Starting /dee2/code/volunteer_pipeline.sh SRR11389885 current disk space = 1544256765952 free memory = 1604261924 SRR11389885 SRAfilesize ed8e6fec5388f717a7983c58dc1598c0 SRR11389885.sra SRR11389885.sra file validated SRR11389885 is paired end SRR11389885 is conventional basespace SRR11389885 read1 length is 44-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389885_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 44-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4195 32.0 32.0 32.0 32.0 32.0 2 31.5415 32.0 32.0 32.0 32.0 32.0 3 31.463 32.0 32.0 32.0 32.0 32.0 4 31.42675 32.0 32.0 32.0 32.0 32.0 5 31.51375 32.0 32.0 32.0 32.0 32.0 6 34.6095 36.0 36.0 36.0 32.0 36.0 7 34.6425 36.0 36.0 36.0 32.0 36.0 8 34.80625 36.0 36.0 36.0 32.0 36.0 9 34.69875 36.0 36.0 36.0 32.0 36.0 10-11 34.726375000000004 36.0 36.0 36.0 32.0 36.0 12-13 34.807125 36.0 36.0 36.0 32.0 36.0 14-15 34.708875 36.0 36.0 36.0 32.0 36.0 16-17 34.7555 36.0 36.0 36.0 32.0 36.0 18-19 34.699875000000006 36.0 36.0 36.0 32.0 36.0 20-21 34.7075 36.0 36.0 36.0 32.0 36.0 22-23 34.671499999999995 36.0 36.0 36.0 32.0 36.0 24-25 34.576 36.0 36.0 36.0 32.0 36.0 26-27 34.46025 36.0 36.0 36.0 32.0 36.0 28-29 34.3345 36.0 36.0 36.0 32.0 36.0 30-31 34.354375 36.0 36.0 36.0 32.0 36.0 32-33 34.348124999999996 36.0 36.0 36.0 32.0 36.0 34-35 34.299 36.0 36.0 36.0 32.0 36.0 36-37 34.299 36.0 36.0 36.0 32.0 36.0 38-39 34.128 36.0 36.0 36.0 32.0 36.0 40-41 34.174875 36.0 36.0 36.0 32.0 36.0 42-43 34.180125000000004 36.0 36.0 36.0 32.0 36.0 44-45 34.03688572143036 36.0 36.0 36.0 32.0 36.0 46-47 34.064141035258814 36.0 36.0 36.0 32.0 36.0 48-49 34.13028257064266 36.0 36.0 36.0 32.0 36.0 50-51 34.073918057352415 36.0 36.0 36.0 32.0 36.0 52-53 33.91831373530148 36.0 36.0 36.0 32.0 36.0 54-55 33.799724793595196 36.0 36.0 36.0 27.0 36.0 56-57 34.01013259944959 36.0 36.0 36.0 32.0 36.0 58-59 33.93770327745809 36.0 36.0 36.0 32.0 36.0 60-61 33.55904428321241 36.0 36.0 36.0 27.0 36.0 62-63 33.66798750152958 36.0 36.0 36.0 27.0 36.0 64-65 33.50764219493861 36.0 36.0 36.0 27.0 36.0 66-67 33.40165372087196 36.0 34.0 36.0 27.0 36.0 68-69 33.11688909695938 36.0 32.0 36.0 27.0 36.0 70-71 33.16458215498626 36.0 32.0 36.0 27.0 36.0 72-73 33.048470391501084 36.0 34.0 36.0 21.0 36.0 74-75 33.17580382519884 36.0 32.0 36.0 27.0 36.0 76 32.48028419182948 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 5.0 25 8.0 26 16.0 27 27.0 28 69.0 29 85.0 30 124.0 31 178.0 32 307.0 33 584.0 34 1234.0 35 1360.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.2 9.875 8.774999999999999 47.15 2 25.025 10.9 41.675000000000004 22.400000000000002 3 24.875 14.899999999999999 22.2 38.025 4 32.35 22.025 16.925 28.7 5 29.799999999999997 26.724999999999998 22.275 21.2 6 26.053159478435305 28.88665997993982 23.696088264794383 21.36409227683049 7 18.8 22.85 36.275 22.075 8 19.475 20.3 32.35 27.875 9 20.95 19.425 32.475 27.150000000000002 10-11 24.453056632079008 26.828353544193025 23.465433179147393 25.25315664458057 12-13 25.874999999999996 22.0625 23.962500000000002 28.1 14-15 24.7875 23.075000000000003 26.150000000000002 25.9875 16-17 26.2125 22.9375 23.4875 27.3625 18-19 25.55 22.2 23.8875 28.3625 20-21 25.087500000000002 22.125 25.124999999999996 27.6625 22-23 25.587500000000002 23.1125 24.375 26.924999999999997 24-25 25.8625 22.35 23.9 27.8875 26-27 25.5125 22.6125 24.625 27.250000000000004 28-29 25.2875 23.525 23.9125 27.275 30-31 26.2875 22.5 23.5 27.712500000000002 32-33 25.837500000000002 23.025000000000002 23.6125 27.525 34-35 26.5625 23.025000000000002 24.075 26.337500000000002 36-37 25.974999999999998 22.2125 23.95 27.8625 38-39 24.7375 23.400000000000002 24.2875 27.575 40-41 26.0625 23.0625 22.975 27.900000000000002 42-43 24.837500000000002 22.7625 25.2 27.200000000000003 44-45 25.2281535191899 22.59032379047381 24.153019127390923 28.028503562945367 46-47 26.231557889472366 22.74318579644911 23.093273318329583 27.93198299574894 48-49 26.6816704176044 21.780445111277817 23.58089522380595 27.956989247311824 50-51 26.028767979987492 22.589118198874296 23.677298311444652 27.70481550969356 52-53 25.83187390542907 23.204903677758317 22.879659744808606 28.083562672004003 54-55 26.157117838378785 22.466850137603203 22.59194395796848 28.784088066049534 56-57 25.756817613209908 22.929697272954716 24.11808856642482 27.195396547410557 58-59 26.207155366524894 22.52939704778584 23.517638228671505 27.745809357017766 60-61 26.28221165874406 22.566925193895422 23.19239429572179 27.958468851638727 62-63 26.039058587881826 22.346019028542813 23.97346019028543 27.641462193289932 64-65 26.43447757454272 22.776246554748184 23.314958656978202 27.47431721373089 66-67 26.421949386118765 22.337759959909796 23.402655975945876 27.83763467802556 68-69 25.798772083698786 22.741511088835985 23.79401077559203 27.6657060518732 70-71 25.632990724492355 22.73752820255703 23.050889947355227 28.578591125595388 72-73 26.720443660196626 21.653642551046133 23.065288631207462 28.560625157549786 74-75 26.174407833796483 19.213973799126638 25.76419213973799 28.84742622733889 76 28.774422735346363 0.0 31.72291296625222 39.50266429840142 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 2.0 23 1.5 24 2.0 25 2.5 26 3.5 27 7.0 28 9.5 29 10.5 30 13.0 31 15.0 32 17.5 33 20.5 34 25.5 35 45.5 36 65.0 37 68.0 38 78.5 39 105.5 40 119.0 41 129.5 42 147.5 43 166.5 44 188.5 45 195.0 46 191.5 47 187.0 48 181.0 49 166.0 50 152.5 51 149.5 52 155.0 53 158.0 54 148.0 55 142.5 56 131.5 57 127.0 58 131.0 59 149.0 60 155.0 61 132.0 62 124.0 63 119.0 64 106.0 65 106.0 66 105.0 67 96.5 68 95.0 69 93.0 70 80.0 71 67.0 72 64.0 73 59.0 74 49.5 75 38.0 76 31.0 77 30.5 78 24.0 79 15.5 80 15.0 81 14.5 82 13.0 83 8.5 84 4.5 85 2.5 86 1.5 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.3 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 1.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 4.0 63 1.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 2.0 71 10.0 72 22.0 73 55.0 74 245.0 75 841.0 76 2815.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.575 #Duplication Level Percentage of deduplicated Percentage of total 1 97.95029464514477 95.575 2 1.6653856008198822 3.25 3 0.3586984370996669 1.05 4 0.0 0.0 5 0.025621316935690495 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCTTAATACGGAGCTGTCCTTGGTTGTTTATGCCTTGCCGGATTCCTCGCAGCCCGGTGGCTTGAAGGCGATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGGCTC 15 0.0021179097 69.5625 2 >>END_MODULE SRR11389885 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389885_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.02075 32.0 32.0 32.0 32.0 32.0 2 30.839 32.0 32.0 32.0 32.0 32.0 3 30.82825 32.0 32.0 32.0 32.0 32.0 4 30.96775 32.0 32.0 32.0 32.0 32.0 5 30.8075 32.0 32.0 32.0 32.0 32.0 6 33.8265 36.0 36.0 36.0 32.0 36.0 7 34.33325 36.0 36.0 36.0 32.0 36.0 8 34.07225 36.0 36.0 36.0 32.0 36.0 9 34.01675 36.0 36.0 36.0 32.0 36.0 10-11 33.94925 36.0 36.0 36.0 32.0 36.0 12-13 34.0025 36.0 36.0 36.0 32.0 36.0 14-15 33.850624999999994 36.0 36.0 36.0 32.0 36.0 16-17 33.931875 36.0 36.0 36.0 32.0 36.0 18-19 33.89075 36.0 36.0 36.0 32.0 36.0 20-21 33.724000000000004 36.0 36.0 36.0 29.5 36.0 22-23 33.790625 36.0 36.0 36.0 32.0 36.0 24-25 33.819500000000005 36.0 36.0 36.0 32.0 36.0 26-27 33.709375 36.0 36.0 36.0 32.0 36.0 28-29 33.69875 36.0 36.0 36.0 29.5 36.0 30-31 33.63525 36.0 36.0 36.0 27.0 36.0 32-33 33.658 36.0 36.0 36.0 29.5 36.0 34-35 33.61225 36.0 36.0 36.0 29.5 36.0 36-37 33.583937953465096 36.0 36.0 36.0 29.5 36.0 38-39 33.558492599429556 36.0 36.0 36.0 27.0 36.0 40-41 33.466966966966964 36.0 36.0 36.0 27.0 36.0 42-43 33.34743429286608 36.0 36.0 36.0 27.0 36.0 44-45 33.30867211330137 36.0 36.0 36.0 21.0 36.0 46-47 33.20793690535804 36.0 36.0 36.0 21.0 36.0 48-49 33.12418627941913 36.0 36.0 36.0 21.0 36.0 50-51 32.94052047245003 36.0 34.0 36.0 21.0 36.0 52-53 32.9004258517034 36.0 32.0 36.0 21.0 36.0 54-55 32.90581162324649 36.0 34.0 36.0 21.0 36.0 56-57 32.73534569138276 36.0 32.0 36.0 21.0 36.0 58-59 32.63051102204409 36.0 32.0 36.0 21.0 36.0 60-61 32.56074649298597 36.0 32.0 36.0 21.0 36.0 62-63 32.56593101345346 36.0 32.0 36.0 17.5 36.0 64-65 32.53888610135474 36.0 32.0 36.0 17.5 36.0 66-67 32.55858003010537 36.0 32.0 36.0 21.0 36.0 68-69 32.04414342922941 36.0 32.0 36.0 17.5 36.0 70-71 32.111836629824154 36.0 32.0 36.0 17.5 36.0 72-73 31.957955919157016 36.0 32.0 36.0 14.0 36.0 74-75 31.95025775551759 36.0 32.0 36.0 14.0 36.0 76 30.51851851851852 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 3.0 18 2.0 19 3.0 20 4.0 21 4.0 22 8.0 23 13.0 24 22.0 25 29.0 26 47.0 27 81.0 28 104.0 29 156.0 30 196.0 31 254.0 32 413.0 33 667.0 34 1219.0 35 769.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.4748309541698 20.010017530678688 8.0641121963436 43.451039318807915 2 28.843742162026587 23.27564584900928 31.27664910960622 16.603962879357915 3 22.992244183137352 28.57142857142857 19.11433575181386 29.321991493620214 4 27.695771828871653 32.44933700275207 16.662496872654494 23.19239429572179 5 30.5479109331999 31.5986990242682 17.81336002001501 20.040030022516888 6 25.11883912934701 33.52514385789342 17.988491368526393 23.367525644233176 7 22.942206654991242 16.887665749311985 32.99974981235927 27.1703777833375 8 24.26820115086315 19.5896922692019 24.7935951963973 31.34851138353765 9 25.04378283712785 20.365273955466602 26.1195896922692 28.471353515136354 10-11 27.90843132349262 26.957718288716535 18.739054290718038 26.394796097072803 12-13 27.663036675428714 21.241707347602954 22.71873826511453 28.3765177118538 14-15 27.122464312546956 23.27823691460055 22.97771099423992 26.62158777861257 16-17 26.818580192813325 22.77450857643671 21.848003004882933 28.558908225867036 18-19 26.672513154597844 23.552994237033325 22.02455524931095 27.74993735905788 20-21 27.273866198947633 22.91405662741168 22.67602104735655 27.136056126284142 22-23 27.187382651145324 23.469770935035676 22.005257228689448 27.337589185129552 24-25 26.856141229497933 23.913860022536625 22.02328784274446 27.206710905220984 26-27 27.69635475385194 23.788049605411498 21.583364649881 26.932230990855565 28-29 27.804206309464195 23.360040060090135 21.61992989484226 27.215823735603408 30-31 27.137313806483913 23.13180623357116 22.105394918012266 27.625485041932656 32-33 27.857768874420934 23.28784274445975 21.56003505696757 27.29435332415175 34-35 28.03656398697721 22.877535687453044 21.487603305785125 27.598297019784624 36-37 28.07610464388534 22.906496432594817 22.055326073350855 26.962072850168983 38-39 26.850344395742017 23.656856606136508 22.429555416405762 27.063243581715717 40-41 28.038553010389283 23.332081612216797 21.592189260232818 27.0371761171611 42-43 27.925898109901116 23.206909500563274 21.416948303917888 27.450244085617726 44-45 28.033053712282456 22.987354450982846 21.797921622636785 27.18167021409791 46-47 27.932890947790156 23.838737949167395 22.07336922499061 26.155001878051838 48-49 27.886301026796893 23.466065614825947 21.086902078637614 27.560731279739542 50-51 27.25222403207618 22.95451697782233 22.215261245457963 27.57799774464353 52-53 28.29763246899662 23.324564699987473 21.658524364274083 26.719278466741827 54-55 27.680360721442888 23.697394789579157 21.405310621242485 27.21693386773547 56-57 28.319138276553108 23.359218436873746 21.53056112224449 26.791082164328657 58-59 27.871727420769133 22.936239508956533 21.821370412125766 27.370662658148564 60-61 27.45490981963928 23.52204408817635 21.618236472945892 27.404809619238478 62-63 28.002005515166704 22.913010779644022 22.236149410879918 26.84883429430935 64-65 27.951323547860994 23.3596788357797 20.93840170618492 27.75059591017438 66-67 27.30807827395886 24.03411941796287 21.13647767185148 27.521324636226797 68-69 28.65746549560853 22.421580928481806 22.03262233375157 26.888331242158092 70-71 27.63339610797238 23.214061519146263 21.682360326428125 27.470182046453235 72-73 27.926337033299696 22.250252270433904 22.616044399596365 27.20736629667003 74-75 27.711649057108467 20.181891132807277 22.66951986090678 29.436939949177475 76 29.774872912127815 0.0 30.392156862745097 39.83297022512709 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 1.5 19 1.0 20 0.0 21 1.5 22 3.0 23 2.5 24 1.5 25 1.0 26 3.0 27 3.5 28 4.5 29 8.0 30 11.5 31 16.5 32 25.0 33 29.0 34 23.5 35 27.0 36 46.5 37 65.0 38 84.0 39 96.5 40 108.0 41 122.5 42 125.5 43 140.5 44 170.5 45 183.0 46 172.0 47 161.5 48 156.5 49 153.5 50 153.5 51 132.5 52 123.0 53 140.0 54 147.0 55 146.0 56 142.5 57 137.0 58 136.5 59 161.5 60 166.0 61 146.5 62 134.0 63 129.0 64 127.0 65 114.0 66 105.0 67 105.0 68 111.5 69 115.0 70 94.5 71 74.5 72 87.0 73 91.0 74 71.5 75 56.5 76 43.5 77 35.0 78 27.5 79 17.5 80 12.0 81 6.0 82 4.0 83 4.5 84 4.0 85 3.0 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.325 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.13749999999999998 14-15 0.17500000000000002 16-17 0.1625 18-19 0.22499999999999998 20-21 0.22499999999999998 22-23 0.13749999999999998 24-25 0.1625 26-27 0.21250000000000002 28-29 0.15 30-31 0.13749999999999998 32-33 0.1625 34-35 0.17500000000000002 36-37 0.06254691018263697 38-39 0.10008757662955087 40-41 0.03753753753753754 42-43 0.012515644555694618 44-45 0.025034422330704718 46-47 0.012518778167250874 48-49 0.025037556334501748 50-51 0.050093926111458985 52-53 0.0125250501002004 54-55 0.0 56-57 0.0 58-59 0.0125250501002004 60-61 0.0 62-63 0.0 64-65 0.012543903662819869 66-67 0.0 68-69 0.012545477355413375 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 1.0 42 0.0 43 0.0 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 1.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 4.0 63 1.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 5.0 71 5.0 72 22.0 73 84.0 74 261.0 75 854.0 76 2754.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.975 #Duplication Level Percentage of deduplicated Percentage of total 1 98.26486348558305 96.275 2 1.4544526664965551 2.85 3 0.22965042102577188 0.675 4 0.05103342689461597 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681878 spots for SRR11389885.sra Written 681878 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra Read 681874 spots for SRR11389885.sra Written 681874 spots for SRR11389885.sra SRR ids: ['SRR11389885.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qibhjmx5 SRR11389885.sra spots: 13637484 blocks: [[1, 681874], [681875, 1363748], [1363749, 2045622], [2045623, 2727496], [2727497, 3409370], [3409371, 4091244], [4091245, 4773118], [4773119, 5454992], [5454993, 6136866], [6136867, 6818740], [6818741, 7500614], [7500615, 8182488], [8182489, 8864362], [8864363, 9546236], [9546237, 10228110], [10228111, 10909984], [10909985, 11591858], [11591859, 12273732], [12273733, 12955606], [12955607, 13637484]] SRR11389885 file size 2590148 SRR11389885 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389885 SRR11389885_1.fastq SRR11389885_2.fastq Input file: SRR11389885_1.fastq Paired file: SRR11389885_2.fastq trimmed: SRR11389885-trimmed-pair1.fastq, SRR11389885-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:05:16 2024 >> started Sat Dec 7 09:05:26 2024 >> done (10.813s) 13637484 read pairs processed; of these: 822 ( 0.01%) short read pairs filtered out after trimming by size control 5416 ( 0.04%) empty read pairs filtered out after trimming by size control 13631246 (99.95%) read pairs available; of these: 12072 ( 0.09%) trimmed read pairs available after processing 13619174 (99.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 4 0.00% 23 6 0.00% 24 3 0.00% 25 9 0.00% 26 7 0.00% 27 13 0.00% 28 12 0.00% 29 8 0.00% 30 12 0.00% 31 12 0.00% 32 21 0.00% 33 16 0.00% 34 19 0.00% 35 211 0.00% 36 211 0.00% 37 215 0.00% 38 255 0.00% 39 276 0.00% 40 332 0.00% 41 351 0.00% 42 409 0.00% 43 372 0.00% 44 443 0.00% 45 461 0.00% 46 470 0.00% 47 516 0.00% 48 528 0.00% 49 553 0.00% 50 660 0.00% 51 678 0.00% 52 708 0.01% 53 789 0.01% 54 860 0.01% 55 953 0.01% 56 975 0.01% 57 996 0.01% 58 1136 0.01% 59 1162 0.01% 60 1226 0.01% 61 1243 0.01% 62 1401 0.01% 63 1456 0.01% 64 1606 0.01% 65 1715 0.01% 66 1856 0.01% 67 1949 0.01% 68 1879 0.01% 69 2082 0.02% 70 2679 0.02% 71 3839 0.03% 72 12604 0.09% 73 104876 0.77% 74 897623 6.59% 75 5812834 42.64% 76 6765709 49.63% 13631246 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=23 prefix-density=0.52 prefix-fanout=2.5 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=32.99 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=8.1 sequence=CTTCTTCTCCGGGTCC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=10 prefix-density=0.75 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.24 sequence-density-rank=14 fanout-score=90.27 fanout-score-rank=1 prefix-density=1.20 prefix-fanout=18.1 sequence=GCCGCCGCCACCCTCCCTTCCATGGTCGCCGCCGCTCCCCGGAGCAGCAGCCGGCTGGTGGTGCGCGCATCGGCCGTAGGAGGGTTCCGGAAGGCGGCGGGGG SRR11389885 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:05:58 Started mapping on | Dec 07 09:05:58 Finished on | Dec 07 09:06:57 Mapping speed, Million of reads per hour | 831.74 Number of input reads | 13631246 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 12576579 Uniquely mapped reads % | 92.26% Average mapped length | 150.31 Number of splices: Total | 6258770 Number of splices: Annotated (sjdb) | 5991944 Number of splices: GT/AG | 6171572 Number of splices: GC/AG | 78057 Number of splices: AT/AC | 1735 Number of splices: Non-canonical | 7406 Mismatch rate per base, % | 0.85% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 513077 % of reads mapped to multiple loci | 3.76% Number of reads mapped to too many loci | 23839 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.15% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 541596 541596 541596 N_multimapping 513077 513077 513077 N_noFeature 337830 12260792 417605 N_ambiguous 315328 1487 81248 UnstrandedReadsAssigned:11923421 PositiveStrandReadsAssigned:314300 NegativeStrandReadsAssigned:12077726 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389885 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389885-trimmed-pair1.fastq SRR11389885-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,631,246 reads, 12,402,960 reads pseudoaligned [quant] estimated average fragment length: 235.292 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR11389885.ke.tsv 35125 SRR11389885.se.tsv 88098 total ==> SRR11389885.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 701.831 0 0 PNS24247 1044 809.708 26.5493 3.29541 PNS24249 1928 1693.71 129.553 7.68762 PNS24246 1044 809.708 26.5493 3.29541 PNS24248 1044 809.708 26.5493 3.29541 PNS24244 1471 1236.71 22.7992 1.85284 PNS24243 293 85.3721 0 0 KQK14069 1603 1368.71 6457.56 474.178 KQK14071 474 243.045 321.476 132.937 ==> SRR11389885.se.tsv <== BRADI_1g14170v3 6930 BRADI_1g53295v3 11 BRADI_1g59795v3 184 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 102 BRADI_1g74790v3 173 BRADI_1g09890v3 0 BRADI_1g77505v3 187 BRADI_1g48960v3 0 SRR11389885 completed mapping pipeline successfully