Starting /dee2/code/volunteer_pipeline.sh SRR11389889 current disk space = 1544267071488 free memory = 1601448224 SRR11389889 SRAfilesize de606b80015a6885324cdd074ad12cf7 SRR11389889.sra SRR11389889.sra file validated SRR11389889 is paired end SRR11389889 is conventional basespace SRR11389889 read1 length is 56-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389889_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 56-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3655 32.0 32.0 32.0 32.0 32.0 2 31.4835 32.0 32.0 32.0 32.0 32.0 3 31.38175 32.0 32.0 32.0 32.0 32.0 4 31.4785 32.0 32.0 32.0 32.0 32.0 5 31.5195 32.0 32.0 32.0 32.0 32.0 6 34.6405 36.0 36.0 36.0 32.0 36.0 7 34.695 36.0 36.0 36.0 32.0 36.0 8 34.757 36.0 36.0 36.0 32.0 36.0 9 34.75875 36.0 36.0 36.0 32.0 36.0 10-11 34.610749999999996 36.0 36.0 36.0 32.0 36.0 12-13 34.56375 36.0 36.0 36.0 32.0 36.0 14-15 34.705875 36.0 36.0 36.0 32.0 36.0 16-17 34.66375 36.0 36.0 36.0 32.0 36.0 18-19 34.708 36.0 36.0 36.0 32.0 36.0 20-21 34.700625 36.0 36.0 36.0 32.0 36.0 22-23 34.6235 36.0 36.0 36.0 32.0 36.0 24-25 34.5 36.0 36.0 36.0 32.0 36.0 26-27 34.387874999999994 36.0 36.0 36.0 32.0 36.0 28-29 34.342875 36.0 36.0 36.0 32.0 36.0 30-31 34.34275 36.0 36.0 36.0 32.0 36.0 32-33 34.2915 36.0 36.0 36.0 32.0 36.0 34-35 34.201 36.0 36.0 36.0 32.0 36.0 36-37 34.27675 36.0 36.0 36.0 32.0 36.0 38-39 34.13475 36.0 36.0 36.0 32.0 36.0 40-41 34.060249999999996 36.0 36.0 36.0 32.0 36.0 42-43 34.101375 36.0 36.0 36.0 32.0 36.0 44-45 33.996624999999995 36.0 36.0 36.0 32.0 36.0 46-47 34.066500000000005 36.0 36.0 36.0 32.0 36.0 48-49 33.994875 36.0 36.0 36.0 32.0 36.0 50-51 33.84625 36.0 36.0 36.0 32.0 36.0 52-53 33.798874999999995 36.0 36.0 36.0 32.0 36.0 54-55 33.732625 36.0 36.0 36.0 27.0 36.0 56-57 33.80385737059265 36.0 36.0 36.0 32.0 36.0 58-59 33.78369592398099 36.0 36.0 36.0 29.5 36.0 60-61 33.51012753188297 36.0 36.0 36.0 27.0 36.0 62-63 33.72348674337169 36.0 36.0 36.0 27.0 36.0 64-65 33.374312156078034 36.0 36.0 36.0 27.0 36.0 66-67 33.26800900450225 36.0 34.0 36.0 27.0 36.0 68-69 33.13050550550551 36.0 32.0 36.0 27.0 36.0 70-71 33.16064050370572 36.0 32.0 36.0 27.0 36.0 72-73 33.21849016332796 36.0 34.0 36.0 27.0 36.0 74-75 33.19176823904772 36.0 32.0 36.0 27.0 36.0 76 32.28269298554812 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 4.0 25 11.0 26 15.0 27 24.0 28 58.0 29 82.0 30 133.0 31 213.0 32 331.0 33 593.0 34 1305.0 35 1230.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.325 11.15 8.875 45.65 2 25.35 9.425 43.45 21.775 3 24.875 14.6 21.775 38.75 4 33.025 22.225 17.8 26.950000000000003 5 29.45 26.125 23.674999999999997 20.75 6 25.702811244979916 27.68574297188755 24.021084337349397 22.590361445783135 7 20.225 21.875 35.199999999999996 22.7 8 20.05 21.175 32.35 26.424999999999997 9 21.125 17.125 34.150000000000006 27.6 10-11 24.725 27.787499999999998 22.400000000000002 25.087500000000002 12-13 26.2125 21.099999999999998 23.275000000000002 29.4125 14-15 24.962500000000002 22.4875 25.324999999999996 27.224999999999998 16-17 25.85 22.775000000000002 24.15 27.224999999999998 18-19 25.75 22.1375 23.7625 28.349999999999998 20-21 25.4375 24.1625 23.7625 26.637499999999996 22-23 26.650000000000002 22.900000000000002 23.65 26.8 24-25 25.5375 23.1125 23.3875 27.962500000000002 26-27 25.2 22.9375 24.8125 27.05 28-29 26.35 22.05 24.3875 27.212500000000002 30-31 26.9625 21.875 23.599999999999998 27.5625 32-33 25.587500000000002 23.3625 24.025 27.025 34-35 25.974999999999998 22.575 23.9875 27.462500000000002 36-37 25.8625 22.4375 23.8875 27.8125 38-39 24.8125 22.650000000000002 24.8125 27.725 40-41 26.950000000000003 22.400000000000002 22.9875 27.6625 42-43 25.937500000000004 22.3875 22.925 28.749999999999996 44-45 25.6 22.237499999999997 23.9 28.262500000000003 46-47 26.75 22.975 22.9875 27.287499999999998 48-49 26.650000000000002 22.425 23.2375 27.6875 50-51 26.387500000000003 22.912499999999998 23.400000000000002 27.3 52-53 26.650000000000002 22.575 22.9375 27.8375 54-55 25.8625 23.075000000000003 22.8125 28.249999999999996 56-57 25.965745718214777 21.9777472184023 24.14051756469559 27.91598949868734 58-59 26.894223555888974 22.255563890972745 23.85596399099775 26.994248562140534 60-61 27.656914228557138 21.405351337834457 23.168292073018254 27.769442360590148 62-63 26.013006503251624 22.823911955977987 23.974487243621812 27.188594297148573 64-65 27.47623811905953 21.010505252626313 23.62431215607804 27.888944472236116 66-67 26.713356678339167 22.28614307153577 22.823911955977987 28.176588294147077 68-69 26.2012012012012 22.66016016016016 23.71121121121121 27.427427427427425 70-71 26.806059847251785 22.286215099536747 22.999874796544383 27.907850256667082 72-73 27.09118311981914 21.55237377543331 23.474001507159006 27.882441597588546 74-75 26.52711953659821 19.72090573986309 24.486571879936808 29.265402843601894 76 29.714487134296792 0.0 29.961226647867466 40.32428621783574 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 2.0 19 2.5 20 2.0 21 1.5 22 2.5 23 3.5 24 4.0 25 5.0 26 4.0 27 2.5 28 3.0 29 3.5 30 8.5 31 16.0 32 18.0 33 20.5 34 28.0 35 39.5 36 54.5 37 67.0 38 83.5 39 103.0 40 121.0 41 138.0 42 149.5 43 156.5 44 165.0 45 166.0 46 159.0 47 157.0 48 157.5 49 157.5 50 158.5 51 149.0 52 137.0 53 137.5 54 135.5 55 146.0 56 150.5 57 154.0 58 159.5 59 158.0 60 173.5 61 172.0 62 160.0 63 149.5 64 125.5 65 125.5 66 120.0 67 96.0 68 83.5 69 71.0 70 69.0 71 76.0 72 77.0 73 61.5 74 44.5 75 40.5 76 35.0 77 28.0 78 19.5 79 13.5 80 13.0 81 9.5 82 4.5 83 1.0 84 1.5 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.4 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 2.0 68 0.0 69 2.0 70 1.0 71 4.0 72 16.0 73 52.0 74 246.0 75 838.0 76 2837.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.25103734439834 93.75 2 2.2821576763485476 4.3999999999999995 3 0.2074688796680498 0.6 4 0.1296680497925311 0.5 5 0.07780082987551867 0.375 6 0.0 0.0 7 0.025933609958506226 0.17500000000000002 8 0.025933609958506226 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 8 0.2 No Hit CAACAGATCAATCCAGATCAGTGAGCTGCTGTTTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGCG 7 0.17500000000000002 No Hit CTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGC 5 0.125 No Hit GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 5 0.125 No Hit GTCAGGGTTCAAATGTACATATGCTCCTCGAGCCCATGTCGGTACATTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.025 57 0.0 0.0 0.0 0.0 0.025 58 0.0 0.0 0.0 0.0 0.05 59 0.0 0.0 0.0 0.0 0.05 60 0.0 0.0 0.0 0.0 0.05 61 0.0 0.0 0.0 0.0 0.05 62 0.0 0.0 0.0 0.0 0.05 63 0.0 0.0 0.0 0.0 0.05 64 0.0 0.0 0.0 0.0 0.05 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389889 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389889_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.83675 32.0 32.0 32.0 32.0 32.0 2 30.6285 32.0 32.0 32.0 32.0 32.0 3 30.657 32.0 32.0 32.0 32.0 32.0 4 30.6215 32.0 32.0 32.0 32.0 32.0 5 30.7345 32.0 32.0 32.0 32.0 32.0 6 33.56075 36.0 36.0 36.0 21.0 36.0 7 33.93725 36.0 36.0 36.0 32.0 36.0 8 33.77875 36.0 36.0 36.0 32.0 36.0 9 33.88125 36.0 36.0 36.0 32.0 36.0 10-11 33.67125 36.0 36.0 36.0 32.0 36.0 12-13 33.746375 36.0 36.0 36.0 32.0 36.0 14-15 33.536625 36.0 36.0 36.0 29.5 36.0 16-17 33.551 36.0 36.0 36.0 29.5 36.0 18-19 33.677875 36.0 36.0 36.0 32.0 36.0 20-21 33.42975 36.0 36.0 36.0 27.0 36.0 22-23 33.576875 36.0 36.0 36.0 29.5 36.0 24-25 33.213625 36.0 36.0 36.0 21.0 36.0 26-27 33.368625 36.0 36.0 36.0 27.0 36.0 28-29 33.453375 36.0 36.0 36.0 27.0 36.0 30-31 33.309375 36.0 36.0 36.0 24.0 36.0 32-33 33.262625 36.0 36.0 36.0 24.0 36.0 34-35 33.282125 36.0 36.0 36.0 27.0 36.0 36-37 33.28585732165206 36.0 36.0 36.0 27.0 36.0 38-39 33.24355444305382 36.0 36.0 36.0 27.0 36.0 40-41 33.17421777221527 36.0 36.0 36.0 20.5 36.0 42-43 33.15008272734508 36.0 36.0 36.0 21.0 36.0 44-45 32.9685778668002 36.0 36.0 36.0 21.0 36.0 46-47 32.65923885828743 36.0 36.0 36.0 14.0 36.0 48-49 32.76652478718077 36.0 36.0 36.0 21.0 36.0 50-51 32.55608412618928 36.0 32.0 36.0 14.0 36.0 52-53 32.50788683024537 36.0 32.0 36.0 17.5 36.0 54-55 32.31221832749124 36.0 32.0 36.0 14.0 36.0 56-57 32.565403734201354 36.0 32.0 36.0 17.5 36.0 58-59 32.18645128975707 36.0 32.0 36.0 14.0 36.0 60-61 32.24254946155773 36.0 32.0 36.0 17.5 36.0 62-63 32.2686623246493 36.0 32.0 36.0 14.0 36.0 64-65 32.12111723446894 36.0 32.0 36.0 14.0 36.0 66-67 32.223321643286575 36.0 32.0 36.0 14.0 36.0 68-69 31.95501253132832 36.0 32.0 36.0 14.0 36.0 70-71 31.672533791132434 36.0 32.0 36.0 14.0 36.0 72-73 31.68099889959865 36.0 32.0 36.0 14.0 36.0 74-75 31.627750800023193 36.0 32.0 36.0 14.0 36.0 76 30.261560183551005 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 2.0 17 4.0 18 3.0 19 7.0 20 6.0 21 10.0 22 11.0 23 18.0 24 23.0 25 38.0 26 52.0 27 83.0 28 117.0 29 152.0 30 221.0 31 317.0 32 489.0 33 734.0 34 1136.0 35 567.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.97746055597295 20.63611319809667 8.214375156523916 41.172051089406466 2 29.273182957393484 23.50877192982456 30.50125313283208 16.716791979949875 3 24.055068836045056 26.458072590738425 18.72340425531915 30.76345431789737 4 28.685857321652065 30.538172715894866 15.269086357947433 25.50688360450563 5 29.536921151439298 32.21526908635794 17.37171464330413 20.876095118898625 6 24.705882352941178 34.618272841051315 17.07133917396746 23.60450563204005 7 23.479349186483102 15.41927409261577 32.090112640801 29.011264080100123 8 23.67959949937422 20.35043804755945 24.080100125156445 31.889862327909885 9 24.680851063829788 20.02503128911139 24.355444305381727 30.9386733416771 10-11 28.1136562773814 25.610214044310926 18.36274877957191 27.913380898735763 12-13 27.698472326571498 20.097670924117207 22.251440020035062 29.952416729276234 14-15 26.328320802005013 22.894736842105264 22.355889724310778 28.421052631578945 16-17 28.025557504384867 22.67602104735655 21.949386118767226 27.349035329491358 18-19 27.600902481825017 22.950614189019806 20.932564552519427 28.515918776635747 20-21 28.00351141208929 22.91196388261851 21.43215450213193 27.65237020316027 22-23 28.319138276553108 23.284068136272545 20.804108216432866 27.59268537074148 24-25 27.919799498746865 23.05764411027569 21.879699248120303 27.142857142857142 26-27 27.11779448621554 23.596491228070178 21.716791979949875 27.56892230576441 28-29 27.862691054873466 23.076923076923077 21.748935103983964 27.31145076421949 30-31 27.819548872180448 22.606516290726816 20.463659147869677 29.11027568922306 32-33 27.268170426065165 23.94736842105263 21.654135338345863 27.130325814536345 34-35 28.1938877755511 22.45741482965932 21.26753507014028 28.0811623246493 36-37 27.887747431721372 22.400400902029567 20.60886995740416 29.1029817088449 38-39 27.468671679197993 23.609022556390975 21.416040100250626 27.506265664160402 40-41 28.87024048096192 23.10871743486974 21.20490981963928 26.81613226452906 42-43 27.00162886856284 22.829219396065657 21.964666081944618 28.204485653426886 44-45 28.308270676691727 23.258145363408524 21.2531328320802 27.18045112781955 46-47 27.810502569244267 23.18586289008648 21.569118937210177 27.43451560345908 48-49 27.62250908635167 22.245895475623513 21.35605965659857 28.775535781426242 50-51 27.118856569709127 22.80591775325978 21.22617853560682 28.849047141424272 52-53 27.44926083688299 22.813831120020044 21.160110248058132 28.57679779503884 54-55 28.09720656394839 22.785920080170364 21.458098459225855 27.65877489665539 56-57 28.52311161217587 22.598020794187647 21.934109983715395 26.944757609921083 58-59 28.283208020050125 22.318295739348372 21.51629072681704 27.882205513784463 60-61 28.90253069406164 22.437985467301427 21.009771986970684 27.649711851666247 62-63 28.24207492795389 22.71645157248465 21.77671970930961 27.26475379025185 64-65 28.6287290047631 21.997994484833292 21.358736525444975 28.014539984958635 66-67 27.950388373841147 22.889000250563768 20.646454522676024 28.514156852919072 68-69 27.613436951616947 23.251441464026072 21.684632740035095 27.450488844321885 70-71 29.284818067754077 21.36762860727729 21.66875784190715 27.67879548306148 72-73 27.585338203804007 21.677793172943698 21.27471973800227 29.462148885250034 74-75 28.54485049833887 20.411960132890368 22.710963455149503 28.33222591362126 76 30.120056497175142 0.0 29.30790960451977 40.57203389830508 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 2.0 18 1.5 19 1.5 20 1.5 21 0.5 22 0.0 23 1.5 24 3.0 25 2.5 26 2.0 27 5.0 28 7.0 29 6.0 30 6.5 31 11.0 32 14.5 33 17.0 34 24.5 35 33.5 36 43.5 37 49.0 38 60.0 39 67.0 40 77.5 41 110.5 42 131.0 43 139.5 44 140.0 45 138.0 46 148.0 47 155.5 48 146.0 49 130.0 50 131.0 51 134.5 52 136.0 53 136.0 54 137.0 55 147.5 56 171.5 57 162.0 58 144.0 59 177.0 60 198.5 61 189.0 62 173.5 63 161.5 64 150.5 65 122.5 66 109.5 67 119.5 68 115.0 69 107.5 70 96.5 71 85.5 72 81.0 73 78.5 74 66.0 75 50.5 76 46.5 77 32.5 78 16.0 79 10.0 80 9.5 81 13.0 82 9.5 83 4.0 84 2.5 85 1.5 86 2.0 87 2.0 88 1.0 89 0.0 90 0.5 91 1.0 92 1.0 93 1.0 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.25 3 0.125 4 0.125 5 0.125 6 0.125 7 0.125 8 0.125 9 0.125 10-11 0.13749999999999998 12-13 0.17500000000000002 14-15 0.25 16-17 0.22499999999999998 18-19 0.27499999999999997 20-21 0.325 22-23 0.2 24-25 0.25 26-27 0.25 28-29 0.22499999999999998 30-31 0.25 32-33 0.25 34-35 0.2 36-37 0.10012515644555695 38-39 0.1251564455569462 40-41 0.0750938673341677 42-43 0.10013768932281887 44-45 0.10015022533800699 46-47 0.1126690035052579 48-49 0.1126690035052579 50-51 0.15022533800701052 52-53 0.07511266900350526 54-55 0.06259389083625438 56-57 0.05008138224615 58-59 0.07513148009015778 60-61 0.050087653393438514 62-63 0.037575150300601205 64-65 0.07515030060120241 66-67 0.0250501002004008 68-69 0.02506265664160401 70-71 0.025087807325639738 72-73 0.03777386048854193 74-75 0.026571011026969578 76 0.03529827038475115 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 2.0 68 0.0 69 2.0 70 4.0 71 6.0 72 14.0 73 57.0 74 287.0 75 787.0 76 2833.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.975 #Duplication Level Percentage of deduplicated Percentage of total 1 97.39623614333591 94.45 2 2.268625934519206 4.3999999999999995 3 0.23201856148491878 0.675 4 0.051559680329981955 0.2 5 0.025779840164990978 0.125 6 0.025779840164990978 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTT 6 0.15 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750473 spots for SRR11389889.sra Written 750473 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra Read 750458 spots for SRR11389889.sra Written 750458 spots for SRR11389889.sra SRR ids: ['SRR11389889.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9yqay4e4 SRR11389889.sra spots: 15009175 blocks: [[1, 750458], [750459, 1500916], [1500917, 2251374], [2251375, 3001832], [3001833, 3752290], [3752291, 4502748], [4502749, 5253206], [5253207, 6003664], [6003665, 6754122], [6754123, 7504580], [7504581, 8255038], [8255039, 9005496], [9005497, 9755954], [9755955, 10506412], [10506413, 11256870], [11256871, 12007328], [12007329, 12757786], [12757787, 13508244], [13508245, 14258702], [14258703, 15009175]] SRR11389889 file size 2852931 SRR11389889 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389889 SRR11389889_1.fastq SRR11389889_2.fastq Input file: SRR11389889_1.fastq Paired file: SRR11389889_2.fastq trimmed: SRR11389889-trimmed-pair1.fastq, SRR11389889-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:15:25 2024 >> started Sat Dec 7 09:15:37 2024 >> done (12.213s) 15009175 read pairs processed; of these: 855 ( 0.01%) short read pairs filtered out after trimming by size control 12013 ( 0.08%) empty read pairs filtered out after trimming by size control 14996307 (99.91%) read pairs available; of these: 14437 ( 0.10%) trimmed read pairs available after processing 14981870 (99.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 0 0.00% 20 2 0.00% 21 0 0.00% 22 7 0.00% 23 1 0.00% 24 6 0.00% 25 7 0.00% 26 14 0.00% 27 3 0.00% 28 7 0.00% 29 2 0.00% 30 7 0.00% 31 8 0.00% 32 7 0.00% 33 4 0.00% 34 9 0.00% 35 206 0.00% 36 227 0.00% 37 238 0.00% 38 265 0.00% 39 300 0.00% 40 371 0.00% 41 376 0.00% 42 395 0.00% 43 459 0.00% 44 471 0.00% 45 476 0.00% 46 509 0.00% 47 511 0.00% 48 575 0.00% 49 595 0.00% 50 577 0.00% 51 703 0.00% 52 705 0.00% 53 758 0.01% 54 831 0.01% 55 908 0.01% 56 930 0.01% 57 1006 0.01% 58 1003 0.01% 59 1102 0.01% 60 1213 0.01% 61 1154 0.01% 62 1261 0.01% 63 1422 0.01% 64 1487 0.01% 65 1625 0.01% 66 1703 0.01% 67 1792 0.01% 68 1742 0.01% 69 2035 0.01% 70 2501 0.02% 71 3698 0.02% 72 13970 0.09% 73 111374 0.74% 74 947744 6.32% 75 6300607 42.01% 76 7586393 50.59% 14996307 reads passed initial QC criterion=sequence-density sequence-density=1.25 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=21 prefix-density=1.27 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=9.12 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=2.7 sequence=CCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=1.05 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=6 prefix-density=1.12 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=27.77 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.0 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR11389889 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:16:13 Started mapping on | Dec 07 09:16:13 Finished on | Dec 07 09:17:11 Mapping speed, Million of reads per hour | 930.81 Number of input reads | 14996307 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 13948225 Uniquely mapped reads % | 93.01% Average mapped length | 150.37 Number of splices: Total | 6676896 Number of splices: Annotated (sjdb) | 6418547 Number of splices: GT/AG | 6589880 Number of splices: GC/AG | 78410 Number of splices: AT/AC | 1530 Number of splices: Non-canonical | 7076 Mismatch rate per base, % | 0.88% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 495849 % of reads mapped to multiple loci | 3.31% Number of reads mapped to too many loci | 24007 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 552238 552238 552238 N_multimapping 495849 495849 495849 N_noFeature 327099 13639890 392525 N_ambiguous 341763 1185 101127 UnstrandedReadsAssigned:13279363 PositiveStrandReadsAssigned:307150 NegativeStrandReadsAssigned:13454573 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389889 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389889-trimmed-pair1.fastq SRR11389889-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,996,307 reads, 13,727,348 reads pseudoaligned [quant] estimated average fragment length: 229.387 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52973 SRR11389889.ke.tsv 35125 SRR11389889.se.tsv 88098 total ==> SRR11389889.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 707.748 0 0 PNS24247 1044 815.613 24.6776 2.6618 PNS24249 1928 1699.61 73.7038 3.81502 PNS24246 1044 815.613 24.6776 2.6618 PNS24248 1044 815.613 24.6776 2.6618 PNS24244 1471 1242.61 12.2634 0.868223 PNS24243 293 88.2184 0 0 KQK14069 1603 1374.61 1210.91 77.4979 KQK14071 474 248.203 79.9804 28.3488 ==> SRR11389889.se.tsv <== BRADI_1g14170v3 1350 BRADI_1g53295v3 9 BRADI_1g59795v3 212 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 109 BRADI_1g74790v3 188 BRADI_1g09890v3 0 BRADI_1g77505v3 162 BRADI_1g48960v3 0 SRR11389889 completed mapping pipeline successfully