Starting /dee2/code/volunteer_pipeline.sh SRR11389886 current disk space = 1544245501952 free memory = 1598732280 SRR11389886 SRAfilesize e0b7f27f2595efcb459b4d5e85da2ba3 SRR11389886.sra SRR11389886.sra file validated SRR11389886 is paired end SRR11389886 is conventional basespace SRR11389886 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389886_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.32025 32.0 32.0 32.0 32.0 32.0 2 31.48475 32.0 32.0 32.0 32.0 32.0 3 31.4155 32.0 32.0 32.0 32.0 32.0 4 31.4555 32.0 32.0 32.0 32.0 32.0 5 31.55425 32.0 32.0 32.0 32.0 32.0 6 34.4975 36.0 36.0 36.0 32.0 36.0 7 34.72975 36.0 36.0 36.0 32.0 36.0 8 34.827 36.0 36.0 36.0 32.0 36.0 9 34.5585 36.0 36.0 36.0 32.0 36.0 10-11 34.72625 36.0 36.0 36.0 32.0 36.0 12-13 34.81325 36.0 36.0 36.0 32.0 36.0 14-15 34.748875 36.0 36.0 36.0 32.0 36.0 16-17 34.685500000000005 36.0 36.0 36.0 32.0 36.0 18-19 34.7095 36.0 36.0 36.0 32.0 36.0 20-21 34.670625 36.0 36.0 36.0 32.0 36.0 22-23 34.646375 36.0 36.0 36.0 32.0 36.0 24-25 34.517375 36.0 36.0 36.0 32.0 36.0 26-27 34.530875 36.0 36.0 36.0 32.0 36.0 28-29 34.397000000000006 36.0 36.0 36.0 32.0 36.0 30-31 34.314125000000004 36.0 36.0 36.0 32.0 36.0 32-33 34.369375000000005 36.0 36.0 36.0 32.0 36.0 34-35 34.295375 36.0 36.0 36.0 32.0 36.0 36-37 34.1669167291823 36.0 36.0 36.0 32.0 36.0 38-39 34.26869217304326 36.0 36.0 36.0 32.0 36.0 40-41 34.10765191297824 36.0 36.0 36.0 32.0 36.0 42-43 34.17066766691673 36.0 36.0 36.0 32.0 36.0 44-45 34.01775443860966 36.0 36.0 36.0 32.0 36.0 46-47 34.00812703175794 36.0 36.0 36.0 32.0 36.0 48-49 34.035258814703674 36.0 36.0 36.0 32.0 36.0 50-51 33.961240310077514 36.0 36.0 36.0 32.0 36.0 52-53 33.922211105552776 36.0 36.0 36.0 32.0 36.0 54-55 33.77138569284642 36.0 36.0 36.0 27.0 36.0 56-57 33.86593296648324 36.0 36.0 36.0 32.0 36.0 58-59 33.780607435316355 36.0 36.0 36.0 29.5 36.0 60-61 33.56029522141606 36.0 36.0 36.0 27.0 36.0 62-63 33.535982598810975 36.0 36.0 36.0 27.0 36.0 64-65 33.441191191191194 36.0 36.0 36.0 27.0 36.0 66-67 33.37055453450948 36.0 34.0 36.0 27.0 36.0 68-69 33.15658277779623 36.0 32.0 36.0 27.0 36.0 70-71 33.01778111695467 36.0 32.0 36.0 24.0 36.0 72-73 33.10675707707429 36.0 34.0 36.0 24.0 36.0 74-75 33.21540303252149 36.0 32.0 36.0 27.0 36.0 76 32.194746059544656 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 5.0 25 7.0 26 14.0 27 42.0 28 51.0 29 89.0 30 127.0 31 206.0 32 303.0 33 574.0 34 1292.0 35 1287.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.925 9.5 8.625 46.949999999999996 2 26.424999999999997 10.125 41.325 22.125 3 25.124999999999996 15.7 21.55 37.625 4 32.025 21.325 18.025 28.625 5 30.675 25.424999999999997 21.975 21.925 6 25.84213172448467 28.431372549019606 23.78079436902966 21.945701357466064 7 18.7 23.25 36.1 21.95 8 19.75 20.875 33.074999999999996 26.3 9 22.225 18.825 32.35 26.6 10-11 24.212500000000002 27.925 22.5125 25.35 12-13 25.374999999999996 20.7875 25.124999999999996 28.712500000000002 14-15 25.0125 23.7 25.1 26.187500000000004 16-17 25.575 23.2875 23.962500000000002 27.175 18-19 25.912499999999998 23.1125 23.5 27.474999999999998 20-21 25.5 23.4125 24.0125 27.075 22-23 25.624999999999996 23.45 24.3625 26.5625 24-25 26.2875 22.725 23.6375 27.35 26-27 24.5375 23.2375 24.775 27.450000000000003 28-29 25.825 23.9 23.8625 26.4125 30-31 25.825 22.925 23.5 27.750000000000004 32-33 25.137500000000003 23.05 24.175 27.6375 34-35 25.5375 22.825 23.6875 27.950000000000003 36-37 26.04401100275069 22.29307326831708 23.10577644411103 28.557139284821204 38-39 25.93148287071768 23.10577644411103 22.968242060515127 27.994498624656167 40-41 26.619154788697173 22.50562640660165 24.06851712928232 26.806701675418854 42-43 25.506376594148538 22.568142035508878 23.88097024256064 28.044511127781945 44-45 25.081270317579396 23.830957739434858 23.80595148787197 27.28182045511378 46-47 26.094023505876468 23.268317079269817 23.88097024256064 26.756689172293076 48-49 25.468867216804203 22.80570142535634 24.056014003500874 27.66941735433858 50-51 25.456364091022753 23.25581395348837 23.50587646911728 27.781945486371594 52-53 26.92596298149075 21.91095547773887 23.58679339669835 27.576288144072038 54-55 26.25062531265633 22.373686843421712 23.12406203101551 28.251625812906454 56-57 26.23811905952976 22.923961980990494 23.19909954977489 27.63881940970485 58-59 27.04190118824265 22.601626016260163 23.702313946216385 26.6541588492808 60-61 26.09457092819615 23.254941205904426 22.629472104078058 28.021015761821367 62-63 25.897660452896282 22.432128112098084 24.32128112098086 27.348930314024773 64-65 26.8018018018018 22.722722722722725 23.123123123123122 27.352352352352355 66-67 26.842698035289704 21.924665248404455 23.7141784507571 27.51845826554874 68-69 25.985730379271498 22.505945675303543 24.03304543747653 27.47527850794843 70-71 26.884547958928124 22.63961933383421 23.541197094916104 26.93463561232156 72-73 26.637335009428032 21.470773098680077 23.40666247642992 28.485229415461973 74-75 27.448912326961107 19.22214897824654 24.812129202373104 28.51680949241925 76 28.68651488616462 0.0 32.15411558669002 39.15936952714536 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 3.0 21 4.0 22 3.5 23 3.5 24 3.5 25 3.5 26 5.0 27 6.0 28 11.0 29 15.5 30 14.0 31 17.0 32 20.0 33 20.0 34 29.5 35 39.0 36 56.5 37 77.0 38 89.0 39 110.5 40 122.0 41 134.5 42 150.5 43 163.5 44 180.5 45 185.0 46 184.5 47 175.5 48 163.0 49 154.0 50 147.5 51 139.0 52 136.0 53 144.0 54 152.5 55 159.5 56 151.5 57 148.0 58 151.5 59 171.0 60 167.5 61 139.0 62 134.0 63 129.0 64 130.5 65 129.5 66 113.0 67 102.5 68 95.0 69 78.0 70 67.0 71 63.5 72 60.0 73 48.5 74 35.5 75 33.5 76 42.0 77 40.0 78 23.5 79 14.0 80 11.0 81 8.5 82 6.0 83 4.0 84 3.5 85 3.5 86 1.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5499999999999999 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 1.0 69 1.0 70 0.0 71 8.0 72 15.0 73 51.0 74 253.0 75 811.0 76 2855.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.8 #Duplication Level Percentage of deduplicated Percentage of total 1 97.4948347107438 94.375 2 1.9369834710743803 3.75 3 0.38739669421487605 1.125 4 0.1291322314049587 0.5 5 0.05165289256198347 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCT 5 0.125 No Hit GTCCATCTTAATACGGAGCTGTCCTTGGTTGTTTATGCCTTGCCGGATTCCTCGCAGCCCGGTGGCTTGAAGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389886 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389886_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.89075 32.0 32.0 32.0 32.0 32.0 2 30.71075 32.0 32.0 32.0 32.0 32.0 3 30.512 32.0 32.0 32.0 32.0 32.0 4 30.614 32.0 32.0 32.0 32.0 32.0 5 30.6325 32.0 32.0 32.0 32.0 32.0 6 33.54 36.0 36.0 36.0 27.0 36.0 7 33.72325 36.0 36.0 36.0 32.0 36.0 8 33.69875 36.0 36.0 36.0 32.0 36.0 9 33.6895 36.0 36.0 36.0 32.0 36.0 10-11 33.58 36.0 36.0 36.0 26.5 36.0 12-13 33.72425 36.0 36.0 36.0 32.0 36.0 14-15 33.482875 36.0 36.0 36.0 29.5 36.0 16-17 33.451625 36.0 36.0 36.0 29.5 36.0 18-19 33.4875 36.0 36.0 36.0 32.0 36.0 20-21 33.262 36.0 36.0 36.0 24.0 36.0 22-23 33.4 36.0 36.0 36.0 26.5 36.0 24-25 33.11175 36.0 36.0 36.0 21.0 36.0 26-27 33.31875 36.0 36.0 36.0 27.0 36.0 28-29 33.161500000000004 36.0 36.0 36.0 21.0 36.0 30-31 33.092 36.0 36.0 36.0 21.0 36.0 32-33 33.086749999999995 36.0 36.0 36.0 17.5 36.0 34-35 33.23025 36.0 36.0 36.0 24.0 36.0 36-37 33.25068836045057 36.0 36.0 36.0 27.0 36.0 38-39 33.13779724655819 36.0 36.0 36.0 17.5 36.0 40-41 33.15506883604506 36.0 36.0 36.0 24.0 36.0 42-43 33.11514392991239 36.0 36.0 36.0 17.5 36.0 44-45 32.805882352941175 36.0 36.0 36.0 17.5 36.0 46-47 32.59048811013767 36.0 34.0 36.0 14.0 36.0 48-49 32.6360450563204 36.0 34.0 36.0 14.0 36.0 50-51 32.45419274092616 36.0 32.0 36.0 14.0 36.0 52-53 32.401977966950426 36.0 32.0 36.0 14.0 36.0 54-55 32.22709063595393 36.0 32.0 36.0 14.0 36.0 56-57 32.36254381572358 36.0 32.0 36.0 14.0 36.0 58-59 31.861019145798586 36.0 32.0 36.0 14.0 36.0 60-61 32.013523666416226 36.0 32.0 36.0 14.0 36.0 62-63 32.12534435261708 36.0 32.0 36.0 14.0 36.0 64-65 31.97570748810418 36.0 32.0 36.0 14.0 36.0 66-67 32.04169797145004 36.0 32.0 36.0 14.0 36.0 68-69 31.671627471070366 36.0 32.0 36.0 14.0 36.0 70-71 31.687670770434774 36.0 32.0 36.0 14.0 36.0 72-73 31.607440940141693 36.0 32.0 36.0 14.0 36.0 74-75 31.460629690795088 36.0 32.0 36.0 14.0 36.0 76 30.308221658819267 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 2.0 17 3.0 18 4.0 19 4.0 20 4.0 21 6.0 22 9.0 23 21.0 24 27.0 25 38.0 26 65.0 27 103.0 28 141.0 29 168.0 30 242.0 31 322.0 32 466.0 33 722.0 34 1118.0 35 526.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.650137741046834 19.759579263711498 8.564988730277987 43.02529426496369 2 30.042595840641447 23.1520922074668 29.341017288900023 17.46429466299173 3 23.4984984984985 27.37737737737738 19.76976976976977 29.354354354354356 4 28.153153153153156 31.806806806806808 16.216216216216218 23.823823823823822 5 31.456456456456454 30.78078078078078 17.992992992992992 19.76976976976977 6 24.5995995995996 34.034034034034036 18.06806806806807 23.2982982982983 7 23.573573573573572 15.815815815815814 32.532532532532535 28.07807807807808 8 24.155193992490613 20.826032540675847 23.329161451814766 31.689612015018774 9 24.54954954954955 20.12012012012012 25.975975975975974 29.354354354354356 10-11 28.46057571964956 26.25782227784731 18.473091364205256 26.80851063829787 12-13 27.72909364046069 20.505758637956937 21.54481722583876 30.220330495743614 14-15 25.946352469290552 23.050889947355227 24.37954374529957 26.62321383805465 16-17 28.25814536340852 22.205513784461154 21.31578947368421 28.220551378446114 18-19 27.429859719438877 22.52004008016032 21.442885771543086 28.607214428857713 20-21 27.65370138017566 22.685069008782936 22.760351317440403 26.900878293601004 22-23 26.93463561232156 24.242424242424242 21.66291009266216 27.160030052592038 24-25 26.999247931812487 23.451992980696918 21.346202055653045 28.202557031837554 26-27 28.6878054894097 23.17332999122697 21.794711116681288 26.344153402682043 28-29 28.234999373669044 23.55004384316673 20.869347363146687 27.345609420017535 30-31 27.45958140117809 23.348790575260058 20.85474370221832 28.336884321343526 32-33 27.662240040090204 24.267100977198698 21.51089952392884 26.55975945878226 34-35 28.240450845335 23.206011271133377 22.1665623043206 26.38697557921102 36-37 27.352462097481517 23.53088585390302 21.162761558701916 27.953890489913547 38-39 27.416321925535915 23.856086247962892 21.236053654255986 27.491538172245207 40-41 28.360265564324187 23.4373042715771 21.044720030063885 27.157710134034822 42-43 28.483709273182956 23.283208020050125 20.614035087719298 27.61904761904762 44-45 27.752696262854275 23.07499372962127 22.14697767745172 27.025332330072736 46-47 29.300401203610832 22.5802407221665 20.837512537612838 27.28184553660983 48-49 28.36719337848006 22.322548281916227 21.595184349134687 27.715073990469026 50-51 27.183734939759034 22.954317269076306 21.95030120481928 27.91164658634538 52-53 28.598294884653964 22.567703109327983 21.276328986960884 27.557673019057173 54-55 27.731829573934835 23.107769423558896 21.340852130325814 27.819548872180448 56-57 28.272579230865592 23.036452461480646 21.97168984091194 26.719278466741827 58-59 28.105804187037737 23.10392378087 21.29873385984706 27.491538172245207 60-61 28.24207492795389 22.85427891241699 21.588773336674603 27.314872822954516 62-63 27.57799774464353 23.330409723092345 21.63889236937727 27.452700162886856 64-65 28.544565626175256 22.752914629559985 20.609251598345242 28.09326814591952 66-67 28.063142069656728 23.08945126534703 21.460786770233025 27.38661989476322 68-69 26.938980077684498 24.39543916802406 21.27552938228292 27.39005137200852 70-71 28.852664576802507 22.482758620689655 20.50156739811912 28.163009404388717 72-73 26.8639798488665 22.581863979848865 21.775818639798487 28.778337531486148 74-75 28.014373170082514 18.92467394197498 23.40963534735161 29.6513175405909 76 31.569409206234145 0.0 28.959768031895617 39.470822761870245 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 2.0 22 1.5 23 2.0 24 3.0 25 2.0 26 2.5 27 6.0 28 6.5 29 4.5 30 5.0 31 11.0 32 17.5 33 18.0 34 23.0 35 34.0 36 40.5 37 50.0 38 71.5 39 89.0 40 102.5 41 118.5 42 129.5 43 133.5 44 138.0 45 143.5 46 144.5 47 156.0 48 155.0 49 158.0 50 166.5 51 143.0 52 124.5 53 126.0 54 127.5 55 137.5 56 155.0 57 162.0 58 168.5 59 184.0 60 178.5 61 172.0 62 179.5 63 160.0 64 133.5 65 121.0 66 118.0 67 119.5 68 112.5 69 92.0 70 85.0 71 94.0 72 99.0 73 87.0 74 65.0 75 55.0 76 43.5 77 31.0 78 24.0 79 19.5 80 15.0 81 10.5 82 5.0 83 0.0 84 2.0 85 3.0 86 1.5 87 1.0 88 1.5 89 1.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 2.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.22499999999999998 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.125 9 0.1 10-11 0.125 12-13 0.15 14-15 0.27499999999999997 16-17 0.25 18-19 0.2 20-21 0.375 22-23 0.17500000000000002 24-25 0.27499999999999997 26-27 0.2625 28-29 0.21250000000000002 30-31 0.2625 32-33 0.22499999999999998 34-35 0.1875 36-37 0.11264080100125157 38-39 0.16270337922403005 40-41 0.08760951188986232 42-43 0.1251564455569462 44-45 0.2002503128911139 46-47 0.17521902377972465 48-49 0.2002503128911139 50-51 0.2753441802252816 52-53 0.15022533800701052 54-55 0.10015022533800699 56-57 0.06259389083625438 58-59 0.12520345561537496 60-61 0.06260956674179814 62-63 0.06260956674179814 64-65 0.11269722013523666 66-67 0.050087653393438514 68-69 0.050093926111458985 70-71 0.05013159543802481 72-73 0.06293266205160479 74-75 0.053205639797818574 76 0.07243752263672583 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 5.0 71 2.0 72 25.0 73 61.0 74 280.0 75 858.0 76 2761.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.475 #Duplication Level Percentage of deduplicated Percentage of total 1 97.74301102846884 95.275 2 1.9748653500897666 3.85 3 0.23082841754295974 0.675 4 0.05129520389843549 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778975 spots for SRR11389886.sra Written 778975 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra Read 778966 spots for SRR11389886.sra Written 778966 spots for SRR11389886.sra SRR ids: ['SRR11389886.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uktk6v1m SRR11389886.sra spots: 15579329 blocks: [[1, 778966], [778967, 1557932], [1557933, 2336898], [2336899, 3115864], [3115865, 3894830], [3894831, 4673796], [4673797, 5452762], [5452763, 6231728], [6231729, 7010694], [7010695, 7789660], [7789661, 8568626], [8568627, 9347592], [9347593, 10126558], [10126559, 10905524], [10905525, 11684490], [11684491, 12463456], [12463457, 13242422], [13242423, 14021388], [14021389, 14800354], [14800355, 15579329]] SRR11389886 file size 2962634 SRR11389886 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389886 SRR11389886_1.fastq SRR11389886_2.fastq Input file: SRR11389886_1.fastq Paired file: SRR11389886_2.fastq trimmed: SRR11389886-trimmed-pair1.fastq, SRR11389886-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:07:59 2024 >> started Sat Dec 7 09:08:18 2024 >> done (19.028s) 15579329 read pairs processed; of these: 972 ( 0.01%) short read pairs filtered out after trimming by size control 6134 ( 0.04%) empty read pairs filtered out after trimming by size control 15572223 (99.95%) read pairs available; of these: 13235 ( 0.08%) trimmed read pairs available after processing 15558988 (99.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 3 0.00% 25 5 0.00% 26 3 0.00% 27 3 0.00% 28 4 0.00% 29 5 0.00% 30 1 0.00% 31 0 0.00% 32 8 0.00% 33 3 0.00% 34 3 0.00% 35 173 0.00% 36 164 0.00% 37 174 0.00% 38 225 0.00% 39 236 0.00% 40 235 0.00% 41 278 0.00% 42 312 0.00% 43 355 0.00% 44 369 0.00% 45 390 0.00% 46 388 0.00% 47 408 0.00% 48 475 0.00% 49 481 0.00% 50 480 0.00% 51 534 0.00% 52 581 0.00% 53 602 0.00% 54 652 0.00% 55 743 0.00% 56 714 0.00% 57 814 0.01% 58 956 0.01% 59 980 0.01% 60 997 0.01% 61 1002 0.01% 62 1096 0.01% 63 1168 0.01% 64 1249 0.01% 65 1314 0.01% 66 1380 0.01% 67 1550 0.01% 68 1597 0.01% 69 1770 0.01% 70 2184 0.01% 71 3499 0.02% 72 13767 0.09% 73 115189 0.74% 74 990860 6.36% 75 6564254 42.15% 76 7857583 50.46% 15572223 reads passed initial QC criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=26 prefix-density=1.13 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=27.56 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=2.0 sequence=TGTTGTCGAAGTCGTACTTCCTTAGGCCCTGGCTGATGTACTCTTGGGAGCTGAGGACGGCCACGTGGGTACCGTCGCCCATGGGCGCCTGGAAGAGCGAGTCGACGATACCCTTCCCCCTGGTGATGTCCTGCTGGTCGTCGGAGATATCGTAGGCGAGGCCCTTCCACCTGTCCTGGTCAGTCTGCTTTGACTCGTCCACCTCCTTGGCCATGACTGTGAATCTGTTGGCCTTGGTGCTCTTGCCATGGTAGTTCACGGCCGAGGTCACCTGCTTCTTGAGCTTCTTCCCAAGGAAGCTGGTTGGCGTAGAAGCCGGAGCTCCGACG criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=8 prefix-density=0.96 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=12.17 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.7 sequence=CAACTGCGGGTACATGTGAAGAAATGATGAAGAGAGCTGTTTTTGCGAGAGAATTAGGTGTTCCTATTGTAATGCATGACTACTTAACTGGGGGATTCACCGCAAATACTACTTTGGCTCATTATTGCCGCGACAATGGCTTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCATTTCCGTGTATTAGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATCCACGCCGGTACAGTAGTAGGTAAGTTAGAAGGGGAACGCGAAATCACTTTAGGTTTTGTTGATTTATTGCGCGACGATTTTATTGAAAAAGATCGTGCTCGCGGTATCTTTTTCACTCAGGACTGGGTATCCATGCCAGGTGTTATACCAGTAGCTTCAGGTGGTATTCATGTTTGGCATATGCCAGCTCTGACCGAAATCTTTGGGGATGATTCTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGG SRR11389886 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:08:47 Started mapping on | Dec 07 09:08:47 Finished on | Dec 07 09:09:50 Mapping speed, Million of reads per hour | 889.84 Number of input reads | 15572223 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 14421362 Uniquely mapped reads % | 92.61% Average mapped length | 150.38 Number of splices: Total | 6866135 Number of splices: Annotated (sjdb) | 6588629 Number of splices: GT/AG | 6774981 Number of splices: GC/AG | 82054 Number of splices: AT/AC | 1647 Number of splices: Non-canonical | 7453 Mismatch rate per base, % | 0.88% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 588226 % of reads mapped to multiple loci | 3.78% Number of reads mapped to too many loci | 26492 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.82% % of reads unmapped: other | 0.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 562641 562641 562641 N_multimapping 588226 588226 588226 N_noFeature 344398 14088573 415609 N_ambiguous 349689 1220 91258 UnstrandedReadsAssigned:13727275 PositiveStrandReadsAssigned:331569 NegativeStrandReadsAssigned:13914495 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389886 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389886-trimmed-pair1.fastq SRR11389886-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,572,223 reads, 14,263,114 reads pseudoaligned [quant] estimated average fragment length: 227.99 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52973 SRR11389886.ke.tsv 35125 SRR11389886.se.tsv 88098 total ==> SRR11389886.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 709.216 0 0 PNS24247 1044 817.01 23.0228 2.42923 PNS24249 1928 1701.01 91.1756 4.62072 PNS24246 1044 817.01 23.0228 2.42923 PNS24248 1044 817.01 23.0228 2.42923 PNS24244 1471 1244.01 9.75597 0.676059 PNS24243 293 88.9713 0 0 KQK14069 1603 1376.01 250.052 15.6656 KQK14071 474 249.984 8.92952 3.07931 ==> SRR11389886.se.tsv <== BRADI_1g14170v3 272 BRADI_1g53295v3 9 BRADI_1g59795v3 141 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 133 BRADI_1g74790v3 204 BRADI_1g09890v3 0 BRADI_1g77505v3 175 BRADI_1g48960v3 0 SRR11389886 completed mapping pipeline successfully