Starting /dee2/code/volunteer_pipeline.sh SRR11389883 current disk space = 1544299851776 free memory = 1601531096 SRR11389883 SRAfilesize 568e84e0c7ae5057c0ec86ee976fc8ed SRR11389883.sra SRR11389883.sra file validated SRR11389883 is paired end SRR11389883 is conventional basespace SRR11389883 read1 length is 39-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389883_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 39-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2765 32.0 32.0 32.0 32.0 32.0 2 31.433 32.0 32.0 32.0 32.0 32.0 3 31.3505 32.0 32.0 32.0 32.0 32.0 4 31.474 32.0 32.0 32.0 32.0 32.0 5 31.4195 32.0 32.0 32.0 32.0 32.0 6 34.5605 36.0 36.0 36.0 32.0 36.0 7 34.71775 36.0 36.0 36.0 32.0 36.0 8 34.725 36.0 36.0 36.0 32.0 36.0 9 34.675 36.0 36.0 36.0 32.0 36.0 10-11 34.574875 36.0 36.0 36.0 32.0 36.0 12-13 34.802 36.0 36.0 36.0 32.0 36.0 14-15 34.66125 36.0 36.0 36.0 32.0 36.0 16-17 34.583124999999995 36.0 36.0 36.0 32.0 36.0 18-19 34.61425 36.0 36.0 36.0 32.0 36.0 20-21 34.593125 36.0 36.0 36.0 32.0 36.0 22-23 34.60275 36.0 36.0 36.0 32.0 36.0 24-25 34.4885 36.0 36.0 36.0 32.0 36.0 26-27 34.307 36.0 36.0 36.0 32.0 36.0 28-29 34.288375 36.0 36.0 36.0 32.0 36.0 30-31 34.241625 36.0 36.0 36.0 32.0 36.0 32-33 34.24575 36.0 36.0 36.0 32.0 36.0 34-35 34.296499999999995 36.0 36.0 36.0 32.0 36.0 36-37 34.2055 36.0 36.0 36.0 32.0 36.0 38-39 34.110125 36.0 36.0 36.0 32.0 36.0 40-41 34.18372246927131 36.0 36.0 36.0 32.0 36.0 42-43 34.03340005003753 36.0 36.0 36.0 32.0 36.0 44-45 34.03390042531899 36.0 36.0 36.0 32.0 36.0 46-47 33.95571678759069 36.0 36.0 36.0 32.0 36.0 48-49 33.94846134600951 36.0 36.0 36.0 32.0 36.0 50-51 34.02539404553415 36.0 36.0 36.0 32.0 36.0 52-53 33.87728296222166 36.0 36.0 36.0 32.0 36.0 54-55 33.72522522522523 36.0 36.0 36.0 27.0 36.0 56-57 33.811186186186184 36.0 36.0 36.0 32.0 36.0 58-59 33.695070070070074 36.0 36.0 36.0 29.5 36.0 60-61 33.44306806806807 36.0 36.0 36.0 27.0 36.0 62-63 33.61257120700175 36.0 36.0 36.0 27.0 36.0 64-65 33.34993742177722 36.0 36.0 36.0 27.0 36.0 66-67 33.21754991686528 36.0 34.0 36.0 27.0 36.0 68-69 33.1160575072476 36.0 32.0 36.0 27.0 36.0 70-71 33.14266032064128 36.0 32.0 36.0 27.0 36.0 72-73 33.05060726641114 36.0 32.0 36.0 24.0 36.0 74-75 33.13516483133974 36.0 32.0 36.0 27.0 36.0 76 32.10891089108911 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 11.0 26 21.0 27 43.0 28 48.0 29 82.0 30 127.0 31 205.0 32 373.0 33 604.0 34 1237.0 35 1246.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.025 10.100000000000001 9.625 42.25 2 27.500000000000004 10.274999999999999 37.45 24.775 3 27.175 16.8 20.025000000000002 36.0 4 32.65 21.8 18.175 27.375 5 30.725 26.700000000000003 22.175 20.4 6 25.169896803423107 29.34809967279134 24.590989176944376 20.891014346841178 7 19.55 22.3 35.275 22.875 8 21.25 20.674999999999997 30.825000000000003 27.250000000000004 9 21.55 19.425 33.575 25.45 10-11 25.003125390673837 28.478559819977495 22.315289411176398 24.20302537817227 12-13 24.099999999999998 22.662499999999998 24.762500000000003 28.475 14-15 24.275 24.825 25.137500000000003 25.7625 16-17 26.150000000000002 21.8625 25.3 26.687499999999996 18-19 26.075 22.3125 23.1 28.512500000000003 20-21 24.712500000000002 23.962500000000002 24.425 26.900000000000002 22-23 26.2625 23.5875 24.0375 26.1125 24-25 25.525 23.150000000000002 24.075 27.250000000000004 26-27 24.8625 23.3875 24.625 27.125 28-29 24.887500000000003 23.925 23.625 27.5625 30-31 26.150000000000002 22.55 23.175 28.125 32-33 24.962500000000002 23.375 25.0125 26.650000000000002 34-35 26.0375 22.8625 24.0 27.1 36-37 25.624999999999996 23.1 23.7375 27.537499999999998 38-39 24.5375 23.7125 24.425 27.325 40-41 25.937968984492244 23.799399699849925 23.299149574787396 26.96348174087044 42-43 25.93194896172129 23.204903677758317 23.254941205904426 27.60820615461596 44-45 25.03127345509132 23.53014761070803 24.180635476607456 27.257943457593193 46-47 24.931198398799097 22.59194395796848 23.842882161621215 28.633975481611206 48-49 25.168876657493122 22.61696272204153 24.380785589191895 27.833375031273455 50-51 24.993745308981737 23.179884913685264 25.081310983237426 26.745058794095574 52-53 26.407305479109333 23.942957217913435 22.829622216662496 26.82011508631474 54-55 25.412912912912912 22.822822822822822 23.4984984984985 28.265765765765767 56-57 25.5005005005005 22.835335335335337 24.04904904904905 27.615115115115113 58-59 25.925925925925924 23.1981981981982 23.873873873873876 27.002002002002 60-61 26.413913913913913 22.61011011011011 24.01151151151151 26.964464464464466 62-63 25.703916906519837 23.36378425728945 23.801776999124012 27.130521837066702 64-65 25.982478097622025 22.84105131414268 23.554443053817273 27.62202753441802 66-67 25.02190511953937 22.59356615346101 23.732632369508075 28.65189635749155 68-69 25.103292850882685 22.21109302616752 24.577438337298112 28.108175785651685 70-71 26.152304609218437 22.432364729458918 23.910320641282564 27.505010020040082 72-73 26.276822687915676 22.574978039904632 23.390638725059606 27.757560547120093 74-75 26.72732067510549 19.554324894514767 25.34282700421941 28.375527426160335 76 30.975954738330973 0.0 31.32956152758133 37.6944837340877 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 2.5 21 4.5 22 4.5 23 3.0 24 3.5 25 5.5 26 5.0 27 8.0 28 10.5 29 10.0 30 12.0 31 16.0 32 23.0 33 26.5 34 32.5 35 44.0 36 61.5 37 78.0 38 88.5 39 114.0 40 128.0 41 147.5 42 171.0 43 179.5 44 184.0 45 191.5 46 211.5 47 198.5 48 163.5 49 147.5 50 148.0 51 149.5 52 144.5 53 136.5 54 129.5 55 137.0 56 139.0 57 139.5 58 146.5 59 142.0 60 141.0 61 130.5 62 116.5 63 119.0 64 114.5 65 102.0 66 98.0 67 95.5 68 90.0 69 83.0 70 71.0 71 65.0 72 69.5 73 62.0 74 43.0 75 31.5 76 31.0 77 31.5 78 23.0 79 14.5 80 14.5 81 12.0 82 7.0 83 5.0 84 3.5 85 4.0 86 3.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.675 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 39 1.0 40 2.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 1.0 69 1.0 70 0.0 71 4.0 72 7.0 73 67.0 74 244.0 75 842.0 76 2828.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.3 #Duplication Level Percentage of deduplicated Percentage of total 1 97.79033915724563 95.15 2 1.7471736896197325 3.4000000000000004 3 0.3854059609455293 1.125 4 0.051387461459403906 0.2 5 0.025693730729701953 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389883 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389883_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.92175 32.0 32.0 32.0 32.0 32.0 2 30.875 32.0 32.0 32.0 32.0 32.0 3 30.89025 32.0 32.0 32.0 32.0 32.0 4 30.72925 32.0 32.0 32.0 32.0 32.0 5 30.88075 32.0 32.0 32.0 32.0 32.0 6 34.0265 36.0 36.0 36.0 32.0 36.0 7 34.27625 36.0 36.0 36.0 32.0 36.0 8 34.08825 36.0 36.0 36.0 32.0 36.0 9 34.0705 36.0 36.0 36.0 32.0 36.0 10-11 33.937375 36.0 36.0 36.0 32.0 36.0 12-13 34.053375 36.0 36.0 36.0 32.0 36.0 14-15 33.854 36.0 36.0 36.0 32.0 36.0 16-17 33.886125 36.0 36.0 36.0 32.0 36.0 18-19 33.971875 36.0 36.0 36.0 32.0 36.0 20-21 33.675 36.0 36.0 36.0 29.5 36.0 22-23 33.87025 36.0 36.0 36.0 32.0 36.0 24-25 33.64 36.0 36.0 36.0 29.5 36.0 26-27 33.61875 36.0 36.0 36.0 27.0 36.0 28-29 33.54175 36.0 36.0 36.0 27.0 36.0 30-31 33.584875 36.0 36.0 36.0 27.0 36.0 32-33 33.495875 36.0 36.0 36.0 27.0 36.0 34-35 33.599999999999994 36.0 36.0 36.0 29.5 36.0 36-37 33.626629889669005 36.0 36.0 36.0 29.5 36.0 38-39 33.52394684052156 36.0 36.0 36.0 29.5 36.0 40-41 33.57414964380787 36.0 36.0 36.0 29.5 36.0 42-43 33.51907151819323 36.0 36.0 36.0 27.0 36.0 44-45 33.41493099121706 36.0 36.0 36.0 24.0 36.0 46-47 33.18624497991968 36.0 36.0 36.0 21.0 36.0 48-49 33.16992971887551 36.0 36.0 36.0 21.0 36.0 50-51 32.96749497991968 36.0 36.0 36.0 21.0 36.0 52-53 32.89809236947791 36.0 32.0 36.0 21.0 36.0 54-55 32.907983931709765 36.0 34.0 36.0 21.0 36.0 56-57 32.83140848606578 36.0 34.0 36.0 21.0 36.0 58-59 32.70160682902335 36.0 32.0 36.0 21.0 36.0 60-61 32.64059753954306 36.0 32.0 36.0 21.0 36.0 62-63 32.59686260151601 36.0 32.0 36.0 17.5 36.0 64-65 32.486313410346554 36.0 32.0 36.0 17.5 36.0 66-67 32.618483691558005 36.0 32.0 36.0 21.0 36.0 68-69 32.22121152736806 36.0 32.0 36.0 17.5 36.0 70-71 32.09932716285265 36.0 32.0 36.0 17.5 36.0 72-73 32.12667682040951 36.0 32.0 36.0 17.5 36.0 74-75 31.972620022700383 36.0 32.0 36.0 17.5 36.0 76 30.795815295815295 32.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 3.0 18 1.0 19 3.0 20 4.0 21 10.0 22 14.0 23 7.0 24 14.0 25 28.0 26 50.0 27 85.0 28 93.0 29 131.0 30 198.0 31 273.0 32 375.0 33 659.0 34 1154.0 35 880.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.42158092848181 19.29736511919699 9.109159347553325 39.17189460476788 2 31.099397590361445 22.841365461847392 28.514056224899598 17.545180722891565 3 23.019057171514543 27.00601805416249 19.95987963891675 30.015045135406222 4 28.535606820461386 32.29689067201605 15.170511534603811 23.996990972918756 5 29.989969909729187 32.07121364092277 16.800401203610832 21.13841524573721 6 23.019057171514543 33.324974924774324 19.934804413239718 23.721163490471415 7 22.768304914744235 16.675025075225676 33.324974924774324 27.23169508525577 8 24.49849548645938 20.561685055165498 24.37311935807422 30.566700100300903 9 23.37011033099298 21.13841524573721 27.13139418254764 28.36008024072217 10-11 27.435736677115983 26.64576802507837 19.73667711598746 26.181818181818183 12-13 27.022958223560405 20.700037636432068 23.19658763015933 29.0804165098482 14-15 25.86683417085427 23.37939698492462 23.391959798994975 27.36180904522613 16-17 28.045717156493343 23.09721175584024 21.640291384074352 27.216779703592064 18-19 26.224566691785984 22.883697563426274 23.21024868123587 27.681487063551874 20-21 28.384663733500943 23.8340666247643 21.483343808925206 26.297925832809554 22-23 27.673192771084338 23.02961847389558 22.151104417670684 27.146084337349397 24-25 26.639035418236624 24.265259984928413 21.954282843506657 27.14142175332831 26-27 27.078623461441847 24.453654860587793 21.891484551620195 26.57623712635016 28-29 28.557076478714055 23.23245008162753 21.373854075097327 26.83661936456109 30-31 27.14375392341494 23.27683615819209 22.78719397363465 26.79221594475832 32-33 27.279577995478522 24.101984426023613 21.527254458678723 27.09118311981914 34-35 27.975891511803113 23.204419889502763 22.363134103465594 26.45655449522853 36-37 27.473631341034654 23.36765444500251 21.923656454043194 27.23505775991964 38-39 27.40294006784772 23.809523809523807 22.36461867068727 26.422917451941196 40-41 27.096936212958312 22.664490205926672 21.88598694123556 28.35258663987946 42-43 27.6793567031034 23.69644427691921 21.271516522176153 27.352682497801233 44-45 27.71704988063827 24.651338107802488 21.43485362482724 26.196758386732 46-47 27.867822590777735 23.960296519663274 21.422289232315617 26.74959165724337 48-49 27.309287419881866 22.67186125424155 22.835239411838632 27.183611914037954 50-51 27.802916038210157 23.617395676219203 21.644042232277528 26.935646053293112 52-53 28.58758482030661 22.59361648655441 21.85222417692888 26.966574516210102 54-55 27.63819095477387 23.29145728643216 21.984924623115578 27.08542713567839 56-57 26.714393368500378 23.800552624968603 22.896257221803566 26.588796784727453 58-59 27.93766494910142 23.35050898579867 21.942943320346863 26.768882744753046 60-61 27.467972871137903 23.926149208741524 22.255714644561667 26.350163275558902 62-63 26.94964209468793 23.05663694587467 22.918498053497427 27.07522290593997 64-65 27.844123192960403 24.311753614079194 21.407919547454433 26.436203645505973 66-67 27.5216681321442 23.024745634970483 21.74349956035674 27.71008667252858 68-69 26.991706458909277 23.72455390801709 21.538074893189243 27.74566473988439 70-71 28.11714429361488 23.29059829059829 23.02664655605832 25.565610859728505 72-73 26.70117409418003 23.343012245928545 22.96427218785507 26.991541472036356 74-75 27.88024592354985 19.914461373964183 23.643410852713178 28.561881849772785 76 29.22077922077922 0.0 30.844155844155846 39.935064935064936 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 12.0 1 6.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 2.0 22 2.0 23 2.5 24 3.0 25 2.0 26 2.5 27 5.0 28 4.5 29 4.0 30 7.5 31 10.5 32 13.0 33 18.5 34 24.0 35 39.5 36 57.0 37 65.0 38 88.0 39 107.0 40 113.5 41 131.0 42 147.0 43 153.0 44 157.5 45 167.0 46 172.0 47 165.5 48 159.5 49 156.5 50 155.0 51 148.0 52 129.5 53 125.0 54 140.0 55 139.0 56 136.5 57 151.5 58 165.5 59 162.0 60 158.5 61 156.0 62 143.5 63 140.5 64 137.0 65 127.0 66 115.0 67 106.0 68 99.5 69 91.5 70 85.5 71 82.0 72 75.5 73 70.0 74 55.5 75 42.0 76 39.5 77 29.5 78 19.0 79 15.0 80 11.5 81 10.0 82 8.5 83 5.0 84 5.5 85 5.0 86 3.0 87 2.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.4 3 0.3 4 0.3 5 0.3 6 0.3 7 0.3 8 0.3 9 0.3 10-11 0.3125 12-13 0.36250000000000004 14-15 0.5 16-17 0.475 18-19 0.475 20-21 0.5625 22-23 0.4 24-25 0.475 26-27 0.475 28-29 0.46249999999999997 30-31 0.43750000000000006 32-33 0.475 34-35 0.44999999999999996 36-37 0.15045135406218654 38-39 0.2131394182547643 40-41 0.10035122930255895 42-43 0.13801756587202008 44-45 0.13801756587202008 46-47 0.11295180722891565 48-49 0.13805220883534136 50-51 0.15060240963855423 52-53 0.12550200803212852 54-55 0.07532011046949535 56-57 0.05021340697966357 58-59 0.11298016570424303 60-61 0.05021340697966357 62-63 0.025109855618330193 64-65 0.11300853842290307 66-67 0.02511616225040814 68-69 0.03768370807687476 70-71 0.0 72-73 0.02524296352391771 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 12.0 36 0.0 37 0.0 38 0.0 39 1.0 40 2.0 41 0.0 42 0.0 43 0.0 44 0.0 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 1.0 69 1.0 70 2.0 71 6.0 72 19.0 73 76.0 74 270.0 75 834.0 76 2772.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.07692307692307 95.625 2 1.6153846153846154 3.15 3 0.23076923076923078 0.675 4 0.02564102564102564 0.1 5 0.0 0.0 6 0.02564102564102564 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02564102564102564 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 12 0.3 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra Read 730688 spots for SRR11389883.sra Written 730688 spots for SRR11389883.sra SRR ids: ['SRR11389883.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5nzbur2d SRR11389883.sra spots: 14613760 blocks: [[1, 730688], [730689, 1461376], [1461377, 2192064], [2192065, 2922752], [2922753, 3653440], [3653441, 4384128], [4384129, 5114816], [5114817, 5845504], [5845505, 6576192], [6576193, 7306880], [7306881, 8037568], [8037569, 8768256], [8768257, 9498944], [9498945, 10229632], [10229633, 10960320], [10960321, 11691008], [11691009, 12421696], [12421697, 13152384], [13152385, 13883072], [13883073, 14613760]] SRR11389883 file size 2777270 SRR11389883 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389883 SRR11389883_1.fastq SRR11389883_2.fastq Input file: SRR11389883_1.fastq Paired file: SRR11389883_2.fastq trimmed: SRR11389883-trimmed-pair1.fastq, SRR11389883-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:02:34 2024 >> started Sat Dec 7 09:02:47 2024 >> done (12.892s) 14613760 read pairs processed; of these: 861 ( 0.01%) short read pairs filtered out after trimming by size control 5430 ( 0.04%) empty read pairs filtered out after trimming by size control 14607469 (99.96%) read pairs available; of these: 6622 ( 0.05%) trimmed read pairs available after processing 14600847 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 12 0.00% 23 11 0.00% 24 9 0.00% 25 10 0.00% 26 16 0.00% 27 15 0.00% 28 14 0.00% 29 8 0.00% 30 22 0.00% 31 23 0.00% 32 24 0.00% 33 13 0.00% 34 20 0.00% 35 160 0.00% 36 163 0.00% 37 188 0.00% 38 233 0.00% 39 255 0.00% 40 254 0.00% 41 258 0.00% 42 295 0.00% 43 308 0.00% 44 339 0.00% 45 349 0.00% 46 377 0.00% 47 446 0.00% 48 427 0.00% 49 460 0.00% 50 513 0.00% 51 554 0.00% 52 515 0.00% 53 639 0.00% 54 684 0.00% 55 773 0.01% 56 816 0.01% 57 863 0.01% 58 923 0.01% 59 986 0.01% 60 1053 0.01% 61 1067 0.01% 62 1150 0.01% 63 1277 0.01% 64 1316 0.01% 65 1460 0.01% 66 1636 0.01% 67 1746 0.01% 68 1704 0.01% 69 1912 0.01% 70 2488 0.02% 71 3615 0.02% 72 14077 0.10% 73 116314 0.80% 74 962458 6.59% 75 6274452 42.95% 76 7207759 49.34% 14607469 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=15 prefix-density=1.00 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=16.73 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.8 sequence=TTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGATCTCCCC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=24 prefix-density=0.68 prefix-fanout=2.0 sequence=TGAAGCAGATCGAGTA criterion=fanout-score sequence-density=0.22 sequence-density-rank=17 fanout-score=88.28 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=17.7 sequence=GCCGCCGCCACCCTCCCTTCCATGGTCGCCGCCGCTCCCCGGAGCAGCAGCCGGCTGGTGGTGCGCGCATCGGCCGTAGGAGGGTTCCGGAAGGCGGCGGGGG SRR11389883 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:03:16 Started mapping on | Dec 07 09:03:16 Finished on | Dec 07 09:04:35 Mapping speed, Million of reads per hour | 665.66 Number of input reads | 14607469 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 13270881 Uniquely mapped reads % | 90.85% Average mapped length | 150.38 Number of splices: Total | 6236027 Number of splices: Annotated (sjdb) | 5989233 Number of splices: GT/AG | 6149283 Number of splices: GC/AG | 77347 Number of splices: AT/AC | 1915 Number of splices: Non-canonical | 7482 Mismatch rate per base, % | 0.81% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 778975 % of reads mapped to multiple loci | 5.33% Number of reads mapped to too many loci | 34526 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.77% % of reads unmapped: other | 0.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 557620 557620 557620 N_multimapping 778975 778975 778975 N_noFeature 292337 12951099 369275 N_ambiguous 325290 1429 85448 UnstrandedReadsAssigned:12653254 PositiveStrandReadsAssigned:318353 NegativeStrandReadsAssigned:12816158 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389883 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389883-trimmed-pair1.fastq SRR11389883-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,607,469 reads, 13,449,200 reads pseudoaligned [quant] estimated average fragment length: 226.092 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52973 SRR11389883.ke.tsv 35125 SRR11389883.se.tsv 88098 total ==> SRR11389883.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 711.182 1.47002e-08 1.97623e-09 PNS24247 1044 818.908 14.0152 1.6363 PNS24249 1928 1702.91 97.11 5.45216 PNS24246 1044 818.908 14.0152 1.6363 PNS24248 1044 818.908 14.0152 1.6363 PNS24244 1471 1245.91 23.8443 1.82976 PNS24243 293 91.0194 0 0 KQK14069 1603 1377.91 354.574 24.6027 KQK14071 474 251.719 37.1134 14.0965 ==> SRR11389883.se.tsv <== BRADI_1g14170v3 409 BRADI_1g53295v3 4 BRADI_1g59795v3 156 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 281 BRADI_1g74790v3 452 BRADI_1g09890v3 0 BRADI_1g77505v3 149 BRADI_1g48960v3 0 SRR11389883 completed mapping pipeline successfully