144.0 59 152.5 60 158.0 61 159.5 62 166.5 63 142.5 64 129.5 65 132.0 66 131.0 67 136.0 68 128.5 69 116.5 70 99.0 71 91.0 72 91.0 73 75.5 74 60.5 75 55.0 76 39.0 77 31.0 78 24.0 79 12.0 80 17.0 81 16.0 82 8.5 83 8.5 84 6.5 85 3.0 86 3.0 87 4.5 88 4.0 89 2.0 90 0.5 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.5 98 0.5 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.25 3 0.2 4 0.2 5 0.2 6 0.2 7 0.2 8 0.2 9 0.2 10-11 0.2 12-13 0.25 14-15 0.36250000000000004 16-17 0.3875 18-19 0.3875 20-21 0.5499999999999999 22-23 0.325 24-25 0.375 26-27 0.4 28-29 0.3125 30-31 0.3375 32-33 0.3375 34-35 0.35000000000000003 36-37 0.1002004008016032 38-39 0.2004008016032064 40-41 0.1002004008016032 42-43 0.11272545090180361 44-45 0.1628256513026052 46-47 0.16284604785168483 48-49 0.16286644951140067 50-51 0.2756201453269857 52-53 0.15033826108744675 54-55 0.10025062656641603 56-57 0.10025062656641603 58-59 0.12531328320802004 60-61 0.10028832894571893 62-63 0.07522567703109327 64-65 0.12539184952978058 66-67 0.07527286413248024 68-69 0.06275888038157398 70-71 0.05022601707684581 72-73 0.07566204287515763 74-75 0.05351170568561873 76 0.07301935012778386 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 8.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 1.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 1.0 61 0.0 62 0.0 63 0.0 64 1.0 65 1.0 66 1.0 67 1.0 68 1.0 69 0.0 70 2.0 71 6.0 72 20.0 73 59.0 74 317.0 75 840.0 76 2739.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67919735839472 97.125 2 1.1684023368046736 2.3 3 0.12700025400050802 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025400050800101596 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074667 spots for SRR11389882.sra Written 1074667 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra Read 1074656 spots for SRR11389882.sra Written 1074656 spots for SRR11389882.sra SRR ids: ['SRR11389882.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_72tbvtp_ SRR11389882.sra spots: 21493131 blocks: [[1, 1074656], [1074657, 2149312], [2149313, 3223968], [3223969, 4298624], [4298625, 5373280], [5373281, 6447936], [6447937, 7522592], [7522593, 8597248], [8597249, 9671904], [9671905, 10746560], [10746561, 11821216], [11821217, 12895872], [12895873, 13970528], [13970529, 15045184], [15045185, 16119840], [16119841, 17194496], [17194497, 18269152], [18269153, 19343808], [19343809, 20418464], [20418465, 21493131]] SRR11389882 file size 4094639 SRR11389882 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389882 SRR11389882_1.fastq SRR11389882_2.fastq Input file: SRR11389882_1.fastq Paired file: SRR11389882_2.fastq trimmed: SRR11389882-trimmed-pair1.fastq, SRR11389882-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:02:13 2024 >> started Sat Dec 7 09:02:32 2024 >> done (18.799s) 21493131 read pairs processed; of these: 1326 ( 0.01%) short read pairs filtered out after trimming by size control 10279 ( 0.05%) empty read pairs filtered out after trimming by size control 21481526 (99.95%) read pairs available; of these: 9041 ( 0.04%) trimmed read pairs available after processing 21472485 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 3 0.00% 21 2 0.00% 22 4 0.00% 23 7 0.00% 24 7 0.00% 25 10 0.00% 26 18 0.00% 27 3 0.00% 28 6 0.00% 29 5 0.00% 30 3 0.00% 31 8 0.00% 32 7 0.00% 33 11 0.00% 34 9 0.00% 35 231 0.00% 36 241 0.00% 37 270 0.00% 38 309 0.00% 39 313 0.00% 40 374 0.00% 41 388 0.00% 42 427 0.00% 43 482 0.00% 44 544 0.00% 45 573 0.00% 46 571 0.00% 47 668 0.00% 48 695 0.00% 49 761 0.00% 50 766 0.00% 51 890 0.00% 52 915 0.00% 53 974 0.00% 54 1090 0.01% 55 1301 0.01% 56 1408 0.01% 57 1533 0.01% 58 1603 0.01% 59 1813 0.01% 60 1865 0.01% 61 1890 0.01% 62 2129 0.01% 63 2267 0.01% 64 2556 0.01% 65 2680 0.01% 66 2984 0.01% 67 3193 0.01% 68 3280 0.02% 69 3714 0.02% 70 4437 0.02% 71 6326 0.03% 72 20511 0.10% 73 166246 0.77% 74 1403162 6.53% 75 9146031 42.58% 76 10689012 49.76% 21481526 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=18 prefix-density=0.54 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=24.58 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.8 sequence=CTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGATCTCCCCCAGACA criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=4.11 fanout-score-rank=16 prefix-density=0.54 prefix-fanout=3.2 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=165.23 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=2.4 sequence=CCGCTCCAACACTTCAGTTCTCACTCCACAGCTCAGAGTCAGAGCTACTAGCAATGGCAGCGGCGACCATGGCGCTCTCCTCCCCCGCGATGGCCGGCACCCCGGTGAAGGTCTCCAGGGCCACCCCCTTCGGCGAGGGCCGCATCAC SRR11389882 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:03:08 Started mapping on | Dec 07 09:03:09 Finished on | Dec 07 09:04:28 Mapping speed, Million of reads per hour | 978.90 Number of input reads | 21481526 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 19780061 Uniquely mapped reads % | 92.08% Average mapped length | 150.39 Number of splices: Total | 9100748 Number of splices: Annotated (sjdb) | 8742742 Number of splices: GT/AG | 8974538 Number of splices: GC/AG | 111963 Number of splices: AT/AC | 2851 Number of splices: Non-canonical | 11396 Mismatch rate per base, % | 0.77% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 916672 % of reads mapped to multiple loci | 4.27% Number of reads mapped to too many loci | 48153 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 784801 784801 784801 N_multimapping 916672 916672 916672 N_noFeature 426062 19288818 532756 N_ambiguous 492101 1973 110995 UnstrandedReadsAssigned:18861898 PositiveStrandReadsAssigned:489270 NegativeStrandReadsAssigned:19136310 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389882 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389882-trimmed-pair1.fastq SRR11389882-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,481,526 reads, 19,815,525 reads pseudoaligned [quant] estimated average fragment length: 221.322 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52973 SRR11389882.ke.tsv 35125 SRR11389882.se.tsv 88098 total ==> SRR11389882.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 715.826 3.74159e-05 3.35927e-06 PNS24247 1044 823.678 30.8923 2.41039 PNS24249 1928 1707.68 149.925 5.64238 PNS24246 1044 823.678 30.8923 2.41039 PNS24248 1044 823.678 30.8923 2.41039 PNS24244 1471 1250.68 14.3985 0.739889 PNS24243 293 96.2327 0 0 KQK14069 1603 1382.68 483.781 22.4866 KQK14071 474 256.448 22.1012 5.53875 ==> SRR11389882.se.tsv <== BRADI_1g14170v3 525 BRADI_1g53295v3 12 BRADI_1g59795v3 316 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 313 BRADI_1g74790v3 200 BRADI_1g09890v3 0 BRADI_1g77505v3 267 BRADI_1g48960v3 0 SRR11389882 completed mapping pipeline successfully