Starting /dee2/code/volunteer_pipeline.sh SRR11389884 current disk space = 1544249651200 free memory = 1604275316 SRR11389884 SRAfilesize 5cfce8f832736b88c20c93e1b584b55a SRR11389884.sra SRR11389884.sra file validated SRR11389884 is paired end SRR11389884 is conventional basespace SRR11389884 read1 length is 40-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389884_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 40-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.41025 32.0 32.0 32.0 32.0 32.0 2 31.54675 32.0 32.0 32.0 32.0 32.0 3 31.398 32.0 32.0 32.0 32.0 32.0 4 31.47825 32.0 32.0 32.0 32.0 32.0 5 31.52425 32.0 32.0 32.0 32.0 32.0 6 34.578 36.0 36.0 36.0 32.0 36.0 7 34.6285 36.0 36.0 36.0 32.0 36.0 8 34.784 36.0 36.0 36.0 32.0 36.0 9 34.73575 36.0 36.0 36.0 32.0 36.0 10-11 34.74575 36.0 36.0 36.0 32.0 36.0 12-13 34.728625 36.0 36.0 36.0 32.0 36.0 14-15 34.728125 36.0 36.0 36.0 32.0 36.0 16-17 34.716625 36.0 36.0 36.0 32.0 36.0 18-19 34.776875000000004 36.0 36.0 36.0 32.0 36.0 20-21 34.759125 36.0 36.0 36.0 32.0 36.0 22-23 34.740375 36.0 36.0 36.0 32.0 36.0 24-25 34.572625 36.0 36.0 36.0 32.0 36.0 26-27 34.495374999999996 36.0 36.0 36.0 32.0 36.0 28-29 34.38225 36.0 36.0 36.0 32.0 36.0 30-31 34.245875 36.0 36.0 36.0 32.0 36.0 32-33 34.230375 36.0 36.0 36.0 32.0 36.0 34-35 34.314125000000004 36.0 36.0 36.0 32.0 36.0 36-37 34.385625000000005 36.0 36.0 36.0 32.0 36.0 38-39 34.28775 36.0 36.0 36.0 32.0 36.0 40-41 34.142022224306075 36.0 36.0 36.0 32.0 36.0 42-43 34.181420355088775 36.0 36.0 36.0 32.0 36.0 44-45 34.11277819454864 36.0 36.0 36.0 32.0 36.0 46-47 34.230932733183295 36.0 36.0 36.0 32.0 36.0 48-49 34.14941235308827 36.0 36.0 36.0 32.0 36.0 50-51 34.15928982245561 36.0 36.0 36.0 32.0 36.0 52-53 33.97586896724181 36.0 36.0 36.0 32.0 36.0 54-55 33.84671167791948 36.0 36.0 36.0 27.0 36.0 56-57 33.88369184592296 36.0 36.0 36.0 32.0 36.0 58-59 34.073649440432 36.0 36.0 36.0 29.5 36.0 60-61 33.583437578183634 36.0 36.0 36.0 27.0 36.0 62-63 33.6224030037547 36.0 36.0 36.0 27.0 36.0 64-65 33.29102467844445 36.0 36.0 36.0 27.0 36.0 66-67 33.344641962944415 36.0 34.0 36.0 27.0 36.0 68-69 33.17580528236665 36.0 32.0 36.0 27.0 36.0 70-71 33.20970167961895 36.0 32.0 36.0 27.0 36.0 72-73 33.23761723069272 36.0 34.0 36.0 27.0 36.0 74-75 33.20081535430786 36.0 32.0 36.0 27.0 36.0 76 32.61894586894587 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 2.0 23 2.0 24 3.0 25 7.0 26 23.0 27 22.0 28 62.0 29 96.0 30 129.0 31 194.0 32 262.0 33 542.0 34 1226.0 35 1428.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.375 9.9 12.075 39.65 2 30.15 10.95 32.85 26.05 3 26.924999999999997 18.375 19.525000000000002 35.175 4 32.35 24.85 17.974999999999998 24.825 5 29.275000000000002 27.35 21.65 21.725 6 24.32092555331992 29.652917505030178 23.541247484909455 22.484909456740443 7 17.974999999999998 23.974999999999998 36.175000000000004 21.875 8 21.05 21.775 29.7 27.474999999999998 9 20.200000000000003 18.175 34.625 27.0 10-11 23.962500000000002 28.3375 22.55 25.15 12-13 25.3125 22.875 24.75 27.0625 14-15 24.637500000000003 23.7625 25.4625 26.137500000000003 16-17 25.674999999999997 24.0625 23.974999999999998 26.2875 18-19 23.724999999999998 24.275 24.6125 27.3875 20-21 24.712500000000002 23.8875 24.7 26.700000000000003 22-23 25.324999999999996 24.4875 24.525 25.662499999999998 24-25 25.412499999999998 23.5125 24.712500000000002 26.3625 26-27 24.825 24.825 24.125 26.224999999999998 28-29 25.3125 23.8125 24.3125 26.5625 30-31 24.05 23.75 24.425 27.775 32-33 25.05 23.8625 24.875 26.2125 34-35 25.0375 23.8875 24.212500000000002 26.8625 36-37 25.2 23.875 24.5625 26.3625 38-39 25.2875 23.825 23.674999999999997 27.212500000000002 40-41 25.17814726840855 23.92799099887486 24.34054256782098 26.553319164895612 42-43 25.85646411602901 22.943235808952238 24.968742185546386 26.231557889472366 44-45 24.293573393348336 24.618654663665918 24.60615153788447 26.481620405101275 46-47 25.618904726181547 24.118529632408105 23.168292073018254 27.094273568392097 48-49 25.84396099024756 22.980745186296573 23.99349837459365 27.181795448862218 50-51 24.88122030507627 24.131032758189548 23.85596399099775 27.131782945736433 52-53 25.431357839459867 23.868467116779193 23.3183295823956 27.38184546136534 54-55 25.18129532383096 23.40585146286572 24.3935983995999 27.019254813703427 56-57 26.125562781390695 23.261630815407706 23.899449724862432 26.713356678339167 58-59 24.72795497185741 24.327704815509694 23.777360850531583 27.166979362101312 60-61 25.55666750062547 23.204903677758317 23.992994746059544 27.24543407555667 62-63 25.431789737171464 23.92991239048811 23.57947434292866 27.058823529411764 64-65 26.16097133558643 23.845287269996245 24.08311428213794 25.910627112279382 66-67 25.237856785177765 23.460190285428144 24.499248873309966 26.802704056084124 68-69 26.015037593984964 23.333333333333332 24.273182957393484 26.378446115288224 70-71 25.18174981198295 23.802958134870895 24.141388819252946 26.873903233893202 72-73 26.391856227221318 23.94118386326505 23.161995727032803 26.504964182480833 74-75 25.951877313590693 20.848757271285034 24.788471708090956 28.410893707033313 76 27.20797720797721 0.0 33.76068376068376 39.03133903133903 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 3.0 22 4.0 23 5.0 24 5.5 25 5.0 26 7.0 27 8.0 28 8.0 29 10.5 30 15.5 31 22.5 32 29.0 33 32.5 34 36.0 35 54.5 36 81.5 37 95.0 38 100.5 39 123.0 40 149.5 41 172.0 42 196.0 43 205.0 44 212.0 45 200.0 46 190.0 47 203.5 48 191.0 49 178.0 50 177.0 51 150.0 52 146.5 53 141.0 54 122.0 55 121.0 56 112.0 57 101.5 58 96.0 59 99.5 60 104.0 61 107.5 62 109.0 63 110.5 64 100.0 65 91.5 66 91.0 67 86.0 68 75.5 69 70.0 70 77.5 71 84.0 72 74.0 73 58.0 74 51.0 75 45.0 76 37.0 77 32.5 78 24.5 79 15.5 80 13.0 81 10.5 82 9.5 83 7.5 84 4.0 85 4.0 86 4.0 87 2.0 88 1.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.6 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 2.0 62 0.0 63 0.0 64 1.0 65 0.0 66 0.0 67 3.0 68 2.0 69 0.0 70 0.0 71 3.0 72 15.0 73 64.0 74 250.0 75 849.0 76 2808.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09044972208186 98.05 2 0.7579585649317837 1.5 3 0.15159171298635674 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389884 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389884_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1165 32.0 32.0 32.0 32.0 32.0 2 30.88725 32.0 32.0 32.0 32.0 32.0 3 30.90075 32.0 32.0 32.0 32.0 32.0 4 30.907 32.0 32.0 32.0 32.0 32.0 5 30.86225 32.0 32.0 32.0 32.0 32.0 6 34.13525 36.0 36.0 36.0 32.0 36.0 7 34.3635 36.0 36.0 36.0 32.0 36.0 8 34.11575 36.0 36.0 36.0 32.0 36.0 9 34.20125 36.0 36.0 36.0 32.0 36.0 10-11 34.15075 36.0 36.0 36.0 32.0 36.0 12-13 34.19625 36.0 36.0 36.0 32.0 36.0 14-15 33.91 36.0 36.0 36.0 32.0 36.0 16-17 34.030125 36.0 36.0 36.0 32.0 36.0 18-19 33.933375 36.0 36.0 36.0 32.0 36.0 20-21 33.923125 36.0 36.0 36.0 32.0 36.0 22-23 33.83275 36.0 36.0 36.0 29.5 36.0 24-25 33.748625 36.0 36.0 36.0 29.5 36.0 26-27 33.7115 36.0 36.0 36.0 32.0 36.0 28-29 33.664375 36.0 36.0 36.0 29.5 36.0 30-31 33.66075 36.0 36.0 36.0 27.0 36.0 32-33 33.630750000000006 36.0 36.0 36.0 29.5 36.0 34-35 33.59425 36.0 36.0 36.0 27.0 36.0 36-37 33.65077577577577 36.0 36.0 36.0 29.5 36.0 38-39 33.60785785785786 36.0 36.0 36.0 29.5 36.0 40-41 33.477775522706686 36.0 36.0 36.0 27.0 36.0 42-43 33.703629536921156 36.0 36.0 36.0 32.0 36.0 44-45 33.41214017521902 36.0 36.0 36.0 21.0 36.0 46-47 33.15882352941176 36.0 36.0 36.0 21.0 36.0 48-49 33.28423028785983 36.0 36.0 36.0 21.0 36.0 50-51 33.0648310387985 36.0 36.0 36.0 21.0 36.0 52-53 33.07008760951189 36.0 36.0 36.0 24.0 36.0 54-55 32.98623279098874 36.0 34.0 36.0 21.0 36.0 56-57 33.018402603905855 36.0 34.0 36.0 24.0 36.0 58-59 32.6648299208141 36.0 32.0 36.0 21.0 36.0 60-61 32.75582268970699 36.0 32.0 36.0 21.0 36.0 62-63 32.69569030318216 36.0 32.0 36.0 21.0 36.0 64-65 32.64404719516155 36.0 32.0 36.0 17.5 36.0 66-67 32.66002506265664 36.0 32.0 36.0 21.0 36.0 68-69 32.341401902481685 36.0 32.0 36.0 21.0 36.0 70-71 32.21397790091834 36.0 32.0 36.0 21.0 36.0 72-73 32.20026348639334 36.0 32.0 36.0 21.0 36.0 74-75 32.17352909480261 36.0 32.0 36.0 17.5 36.0 76 30.95604808414726 32.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 3.0 15 5.0 16 0.0 17 3.0 18 4.0 19 4.0 20 4.0 21 4.0 22 11.0 23 10.0 24 21.0 25 26.0 26 39.0 27 89.0 28 82.0 29 130.0 30 184.0 31 221.0 32 402.0 33 608.0 34 1220.0 35 923.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.83854818523154 18.3729662077597 12.690863579474343 38.09762202753441 2 30.387984981226534 23.90488110137672 26.23279098873592 19.474342928660825 3 26.576576576576578 27.72772772772773 19.86986986986987 25.825825825825827 4 30.78078078078078 30.355355355355357 16.49149149149149 22.372372372372375 5 29.72972972972973 31.73173173173173 19.094094094094093 19.444444444444446 6 23.0980980980981 34.35935935935936 19.56956956956957 22.972972972972975 7 22.07207207207207 16.016016016016017 35.28528528528528 26.626626626626624 8 23.723723723723726 21.546546546546548 25.575575575575577 29.154154154154156 9 25.0 18.893893893893893 26.8018018018018 29.304304304304303 10-11 27.227227227227228 26.83933933933934 19.11911911911912 26.814314314314313 12-13 27.55383074611918 20.54331497245869 23.059589384076116 28.84326489734602 14-15 26.10602832435142 23.86263942849981 24.00050131595438 26.030830931194387 16-17 27.349035329491358 22.563267351540965 22.738661989476324 27.349035329491358 18-19 26.97079834565735 23.361323474119562 22.52161925053265 27.146258929690436 20-21 27.71991466934371 23.7796461287489 22.67536704730832 25.82507215459907 22-23 27.424204460035078 24.141819092959157 22.62590829366074 25.808068153345026 24-25 27.11779448621554 23.29573934837093 22.69423558897243 26.8922305764411 26-27 27.53477879433513 24.025567113673393 22.87254041859882 25.567113673392655 28-29 26.885492357805063 23.678276121272866 22.500626409421198 26.935605111500877 30-31 26.917293233082706 23.533834586466167 22.13032581453634 27.418546365914786 32-33 26.337551685252475 23.35546923944368 23.518356095727352 26.788622979576495 34-35 26.910548734652966 24.54272112252568 22.199949887246305 26.34678025557504 36-37 27.690765568224535 23.919308357348704 22.30296955268763 26.08695652173913 38-39 27.03346283995488 23.850106529640307 22.672014036846722 26.44441659355809 40-41 27.502819195589524 23.781481017416365 22.453326650795642 26.26237313619847 42-43 26.949110052644777 24.141388819252946 22.5871145650539 26.322386563048383 44-45 27.14966156931562 23.364251692153424 23.075958886939084 26.41012785159188 46-47 26.57307595888694 23.677613436951617 22.775131611932814 26.97417899222863 48-49 26.52626300614266 24.771217249592578 22.45204964272283 26.250470101541936 50-51 26.99448068238836 23.406924234821876 23.331660812844955 26.26693426994481 52-53 26.97417899222863 23.539734269240412 23.289044873401853 26.197041865129105 54-55 27.781954887218046 23.909774436090224 22.355889724310778 25.952380952380956 56-57 26.48459032823854 24.129290904535207 22.939113004259585 26.447005762966675 58-59 27.57366771159875 23.147335423197493 23.147335423197493 26.13166144200627 60-61 27.280701754385966 23.847117794486216 22.406015037593985 26.466165413533833 62-63 27.541682336718065 24.33245581045506 22.928419205214993 25.197442647611883 64-65 27.135867519759127 24.024589135616612 22.519131852967007 26.320411491657257 66-67 27.369608826479435 23.608324974924773 23.244734202607823 25.77733199598796 68-69 27.585341365461847 24.460341365461847 22.48995983935743 25.464357429718877 70-71 27.882441597588546 23.3232856066315 22.607385079125848 26.186887716654105 72-73 26.720545523424676 23.6646041166814 22.919560550574566 26.695289809319355 74-75 28.07961269499731 20.911780527165142 23.15761161915008 27.850995158687464 76 29.349868470499814 0.0 32.35625704622323 38.293874483276966 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.5 18 0.5 19 0.5 20 2.0 21 4.0 22 6.5 23 6.5 24 5.0 25 5.5 26 6.0 27 9.0 28 9.5 29 8.0 30 13.5 31 16.5 32 18.0 33 25.0 34 32.0 35 46.0 36 66.5 37 82.0 38 94.0 39 112.0 40 131.0 41 139.0 42 144.0 43 170.5 44 184.5 45 182.0 46 179.5 47 182.5 48 181.0 49 163.5 50 159.5 51 153.5 52 139.5 53 127.0 54 129.5 55 132.5 56 123.5 57 121.5 58 131.5 59 140.5 60 131.0 61 129.0 62 133.5 63 120.0 64 98.5 65 93.0 66 104.5 67 105.5 68 100.0 69 91.5 70 93.5 71 94.5 72 76.5 73 65.0 74 54.5 75 41.0 76 39.0 77 36.0 78 25.5 79 16.5 80 16.5 81 15.0 82 9.5 83 7.5 84 3.5 85 2.0 86 2.5 87 2.0 88 1.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.125 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.1 9 0.1 10-11 0.1 12-13 0.15 14-15 0.2625 16-17 0.22499999999999998 18-19 0.2625 20-21 0.3875 22-23 0.22499999999999998 24-25 0.25 26-27 0.2625 28-29 0.22499999999999998 30-31 0.25 32-33 0.2375 34-35 0.22499999999999998 36-37 0.13763763763763764 38-39 0.16266266266266266 40-41 0.12514078338130397 42-43 0.1501877346683354 44-45 0.1501877346683354 46-47 0.1501877346683354 48-49 0.16270337922403005 50-51 0.22528160200250313 52-53 0.1501877346683354 54-55 0.1251564455569462 56-57 0.07511266900350526 58-59 0.15024414673845 60-61 0.07513148009015778 62-63 0.06264094211976949 64-65 0.1252975817566721 66-67 0.05012531328320802 68-69 0.050175614651279475 70-71 0.025113008538422906 72-73 0.05048592704783542 74-75 0.026888948642108095 76 0.03756574004507889 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 4.0 36 0.0 37 0.0 38 0.0 39 0.0 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 2.0 62 0.0 63 0.0 64 1.0 65 0.0 66 0.0 67 3.0 68 2.0 69 0.0 70 6.0 71 9.0 72 17.0 73 81.0 74 306.0 75 904.0 76 2662.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8604710053178 97.6 2 1.0382375284882248 2.0500000000000003 3 0.05064573309698658 0.15 4 0.05064573309698658 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620666 spots for SRR11389884.sra Written 620666 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra Read 620658 spots for SRR11389884.sra Written 620658 spots for SRR11389884.sra SRR ids: ['SRR11389884.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o8m8d_kl SRR11389884.sra spots: 12413168 blocks: [[1, 620658], [620659, 1241316], [1241317, 1861974], [1861975, 2482632], [2482633, 3103290], [3103291, 3723948], [3723949, 4344606], [4344607, 4965264], [4965265, 5585922], [5585923, 6206580], [6206581, 6827238], [6827239, 7447896], [7447897, 8068554], [8068555, 8689212], [8689213, 9309870], [9309871, 9930528], [9930529, 10551186], [10551187, 11171844], [11171845, 11792502], [11792503, 12413168]] SRR11389884 file size 2355400 SRR11389884 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389884 SRR11389884_1.fastq SRR11389884_2.fastq Input file: SRR11389884_1.fastq Paired file: SRR11389884_2.fastq trimmed: SRR11389884-trimmed-pair1.fastq, SRR11389884-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:05:12 2024 >> started Sat Dec 7 09:05:24 2024 >> done (11.785s) 12413168 read pairs processed; of these: 805 ( 0.01%) short read pairs filtered out after trimming by size control 5530 ( 0.04%) empty read pairs filtered out after trimming by size control 12406833 (99.95%) read pairs available; of these: 6681 ( 0.05%) trimmed read pairs available after processing 12400152 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 9 0.00% 21 1 0.00% 22 2 0.00% 23 3 0.00% 24 6 0.00% 25 5 0.00% 26 2 0.00% 27 2 0.00% 28 7 0.00% 29 5 0.00% 30 6 0.00% 31 4 0.00% 32 4 0.00% 33 6 0.00% 34 3 0.00% 35 117 0.00% 36 116 0.00% 37 135 0.00% 38 154 0.00% 39 153 0.00% 40 183 0.00% 41 230 0.00% 42 217 0.00% 43 261 0.00% 44 289 0.00% 45 301 0.00% 46 309 0.00% 47 369 0.00% 48 373 0.00% 49 426 0.00% 50 417 0.00% 51 405 0.00% 52 525 0.00% 53 584 0.00% 54 633 0.01% 55 731 0.01% 56 823 0.01% 57 863 0.01% 58 871 0.01% 59 968 0.01% 60 1040 0.01% 61 1130 0.01% 62 1196 0.01% 63 1315 0.01% 64 1395 0.01% 65 1544 0.01% 66 1690 0.01% 67 1891 0.02% 68 1845 0.01% 69 2116 0.02% 70 2601 0.02% 71 3625 0.03% 72 11408 0.09% 73 100582 0.81% 74 854946 6.89% 75 5401569 43.54% 76 6006419 48.41% 12406833 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=22 prefix-density=0.36 prefix-fanout=2.1 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=182.87 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=20.4 sequence=CGCCGCCGCCGG criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.31 fanout-score-rank=31 prefix-density=0.22 prefix-fanout=1.2 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=192.68 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=21.3 sequence=CCGCCGCCGCCTCC SRR11389884 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:05:56 Started mapping on | Dec 07 09:05:56 Finished on | Dec 07 09:06:49 Mapping speed, Million of reads per hour | 842.73 Number of input reads | 12406833 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 11296501 Uniquely mapped reads % | 91.05% Average mapped length | 150.32 Number of splices: Total | 5318234 Number of splices: Annotated (sjdb) | 5067529 Number of splices: GT/AG | 5244603 Number of splices: GC/AG | 64031 Number of splices: AT/AC | 1950 Number of splices: Non-canonical | 7650 Mismatch rate per base, % | 0.80% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 555768 % of reads mapped to multiple loci | 4.48% Number of reads mapped to too many loci | 24319 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.57% % of reads unmapped: other | 0.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 554568 554568 554568 N_multimapping 555768 555768 555768 N_noFeature 337757 10997904 421012 N_ambiguous 272746 1416 59965 UnstrandedReadsAssigned:10685998 PositiveStrandReadsAssigned:297181 NegativeStrandReadsAssigned:10815524 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389884 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389884-trimmed-pair1.fastq SRR11389884-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,406,833 reads, 11,283,472 reads pseudoaligned [quant] estimated average fragment length: 211.223 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52973 SRR11389884.ke.tsv 35125 SRR11389884.se.tsv 88098 total ==> SRR11389884.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 726.065 0 0 PNS24247 1044 833.777 28.0367 4.00606 PNS24249 1928 1717.78 175.515 12.1728 PNS24246 1044 833.777 28.0367 4.00606 PNS24248 1044 833.777 28.0367 4.00606 PNS24244 1471 1260.78 26.3746 2.49224 PNS24243 293 101.022 0 0 KQK14069 1603 1392.78 1130.82 96.7284 KQK14071 474 267.296 66.0824 29.4534 ==> SRR11389884.se.tsv <== BRADI_1g14170v3 1236 BRADI_1g53295v3 19 BRADI_1g59795v3 276 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 212 BRADI_1g74790v3 151 BRADI_1g09890v3 0 BRADI_1g77505v3 201 BRADI_1g48960v3 0 SRR11389884 completed mapping pipeline successfully