Starting /dee2/code/volunteer_pipeline.sh SRR11389888 current disk space = 1544290181120 free memory = 1602839384 SRR11389888 SRAfilesize 988d2a6e11817b2c83390fa759773139 SRR11389888.sra SRR11389888.sra file validated SRR11389888 is paired end SRR11389888 is conventional basespace SRR11389888 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389888_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2515 32.0 32.0 32.0 32.0 32.0 2 31.43475 32.0 32.0 32.0 32.0 32.0 3 31.2605 32.0 32.0 32.0 32.0 32.0 4 31.38075 32.0 32.0 32.0 32.0 32.0 5 31.46775 32.0 32.0 32.0 32.0 32.0 6 34.39225 36.0 36.0 36.0 32.0 36.0 7 34.58225 36.0 36.0 36.0 32.0 36.0 8 34.72125 36.0 36.0 36.0 32.0 36.0 9 34.57025 36.0 36.0 36.0 32.0 36.0 10-11 34.47725 36.0 36.0 36.0 32.0 36.0 12-13 34.623125 36.0 36.0 36.0 32.0 36.0 14-15 34.590875 36.0 36.0 36.0 32.0 36.0 16-17 34.5275 36.0 36.0 36.0 32.0 36.0 18-19 34.560375 36.0 36.0 36.0 32.0 36.0 20-21 34.51475 36.0 36.0 36.0 32.0 36.0 22-23 34.567625 36.0 36.0 36.0 32.0 36.0 24-25 34.347875 36.0 36.0 36.0 32.0 36.0 26-27 34.169125 36.0 36.0 36.0 32.0 36.0 28-29 34.242125 36.0 36.0 36.0 32.0 36.0 30-31 34.15325 36.0 36.0 36.0 32.0 36.0 32-33 34.193875000000006 36.0 36.0 36.0 32.0 36.0 34-35 34.164249999999996 36.0 36.0 36.0 32.0 36.0 36-37 34.06189047261816 36.0 36.0 36.0 32.0 36.0 38-39 34.046011502875714 36.0 36.0 36.0 32.0 36.0 40-41 33.95511377844461 36.0 36.0 36.0 32.0 36.0 42-43 34.01537884471118 36.0 36.0 36.0 32.0 36.0 44-45 33.80420105026256 36.0 36.0 36.0 32.0 36.0 46-47 33.92448112028007 36.0 36.0 36.0 32.0 36.0 48-49 33.89608598372705 36.0 36.0 36.0 32.0 36.0 50-51 33.76125562781391 36.0 36.0 36.0 32.0 36.0 52-53 33.85005002501251 36.0 36.0 36.0 32.0 36.0 54-55 33.61646234676007 36.0 36.0 36.0 27.0 36.0 56-57 33.79622216662497 36.0 36.0 36.0 32.0 36.0 58-59 33.74943707780836 36.0 36.0 36.0 29.5 36.0 60-61 33.27207905929447 36.0 36.0 36.0 24.0 36.0 62-63 33.367525644233176 36.0 36.0 36.0 24.0 36.0 64-65 33.28909181886415 36.0 36.0 36.0 27.0 36.0 66-67 33.102952214160624 36.0 34.0 36.0 24.0 36.0 68-69 32.91543657743308 36.0 32.0 36.0 24.0 36.0 70-71 32.91543657743307 36.0 32.0 36.0 21.0 36.0 72-73 33.085076799478244 36.0 34.0 36.0 27.0 36.0 74-75 32.874656581171266 36.0 32.0 36.0 21.0 36.0 76 32.10106007067138 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 0.0 23 2.0 24 7.0 25 7.0 26 21.0 27 35.0 28 59.0 29 94.0 30 145.0 31 233.0 32 396.0 33 614.0 34 1251.0 35 1134.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.509127281820454 10.152538134533634 9.277319329832459 44.06101525381345 2 28.257064266066518 9.852463115778946 39.109777444361086 22.780695173793447 3 27.206801700425103 14.853713428357091 20.980245061265315 36.959239809952486 4 31.957989497374346 22.755688922230558 18.6046511627907 26.6816704176044 5 31.38284571142786 25.95648912228057 21.48037009252313 21.180295073768445 6 25.025125628140703 28.94472361809045 23.34170854271357 22.688442211055275 7 19.179794948737182 22.755688922230558 36.734183545886474 21.330332583145786 8 20.980245061265315 20.705176294073517 31.357839459864966 26.9567391847962 9 21.80545136284071 18.95473868467117 32.733183295823956 26.506626656664167 10-11 24.63115778944736 27.656914228557138 22.280570142535634 25.431357839459867 12-13 25.381345336334082 21.230307576894223 24.343585896474117 29.044761190297574 14-15 24.831207801950487 23.36834208552138 25.49387346836709 26.30657664416104 16-17 25.51887971992998 23.53088272068017 24.468617154288573 26.481620405101275 18-19 26.03150787696924 22.88072018004501 23.655913978494624 27.431857964491122 20-21 25.10627656914228 22.593148287071767 24.74368592148037 27.556889222305575 22-23 26.019004751187797 23.443360840210055 23.830957739434858 26.70667666916729 24-25 25.918979744936234 22.88072018004501 23.10577644411103 28.094523630907727 26-27 26.16904226056514 23.3183295823956 23.380845211302827 27.131782945736433 28-29 25.468867216804203 24.043510877719427 23.568392098024507 26.91922980745186 30-31 25.743935983995996 23.25581395348837 23.718429607401852 27.28182045511378 32-33 25.431357839459867 23.36834208552138 24.756189047261813 26.44411102775694 34-35 26.38159539884971 22.630657664416105 23.74343585896474 27.24431107776944 36-37 26.51912978244561 23.280820205051263 23.068267066766694 27.131782945736433 38-39 25.756439109777446 23.13078269567392 23.868467116779193 27.24431107776944 40-41 26.30657664416104 23.168292073018254 22.968242060515127 27.556889222305575 42-43 26.281570392598148 22.443110777694425 23.69342335583896 27.581895473868467 44-45 25.006251562890725 23.25581395348837 24.69367341835459 27.04426106526632 46-47 26.094023505876468 23.030757689422355 23.280820205051263 27.59439859964991 48-49 26.710016256096036 22.308365637113916 23.6963861448043 27.285231961985744 50-51 25.625312656328163 24.074537268634316 23.499249624812407 26.80090045022511 52-53 26.088044022011005 23.774387193596798 23.036518259129565 27.101050525262632 54-55 26.720040030022517 22.679509632224168 23.092319239429575 27.50813109832374 56-57 26.13209907430573 22.70452839629722 23.605203902927197 27.558168626469854 58-59 26.745058794095574 22.892169126845133 23.567675756817614 26.79509632224168 60-61 26.732549412059043 22.76707530647986 22.52939704778584 27.970978233675257 62-63 26.157117838378785 22.641981486114584 23.44258193645234 27.75831873905429 64-65 26.7575681761321 23.54265699274456 22.76707530647986 26.932699524643482 66-67 26.632474355766828 22.904678508881663 23.092319239429575 27.370527895921942 68-69 26.55741806354766 22.354265699274457 23.980485364023014 27.107830873154864 70-71 27.395546659994995 22.22917187890918 23.48011008256192 26.8951713785339 72-73 26.17702448210923 22.38543628374137 23.176396735718768 28.261142498430637 74-75 26.970735565515426 20.155549696809913 24.86158713419457 28.012127603480096 76 28.515901060070668 0.0 32.86219081272085 38.621908127208485 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 2.5 22 3.0 23 2.0 24 4.0 25 6.0 26 4.5 27 6.0 28 8.5 29 8.5 30 9.0 31 13.5 32 21.5 33 29.5 34 31.0 35 41.5 36 66.5 37 79.5 38 87.5 39 101.0 40 118.5 41 139.5 42 151.5 43 176.5 44 179.5 45 172.0 46 184.5 47 176.0 48 162.0 49 164.0 50 166.0 51 157.0 52 145.0 53 125.5 54 118.0 55 139.0 56 149.5 57 150.5 58 158.5 59 161.5 60 155.0 61 140.5 62 140.0 63 138.0 64 126.5 65 114.5 66 96.5 67 94.0 68 97.0 69 80.5 70 67.0 71 69.5 72 66.5 73 51.5 74 49.0 75 55.5 76 45.0 77 32.5 78 23.5 79 16.0 80 14.5 81 10.0 82 6.5 83 5.0 84 3.5 85 1.5 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.5 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 8.0 72 13.0 73 54.0 74 258.0 75 834.0 76 2830.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.26264690853347 96.15 2 1.4052120592743995 2.75 3 0.22994379151762903 0.675 4 0.07664793050587634 0.3 5 0.02554931016862545 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGTTGTGCTCGCGGAAGACGAAGCCGACCTTGCTGAACTCCAGGCAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389888 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389888_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.84725 32.0 32.0 32.0 32.0 32.0 2 30.40875 32.0 32.0 32.0 32.0 32.0 3 30.33475 32.0 32.0 32.0 21.0 32.0 4 30.395 32.0 32.0 32.0 32.0 32.0 5 30.619 32.0 32.0 32.0 32.0 32.0 6 33.51925 36.0 36.0 36.0 21.0 36.0 7 33.684 36.0 36.0 36.0 32.0 36.0 8 33.614 36.0 36.0 36.0 32.0 36.0 9 33.60725 36.0 36.0 36.0 32.0 36.0 10-11 33.417249999999996 36.0 36.0 36.0 26.5 36.0 12-13 33.615 36.0 36.0 36.0 32.0 36.0 14-15 33.390875 36.0 36.0 36.0 29.5 36.0 16-17 33.347875 36.0 36.0 36.0 24.0 36.0 18-19 33.425875000000005 36.0 36.0 36.0 26.5 36.0 20-21 33.178625 36.0 36.0 36.0 24.0 36.0 22-23 33.418625000000006 36.0 36.0 36.0 29.5 36.0 24-25 33.1755 36.0 36.0 36.0 24.0 36.0 26-27 33.158 36.0 36.0 36.0 24.0 36.0 28-29 33.212625 36.0 36.0 36.0 21.0 36.0 30-31 32.961875 36.0 32.0 36.0 21.0 36.0 32-33 32.951375 36.0 34.0 36.0 17.5 36.0 34-35 33.024875 36.0 36.0 36.0 17.5 36.0 36-37 32.98548911683763 36.0 34.0 36.0 14.0 36.0 38-39 32.984738553915435 36.0 36.0 36.0 14.0 36.0 40-41 32.82249186890168 36.0 32.0 36.0 14.0 36.0 42-43 32.70477858393795 36.0 34.0 36.0 14.0 36.0 44-45 32.521891418563925 36.0 32.0 36.0 14.0 36.0 46-47 32.39967475606705 36.0 32.0 36.0 14.0 36.0 48-49 32.54697632959454 36.0 34.0 36.0 14.0 36.0 50-51 32.2784034034034 36.0 32.0 36.0 14.0 36.0 52-53 32.276651651651655 36.0 32.0 36.0 14.0 36.0 54-55 32.061576971214016 36.0 32.0 36.0 14.0 36.0 56-57 32.16983729662077 36.0 32.0 36.0 14.0 36.0 58-59 31.822403003754694 36.0 32.0 36.0 14.0 36.0 60-61 31.9540675844806 36.0 32.0 36.0 14.0 36.0 62-63 31.9441802252816 36.0 32.0 36.0 14.0 36.0 64-65 31.840675844806007 36.0 32.0 36.0 14.0 36.0 66-67 31.77409261576971 36.0 32.0 36.0 14.0 36.0 68-69 31.429225408826632 36.0 32.0 36.0 14.0 36.0 70-71 31.50504460626764 36.0 32.0 36.0 14.0 36.0 72-73 31.245284801549623 36.0 32.0 36.0 14.0 36.0 74-75 31.215188785762788 36.0 32.0 36.0 14.0 36.0 76 30.127735916756368 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 3.0 16 0.0 17 1.0 18 1.0 19 3.0 20 9.0 21 8.0 22 10.0 23 26.0 24 39.0 25 37.0 26 78.0 27 106.0 28 134.0 29 182.0 30 273.0 31 347.0 32 509.0 33 731.0 34 1015.0 35 483.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.806806806806808 19.844844844844843 8.883883883883884 39.46446446446446 2 28.378039608924542 23.940837302582104 30.107796440210578 17.573326648282777 3 24.893670252689517 27.145359019264447 19.564673505128845 28.396297222917187 4 29.39704778583938 29.847385539154363 17.062797097823367 23.692769577182887 5 29.74731048286215 33.02476857643232 17.363022266700025 19.864898674005506 6 23.2424318238679 34.50087565674256 19.089316987740805 23.167375531648737 7 22.566925193895422 15.88691518638979 33.09982486865149 28.446334751063297 8 23.54265699274456 22.366775081310983 22.692019014260694 31.39854891168376 9 23.44258193645234 19.78984238178634 26.21966474856142 30.5479109331999 10-11 27.724258726385585 27.549105467283873 18.253471787814338 26.473164018516204 12-13 28.365865865865864 19.582082082082085 21.72172172172172 30.33033033033033 14-15 26.834460305534684 23.56624092161282 22.97771099423992 26.62158777861257 16-17 27.96695042563846 22.921882824236352 21.4321482223335 27.679018527791687 18-19 27.466199298948425 23.485227841762644 21.244366549824736 27.804206309464195 20-21 26.63574830784658 23.790423665078965 22.536976685886188 27.036851341188267 22-23 27.29662077596996 23.504380475594495 22.040050062578224 27.15894868585732 24-25 27.923866766841975 23.340846481342346 21.863260706235913 26.872026045579766 26-27 26.918742957305618 23.851258294728936 22.636784775259798 26.593213972705648 28-29 27.466199298948425 22.984476715072606 21.870305458187282 27.679018527791687 30-31 27.372902579514154 23.240671174555473 21.775607312797398 27.61081893313298 32-33 27.335336839469072 23.115452041071876 22.026045579764588 27.523165539694467 34-35 27.997496871088863 22.90362953692115 21.90237797246558 27.19649561952441 36-37 27.203304957436153 23.29744616925388 21.594892338507762 27.904356534802204 38-39 28.312046080641124 23.56624092161282 21.550212872526924 26.57150012521913 40-41 28.02252816020025 23.754693366708384 21.00125156445557 27.221526908635795 42-43 27.96143250688705 22.21387427998998 22.464312546957174 27.36038066616579 44-45 26.856141229497933 23.92638036809816 22.035808188305996 27.18167021409791 46-47 27.560731279739542 23.353368394690712 22.03856749311295 27.0473328324568 48-49 28.315591734502192 22.179085785848464 22.417031934877897 27.08829054477145 50-51 28.333333333333332 22.857142857142858 22.731829573934835 26.07769423558897 52-53 27.635862759829706 23.22814926120711 21.487603305785125 27.64838467317806 54-55 27.617735470941884 23.947895791583164 21.430360721442888 27.004008016032067 56-57 28.111695467067367 23.328324567993988 22.32657150012522 26.233408464813422 58-59 27.029058116232463 22.75801603206413 22.044088176352705 28.1688376753507 60-61 28.537440520911595 22.802404207362887 21.399949912346607 27.260205359378915 62-63 27.72004507324402 23.12507825215976 22.148491298359836 27.006385376236388 64-65 27.467434869739478 23.033567134268537 22.044088176352705 27.45490981963928 66-67 27.679018527791687 23.42263395092639 22.02053079619429 26.877816725087634 68-69 29.19744584950545 22.749467885313635 21.998247151621385 26.054839113559535 70-71 28.27966420248089 22.353088585390303 22.08996366370129 27.277283548427516 72-73 28.312798591903444 21.636912245411114 22.190093034950966 27.860196127734472 74-75 27.518557794273597 20.453340402969246 23.700954400848357 28.327147401908803 76 29.07394113424264 0.0 30.50969131371141 40.41636755204595 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 2.5 2 1.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 2.5 25 3.5 26 5.0 27 4.5 28 4.0 29 6.5 30 11.5 31 14.0 32 17.0 33 22.0 34 31.5 35 45.5 36 46.0 37 47.5 38 68.0 39 91.5 40 98.0 41 113.5 42 139.0 43 139.5 44 132.0 45 145.0 46 157.0 47 155.0 48 141.5 49 150.0 50 159.5 51 144.0 52 146.5 53 163.0 54 178.0 55 161.0 56 144.0 57 155.5 58 162.0 59 175.5 60 172.0 61 159.0 62 161.5 63 135.0 64 115.5 65 122.5 66 122.0 67 114.5 68 100.5 69 88.5 70 87.5 71 89.0 72 90.0 73 79.0 74 56.5 75 46.0 76 42.5 77 28.5 78 16.0 79 14.0 80 12.5 81 10.0 82 8.5 83 7.5 84 5.0 85 2.5 86 1.0 87 0.5 88 1.0 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 1.0 98 1.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.27499999999999997 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.08750000000000001 12-13 0.1 14-15 0.17500000000000002 16-17 0.15 18-19 0.15 20-21 0.27499999999999997 22-23 0.125 24-25 0.17500000000000002 26-27 0.1625 28-29 0.15 30-31 0.17500000000000002 32-33 0.17500000000000002 34-35 0.125 36-37 0.07505629221916438 38-39 0.10007505629221916 40-41 0.05003752814610958 42-43 0.10007505629221916 44-45 0.08756567425569177 46-47 0.10007505629221916 48-49 0.10008757662955087 50-51 0.15015015015015015 52-53 0.07507507507507508 54-55 0.0750938673341677 56-57 0.05006257822277847 58-59 0.0750938673341677 60-61 0.05006257822277847 62-63 0.03754693366708385 64-65 0.0750938673341677 66-67 0.025031289111389236 68-69 0.025034422330704718 70-71 0.025053238131028437 72-73 0.037702651753173305 74-75 0.026504108136761195 76 0.03588087549336204 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 5.0 71 2.0 72 17.0 73 57.0 74 280.0 75 846.0 76 2787.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.44625573102394 96.625 2 1.3245033112582782 2.6 3 0.15282730514518594 0.44999999999999996 4 0.05094243504839531 0.2 5 0.025471217524197655 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191256 spots for SRR11389888.sra Written 1191256 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra Read 1191252 spots for SRR11389888.sra Written 1191252 spots for SRR11389888.sra SRR ids: ['SRR11389888.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dv6hf468 SRR11389888.sra spots: 23825044 blocks: [[1, 1191252], [1191253, 2382504], [2382505, 3573756], [3573757, 4765008], [4765009, 5956260], [5956261, 7147512], [7147513, 8338764], [8338765, 9530016], [9530017, 10721268], [10721269, 11912520], [11912521, 13103772], [13103773, 14295024], [14295025, 15486276], [15486277, 16677528], [16677529, 17868780], [17868781, 19060032], [19060033, 20251284], [20251285, 21442536], [21442537, 22633788], [22633789, 23825044]] SRR11389888 file size 4541780 SRR11389888 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389888 SRR11389888_1.fastq SRR11389888_2.fastq Input file: SRR11389888_1.fastq Paired file: SRR11389888_2.fastq trimmed: SRR11389888-trimmed-pair1.fastq, SRR11389888-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:12:53 2024 >> started Sat Dec 7 09:13:12 2024 >> done (19.492s) 23825044 read pairs processed; of these: 1351 ( 0.01%) short read pairs filtered out after trimming by size control 10795 ( 0.05%) empty read pairs filtered out after trimming by size control 23812898 (99.95%) read pairs available; of these: 7219 ( 0.03%) trimmed read pairs available after processing 23805679 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 1 0.00% 21 0 0.00% 22 2 0.00% 23 3 0.00% 24 3 0.00% 25 8 0.00% 26 5 0.00% 27 5 0.00% 28 5 0.00% 29 7 0.00% 30 2 0.00% 31 3 0.00% 32 11 0.00% 33 7 0.00% 34 8 0.00% 35 229 0.00% 36 222 0.00% 37 283 0.00% 38 334 0.00% 39 313 0.00% 40 380 0.00% 41 397 0.00% 42 440 0.00% 43 507 0.00% 44 522 0.00% 45 562 0.00% 46 633 0.00% 47 649 0.00% 48 648 0.00% 49 734 0.00% 50 714 0.00% 51 805 0.00% 52 815 0.00% 53 929 0.00% 54 931 0.00% 55 1147 0.00% 56 1158 0.00% 57 1335 0.01% 58 1423 0.01% 59 1509 0.01% 60 1716 0.01% 61 1567 0.01% 62 1814 0.01% 63 1940 0.01% 64 2070 0.01% 65 2328 0.01% 66 2614 0.01% 67 2793 0.01% 68 2711 0.01% 69 3164 0.01% 70 4127 0.02% 71 6037 0.03% 72 23378 0.10% 73 182173 0.77% 74 1523523 6.40% 75 10124880 42.52% 76 11908372 50.01% 23812898 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=19 prefix-density=0.93 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=12.57 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.4 sequence=TTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATG criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=14 prefix-density=0.74 prefix-fanout=2.4 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.24 sequence-density-rank=21 fanout-score=69.82 fanout-score-rank=1 prefix-density=1.14 prefix-fanout=14.9 sequence=GCCGCCGCCACCCTCCCTTCCATGGTCGCCGCCGCTCCCCGGAGCAGCAGCCGGCTGGTGGTGCGCGCATCGGCCGTAGGAGGGTTCCGGAAGGCGGCGGGGGCGGCTGCGGTGGCGGT SRR11389888 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:13:38 Started mapping on | Dec 07 09:13:38 Finished on | Dec 07 09:15:01 Mapping speed, Million of reads per hour | 1032.85 Number of input reads | 23812898 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 21398139 Uniquely mapped reads % | 89.86% Average mapped length | 150.37 Number of splices: Total | 9670092 Number of splices: Annotated (sjdb) | 9276947 Number of splices: GT/AG | 9542371 Number of splices: GC/AG | 114368 Number of splices: AT/AC | 2419 Number of splices: Non-canonical | 10934 Mismatch rate per base, % | 0.87% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1368060 % of reads mapped to multiple loci | 5.75% Number of reads mapped to too many loci | 98222 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 1.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1046707 1046707 1046707 N_multimapping 1368060 1368060 1368060 N_noFeature 528919 20908500 654824 N_ambiguous 501322 2059 142971 UnstrandedReadsAssigned:20367898 PositiveStrandReadsAssigned:487580 NegativeStrandReadsAssigned:20600344 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389888 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389888-trimmed-pair1.fastq SRR11389888-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,812,898 reads, 21,609,690 reads pseudoaligned [quant] estimated average fragment length: 218.37 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52973 SRR11389888.ke.tsv 35125 SRR11389888.se.tsv 88098 total ==> SRR11389888.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 718.765 1.01631e-05 8.4041e-07 PNS24247 1044 826.63 29.7249 2.13727 PNS24249 1928 1710.63 122.523 4.25707 PNS24246 1044 826.63 29.7249 2.13727 PNS24248 1044 826.63 29.7249 2.13727 PNS24244 1471 1253.63 20.3027 0.962578 PNS24243 293 96.897 0 0 KQK14069 1603 1385.63 123.011 5.27649 KQK14071 474 259.198 13.9894 3.20788 ==> SRR11389888.se.tsv <== BRADI_1g14170v3 136 BRADI_1g53295v3 13 BRADI_1g59795v3 157 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 130 BRADI_1g74790v3 314 BRADI_1g09890v3 0 BRADI_1g77505v3 194 BRADI_1g48960v3 0 SRR11389888 completed mapping pipeline successfully