Starting /dee2/code/volunteer_pipeline.sh SRR11389887 current disk space = 1544290615296 free memory = 1601956636 SRR11389887 SRAfilesize 3e22c95f503cb42983067a939cd6c2e2 SRR11389887.sra SRR11389887.sra file validated SRR11389887 is paired end SRR11389887 is conventional basespace SRR11389887 read1 length is 54-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389887_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 54-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.41675 32.0 32.0 32.0 32.0 32.0 2 31.4025 32.0 32.0 32.0 32.0 32.0 3 31.386 32.0 32.0 32.0 32.0 32.0 4 31.386 32.0 32.0 32.0 32.0 32.0 5 31.56375 32.0 32.0 32.0 32.0 32.0 6 34.44575 36.0 36.0 36.0 32.0 36.0 7 34.63175 36.0 36.0 36.0 32.0 36.0 8 34.642 36.0 36.0 36.0 32.0 36.0 9 34.71875 36.0 36.0 36.0 32.0 36.0 10-11 34.65025 36.0 36.0 36.0 32.0 36.0 12-13 34.603625 36.0 36.0 36.0 32.0 36.0 14-15 34.729 36.0 36.0 36.0 32.0 36.0 16-17 34.526624999999996 36.0 36.0 36.0 32.0 36.0 18-19 34.625625 36.0 36.0 36.0 32.0 36.0 20-21 34.684375 36.0 36.0 36.0 32.0 36.0 22-23 34.53 36.0 36.0 36.0 32.0 36.0 24-25 34.352625 36.0 36.0 36.0 32.0 36.0 26-27 34.336 36.0 36.0 36.0 32.0 36.0 28-29 34.230625 36.0 36.0 36.0 32.0 36.0 30-31 34.303875000000005 36.0 36.0 36.0 32.0 36.0 32-33 34.281875 36.0 36.0 36.0 32.0 36.0 34-35 34.210375 36.0 36.0 36.0 32.0 36.0 36-37 34.255250000000004 36.0 36.0 36.0 32.0 36.0 38-39 34.0835 36.0 36.0 36.0 32.0 36.0 40-41 34.1245 36.0 36.0 36.0 32.0 36.0 42-43 34.0285 36.0 36.0 36.0 32.0 36.0 44-45 34.015125 36.0 36.0 36.0 32.0 36.0 46-47 34.034375 36.0 36.0 36.0 32.0 36.0 48-49 33.949625 36.0 36.0 36.0 32.0 36.0 50-51 33.875375000000005 36.0 36.0 36.0 32.0 36.0 52-53 33.78725 36.0 36.0 36.0 32.0 36.0 54-55 33.7403352088022 36.0 36.0 36.0 27.0 36.0 56-57 33.788697174293574 36.0 36.0 36.0 32.0 36.0 58-59 33.84571142785696 36.0 36.0 36.0 29.5 36.0 60-61 33.35321330332583 36.0 36.0 36.0 27.0 36.0 62-63 33.469992498124526 36.0 36.0 36.0 27.0 36.0 64-65 33.28894723680921 36.0 36.0 36.0 27.0 36.0 66-67 33.188957328148646 36.0 34.0 36.0 27.0 36.0 68-69 32.87490617963472 36.0 32.0 36.0 21.0 36.0 70-71 32.98560854294455 36.0 32.0 36.0 27.0 36.0 72-73 32.990320271214465 36.0 34.0 36.0 24.0 36.0 74-75 33.01609662052432 36.0 32.0 36.0 24.0 36.0 76 32.25008919015341 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 3.0 25 12.0 26 23.0 27 33.0 28 58.0 29 99.0 30 144.0 31 202.0 32 335.0 33 578.0 34 1272.0 35 1236.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.449999999999996 9.8 8.15 45.6 2 28.4 10.45 40.575 20.575 3 26.3 16.825000000000003 19.525000000000002 37.35 4 31.65 22.775000000000002 17.45 28.125 5 30.875000000000004 26.025 22.15 20.95 6 25.301204819277107 29.693775100401602 23.343373493975903 21.66164658634538 7 19.575 23.549999999999997 35.55 21.325 8 20.875 21.65 30.875000000000004 26.6 9 21.525 18.675 33.375 26.424999999999997 10-11 24.675 27.825 23.0125 24.4875 12-13 25.8125 21.775 23.549999999999997 28.8625 14-15 24.975 24.212500000000002 24.9375 25.874999999999996 16-17 25.2 23.3125 23.2375 28.249999999999996 18-19 25.85 23.525 22.775000000000002 27.85 20-21 24.95 23.0625 25.4625 26.525 22-23 26.75 23.225 22.85 27.175 24-25 25.1875 22.9375 23.925 27.950000000000003 26-27 25.4 22.475 24.4875 27.6375 28-29 25.662499999999998 23.7 23.3125 27.325 30-31 26.200000000000003 23.1 23.1625 27.537499999999998 32-33 25.2 23.5 24.2875 27.0125 34-35 25.575 23.0125 24.375 27.037499999999998 36-37 25.887500000000003 22.05 23.5875 28.475 38-39 25.4875 23.125 24.2625 27.125 40-41 25.7625 23.075000000000003 24.0 27.1625 42-43 25.412499999999998 22.650000000000002 23.974999999999998 27.962500000000002 44-45 25.575 22.9375 23.625 27.8625 46-47 26.275 23.599999999999998 23.2125 26.9125 48-49 25.2125 22.875 23.599999999999998 28.3125 50-51 25.2125 23.075000000000003 23.9 27.8125 52-53 26.3125 23.025000000000002 22.9875 27.675 54-55 26.690836354544317 22.42780347543443 22.7903487935992 28.091011376422053 56-57 25.806451612903224 23.418354588647162 23.418354588647162 27.35683920980245 58-59 26.431607901975497 23.305826456614152 22.543135783945985 27.719429857464366 60-61 25.656414103525883 21.867966991747938 23.78094523630908 28.694673668417103 62-63 25.906476619154787 22.268067016754188 24.36859214803701 27.45686421605401 64-65 27.144286071517882 22.705676419104776 22.755688922230558 27.394348587146787 66-67 26.513256628314156 21.898449224612307 23.386693346673336 28.2016008004002 68-69 25.869402051538653 22.979734801100825 23.58018513885414 27.570678008506377 70-71 26.495619524405505 22.215269086357946 23.078848560700877 28.21026282853567 72-73 25.806856712294362 22.453849051864875 22.19012934823559 29.549164887605173 74-75 25.460768825697738 20.576619273301738 24.42074776197999 29.541864139020536 76 30.717088833392793 0.0 31.751694612914733 37.531216553692474 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 2.0 20 4.5 21 7.0 22 6.0 23 3.5 24 2.5 25 1.5 26 4.0 27 7.0 28 7.5 29 9.0 30 15.0 31 23.0 32 28.0 33 25.5 34 29.5 35 37.5 36 45.5 37 60.0 38 81.0 39 100.0 40 116.5 41 134.0 42 137.5 43 156.5 44 179.0 45 180.5 46 188.0 47 186.5 48 168.5 49 163.0 50 164.5 51 148.0 52 134.0 53 136.0 54 133.0 55 135.5 56 140.0 57 133.0 58 131.0 59 144.5 60 153.5 61 148.5 62 149.0 63 134.5 64 118.5 65 116.0 66 103.0 67 97.0 68 107.5 69 97.0 70 72.0 71 70.0 72 69.5 73 58.0 74 48.0 75 46.0 76 41.0 77 32.0 78 23.0 79 15.5 80 10.5 81 9.0 82 8.0 83 4.5 84 5.5 85 3.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.4 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 2.0 67 0.0 68 0.0 69 1.0 70 2.0 71 3.0 72 19.0 73 58.0 74 232.0 75 879.0 76 2803.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.375 #Duplication Level Percentage of deduplicated Percentage of total 1 97.01686121919585 93.5 2 2.594033722438392 5.0 3 0.25940337224383914 0.75 4 0.02594033722438392 0.1 5 0.05188067444876784 0.25 6 0.02594033722438392 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02594033722438392 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCAACAGATCAATCCAGATCAGTGAGCTGCTGTTTAGGCCTTGCCGGA 10 0.25 No Hit CTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCAT 6 0.15 No Hit GTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCT 5 0.125 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389887 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389887_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9395 32.0 32.0 32.0 32.0 32.0 2 30.62075 32.0 32.0 32.0 32.0 32.0 3 30.714 32.0 32.0 32.0 32.0 32.0 4 30.76725 32.0 32.0 32.0 32.0 32.0 5 30.74375 32.0 32.0 32.0 32.0 32.0 6 33.85375 36.0 36.0 36.0 32.0 36.0 7 34.13 36.0 36.0 36.0 32.0 36.0 8 34.0895 36.0 36.0 36.0 32.0 36.0 9 33.9325 36.0 36.0 36.0 32.0 36.0 10-11 33.79375 36.0 36.0 36.0 32.0 36.0 12-13 33.837625 36.0 36.0 36.0 32.0 36.0 14-15 33.772375 36.0 36.0 36.0 32.0 36.0 16-17 33.7605 36.0 36.0 36.0 32.0 36.0 18-19 33.749875 36.0 36.0 36.0 32.0 36.0 20-21 33.609375 36.0 36.0 36.0 27.0 36.0 22-23 33.745125 36.0 36.0 36.0 29.5 36.0 24-25 33.490375 36.0 36.0 36.0 27.0 36.0 26-27 33.510999999999996 36.0 36.0 36.0 27.0 36.0 28-29 33.513374999999996 36.0 36.0 36.0 27.0 36.0 30-31 33.406875 36.0 36.0 36.0 27.0 36.0 32-33 33.41675 36.0 36.0 36.0 27.0 36.0 34-35 33.33 36.0 36.0 36.0 27.0 36.0 36-37 33.448448448448445 36.0 36.0 36.0 27.0 36.0 38-39 33.462087087087085 36.0 36.0 36.0 27.0 36.0 40-41 33.37012012012012 36.0 36.0 36.0 27.0 36.0 42-43 33.400525525525524 36.0 36.0 36.0 27.0 36.0 44-45 33.203953953953956 36.0 36.0 36.0 21.0 36.0 46-47 33.054693366708385 36.0 36.0 36.0 21.0 36.0 48-49 32.90688360450564 36.0 36.0 36.0 21.0 36.0 50-51 32.848811013767204 36.0 34.0 36.0 21.0 36.0 52-53 32.75619524405507 36.0 32.0 36.0 21.0 36.0 54-55 32.57768244983245 36.0 32.0 36.0 14.0 36.0 56-57 32.69103655483225 36.0 32.0 36.0 21.0 36.0 58-59 32.32048072108162 36.0 32.0 36.0 17.5 36.0 60-61 32.334376564847275 36.0 32.0 36.0 17.5 36.0 62-63 32.43377566349524 36.0 32.0 36.0 17.5 36.0 64-65 32.400976464697045 36.0 32.0 36.0 17.5 36.0 66-67 32.34459134844552 36.0 32.0 36.0 17.5 36.0 68-69 31.956521694102314 36.0 32.0 36.0 14.0 36.0 70-71 31.881768117787367 36.0 32.0 36.0 14.0 36.0 72-73 31.704681824363867 36.0 32.0 36.0 14.0 36.0 74-75 31.685208822780297 36.0 32.0 36.0 14.0 36.0 76 30.60475161987041 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 3.0 18 6.0 19 0.0 20 4.0 21 8.0 22 9.0 23 14.0 24 27.0 25 35.0 26 58.0 27 89.0 28 84.0 29 172.0 30 189.0 31 285.0 32 455.0 33 708.0 34 1124.0 35 721.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.75206611570248 19.709491610318057 8.640120210368146 41.89832206361132 2 29.491355549987468 23.527937860185418 29.616637434227012 17.364069155600102 3 25.0 25.475475475475474 19.16916916916917 30.355355355355357 4 29.32932932932933 30.455455455455454 15.14014014014014 25.075075075075077 5 29.254254254254253 31.056056056056057 18.643643643643642 21.046046046046047 6 24.64964964964965 33.908908908908906 18.21821821821822 23.223223223223226 7 23.04804804804805 15.915915915915916 32.58258258258258 28.453453453453452 8 24.2992992992993 19.61961961961962 24.44944944944945 31.631631631631627 9 22.84784784784785 19.894894894894897 25.7007007007007 31.556556556556558 10-11 26.654986860217743 26.680015016894004 18.65849080215242 28.006507320735828 12-13 28.1097331830139 20.20543655267443 22.00926969810848 29.67556056620318 14-15 27.023302430468554 23.25231771485843 21.7113505387121 28.013029315960914 16-17 28.125783011776495 22.41292909045352 21.799047857679778 27.662240040090204 18-19 27.023302430468554 22.049611626158857 21.435730393385118 29.491355549987468 20-21 28.81143430290873 21.82798395185557 21.965897693079235 27.39468405215647 22-23 27.65877489665539 22.87360641362896 21.207566077915573 28.260052611800074 24-25 27.58707090954648 23.139564019042847 22.225006264094212 27.048358807316465 26-27 27.959413754227736 23.750469748214957 21.721157459601653 26.568959037955658 28-29 27.420769134410623 22.948766128022047 21.38293874483277 28.247525992734563 30-31 27.59268537074148 22.895791583166332 22.20691382765531 27.304609218436877 32-33 26.447005762966675 22.86394387371586 22.751190177900277 27.93786018541719 34-35 28.088198446504638 23.177148584314708 21.460786770233025 27.273866198947633 36-37 27.746461230113994 22.760866842039334 21.35788550670174 28.13478642114493 38-39 27.56201453269857 23.264845903282385 22.137308945126534 27.035830618892508 40-41 28.310159088062132 23.387197795315046 21.182512839784543 27.12013027683828 42-43 28.1187374749499 22.808116232464933 21.705911823647295 27.367234468937873 44-45 27.55511022044088 23.233967935871743 22.20691382765531 27.004008016032067 46-47 27.85571142284569 22.49498997995992 21.8311623246493 27.81813627254509 48-49 28.068637274549097 21.9438877755511 21.7685370741483 28.218937875751504 50-51 27.463023314113812 23.113562296314864 22.17347706192028 27.24993732765104 52-53 28.38176352705411 22.78306613226453 21.067134268537075 27.768036072144287 54-55 27.132656895903796 22.923712889891018 22.259802079418765 27.68382813478642 56-57 27.58707090954648 22.91405662741168 22.262590829366076 27.23628163367577 58-59 28.388874968679527 22.80130293159609 20.734151841643698 28.07567025808068 60-61 27.61212728639439 23.277374091706342 20.871961914307192 28.238536707592083 62-63 28.338762214983714 23.490353294913554 21.874216988223502 26.296667501879227 64-65 28.977699824605363 22.41292909045352 21.373089451265347 27.23628163367577 66-67 27.230576441102755 23.308270676691727 21.591478696741856 27.869674185463662 68-69 27.80842527582748 22.80591775325978 21.92828485456369 27.45737211634905 70-71 27.54205372834547 22.60858649259352 21.993472257092645 27.855887521968363 72-73 27.8500189370029 22.269915414720366 21.790178007827294 28.08988764044944 74-75 27.640208807388568 19.3816088876991 23.397135590951677 29.581046713960646 76 29.466858789625363 0.0 28.24207492795389 42.29106628242075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.5 18 2.5 19 1.5 20 1.5 21 2.0 22 2.0 23 2.5 24 3.0 25 2.0 26 3.0 27 6.0 28 7.0 29 7.5 30 7.5 31 11.5 32 16.0 33 19.5 34 21.0 35 29.0 36 44.0 37 55.0 38 66.0 39 81.0 40 95.0 41 112.0 42 130.0 43 136.0 44 135.0 45 141.0 46 159.5 47 177.5 48 165.5 49 132.5 50 125.5 51 138.0 52 140.0 53 129.0 54 126.5 55 139.5 56 150.5 57 153.0 58 155.0 59 169.0 60 190.5 61 179.5 62 160.5 63 141.0 64 132.0 65 144.5 66 125.5 67 109.5 68 111.5 69 109.0 70 92.5 71 77.0 72 76.5 73 73.0 74 65.5 75 60.0 76 47.0 77 31.0 78 27.0 79 26.0 80 17.0 81 9.5 82 8.5 83 6.5 84 5.0 85 3.0 86 1.0 87 0.5 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.22499999999999998 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.1 9 0.1 10-11 0.11249999999999999 12-13 0.21250000000000002 14-15 0.22499999999999998 16-17 0.22499999999999998 18-19 0.22499999999999998 20-21 0.3 22-23 0.21250000000000002 24-25 0.22499999999999998 26-27 0.21250000000000002 28-29 0.21250000000000002 30-31 0.2 32-33 0.22499999999999998 34-35 0.22499999999999998 36-37 0.11261261261261261 38-39 0.12512512512512514 40-41 0.11261261261261261 42-43 0.10010010010010009 44-45 0.10010010010010009 46-47 0.0750938673341677 48-49 0.0750938673341677 50-51 0.1501877346683354 52-53 0.0750938673341677 54-55 0.07510326699211416 56-57 0.07511266900350526 58-59 0.07511266900350526 60-61 0.07511266900350526 62-63 0.07511266900350526 64-65 0.07511266900350526 66-67 0.07513148009015778 68-69 0.08768633345859952 70-71 0.05018820577164366 72-73 0.06308352258390108 74-75 0.06688068485821294 76 0.07199424046076314 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 4.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 2.0 67 0.0 68 1.0 69 2.0 70 8.0 71 9.0 72 18.0 73 65.0 74 302.0 75 809.0 76 2778.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.225 #Duplication Level Percentage of deduplicated Percentage of total 1 97.63435330419131 94.925 2 2.005656981229108 3.9 3 0.2571355104139882 0.75 4 0.07714065312419646 0.3 5 0.025713551041398816 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra Read 825580 spots for SRR11389887.sra Written 825580 spots for SRR11389887.sra Read 825571 spots for SRR11389887.sra Written 825571 spots for SRR11389887.sra SRR ids: ['SRR11389887.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k8hg_92c SRR11389887.sra spots: 16511429 blocks: [[1, 825571], [825572, 1651142], [1651143, 2476713], [2476714, 3302284], [3302285, 4127855], [4127856, 4953426], [4953427, 5778997], [5778998, 6604568], [6604569, 7430139], [7430140, 8255710], [8255711, 9081281], [9081282, 9906852], [9906853, 10732423], [10732424, 11557994], [11557995, 12383565], [12383566, 13209136], [13209137, 14034707], [14034708, 14860278], [14860279, 15685849], [15685850, 16511429]] SRR11389887 file size 3141253 SRR11389887 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389887 SRR11389887_1.fastq SRR11389887_2.fastq Input file: SRR11389887_1.fastq Paired file: SRR11389887_2.fastq trimmed: SRR11389887-trimmed-pair1.fastq, SRR11389887-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:11:44 2024 >> started Sat Dec 7 09:11:56 2024 >> done (12.390s) 16511429 read pairs processed; of these: 933 ( 0.01%) short read pairs filtered out after trimming by size control 5886 ( 0.04%) empty read pairs filtered out after trimming by size control 16504610 (99.96%) read pairs available; of these: 9572 ( 0.06%) trimmed read pairs available after processing 16495038 (99.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 6 0.00% 23 6 0.00% 24 5 0.00% 25 6 0.00% 26 9 0.00% 27 13 0.00% 28 16 0.00% 29 9 0.00% 30 14 0.00% 31 11 0.00% 32 19 0.00% 33 12 0.00% 34 14 0.00% 35 171 0.00% 36 178 0.00% 37 211 0.00% 38 217 0.00% 39 231 0.00% 40 280 0.00% 41 268 0.00% 42 321 0.00% 43 345 0.00% 44 356 0.00% 45 354 0.00% 46 364 0.00% 47 401 0.00% 48 436 0.00% 49 434 0.00% 50 469 0.00% 51 534 0.00% 52 575 0.00% 53 611 0.00% 54 607 0.00% 55 663 0.00% 56 738 0.00% 57 824 0.00% 58 840 0.01% 59 960 0.01% 60 984 0.01% 61 909 0.01% 62 1044 0.01% 63 1141 0.01% 64 1213 0.01% 65 1282 0.01% 66 1369 0.01% 67 1536 0.01% 68 1628 0.01% 69 1791 0.01% 70 2258 0.01% 71 3576 0.02% 72 14856 0.09% 73 122160 0.74% 74 1037778 6.29% 75 6936838 42.03% 76 8362714 50.67% 16504610 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=25 prefix-density=1.24 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=17.04 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=1.9 sequence=TCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATA criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=11 prefix-density=0.87 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.25 sequence-density-rank=24 fanout-score=70.86 fanout-score-rank=1 prefix-density=1.23 prefix-fanout=14.3 sequence=GCCGCCGCCACCCT SRR11389887 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:13:06 Started mapping on | Dec 07 09:13:07 Finished on | Dec 07 09:14:11 Mapping speed, Million of reads per hour | 928.38 Number of input reads | 16504610 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 15259868 Uniquely mapped reads % | 92.46% Average mapped length | 150.43 Number of splices: Total | 6986875 Number of splices: Annotated (sjdb) | 6713576 Number of splices: GT/AG | 6895567 Number of splices: GC/AG | 82165 Number of splices: AT/AC | 1573 Number of splices: Non-canonical | 7570 Mismatch rate per base, % | 0.84% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 639042 % of reads mapped to multiple loci | 3.87% Number of reads mapped to too many loci | 32766 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 605706 605706 605706 N_multimapping 639042 639042 639042 N_noFeature 367482 14904188 444203 N_ambiguous 368898 1255 93017 UnstrandedReadsAssigned:14523488 PositiveStrandReadsAssigned:354425 NegativeStrandReadsAssigned:14722648 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389887 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389887-trimmed-pair1.fastq SRR11389887-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,504,610 reads, 15,106,547 reads pseudoaligned [quant] estimated average fragment length: 230.57 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52973 SRR11389887.ke.tsv 35125 SRR11389887.se.tsv 88098 total ==> SRR11389887.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 706.518 0 0 PNS24247 1044 814.43 30.2133 3.02401 PNS24249 1928 1698.43 77.7977 3.73386 PNS24246 1044 814.43 30.2133 3.02401 PNS24248 1044 814.43 30.2133 3.02401 PNS24244 1471 1241.43 23.5624 1.54716 PNS24243 293 87.9097 0 0 KQK14069 1603 1373.43 610.645 36.2427 KQK14071 474 247.212 43.2204 14.2514 ==> SRR11389887.se.tsv <== BRADI_1g14170v3 683 BRADI_1g53295v3 12 BRADI_1g59795v3 309 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 154 BRADI_1g74790v3 123 BRADI_1g09890v3 0 BRADI_1g77505v3 140 BRADI_1g48960v3 0 SRR11389887 completed mapping pipeline successfully