Starting /dee2/code/volunteer_pipeline.sh SRR11389890 current disk space = 1544262598656 free memory = 1601442744 SRR11389890 SRAfilesize 6d0f42e1daa7cf03c86d02e30e55c408 SRR11389890.sra SRR11389890.sra file validated SRR11389890 is paired end SRR11389890 is conventional basespace SRR11389890 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389890_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2375 32.0 32.0 32.0 32.0 32.0 2 31.509 32.0 32.0 32.0 32.0 32.0 3 31.3805 32.0 32.0 32.0 32.0 32.0 4 31.47925 32.0 32.0 32.0 32.0 32.0 5 31.53225 32.0 32.0 32.0 32.0 32.0 6 34.40875 36.0 36.0 36.0 32.0 36.0 7 34.696 36.0 36.0 36.0 32.0 36.0 8 34.737 36.0 36.0 36.0 32.0 36.0 9 34.63275 36.0 36.0 36.0 32.0 36.0 10-11 34.551500000000004 36.0 36.0 36.0 32.0 36.0 12-13 34.669375 36.0 36.0 36.0 32.0 36.0 14-15 34.591750000000005 36.0 36.0 36.0 32.0 36.0 16-17 34.610625 36.0 36.0 36.0 32.0 36.0 18-19 34.606 36.0 36.0 36.0 32.0 36.0 20-21 34.69975 36.0 36.0 36.0 32.0 36.0 22-23 34.499625 36.0 36.0 36.0 32.0 36.0 24-25 34.43875 36.0 36.0 36.0 32.0 36.0 26-27 34.267125 36.0 36.0 36.0 32.0 36.0 28-29 34.182375 36.0 36.0 36.0 32.0 36.0 30-31 34.234625 36.0 36.0 36.0 32.0 36.0 32-33 34.208625 36.0 36.0 36.0 32.0 36.0 34-35 34.16825 36.0 36.0 36.0 32.0 36.0 36-37 34.139354515886914 36.0 36.0 36.0 32.0 36.0 38-39 34.11533650237678 36.0 36.0 36.0 32.0 36.0 40-41 34.052552552552555 36.0 36.0 36.0 32.0 36.0 42-43 34.10085085085085 36.0 36.0 36.0 32.0 36.0 44-45 33.84643304130162 36.0 36.0 36.0 32.0 36.0 46-47 33.98936170212766 36.0 36.0 36.0 32.0 36.0 48-49 33.98297872340426 36.0 36.0 36.0 32.0 36.0 50-51 33.841158891027405 36.0 36.0 36.0 32.0 36.0 52-53 33.865514650638616 36.0 36.0 36.0 32.0 36.0 54-55 33.6282243926872 36.0 36.0 36.0 27.0 36.0 56-57 33.82481843225645 36.0 36.0 36.0 32.0 36.0 58-59 33.6725519659404 36.0 36.0 36.0 26.5 36.0 60-61 33.457718153562325 36.0 36.0 36.0 27.0 36.0 62-63 33.57178651966926 36.0 36.0 36.0 27.0 36.0 64-65 33.42092731829574 36.0 36.0 36.0 27.0 36.0 66-67 33.2311467179176 36.0 34.0 36.0 27.0 36.0 68-69 32.90407512353967 36.0 32.0 36.0 24.0 36.0 70-71 32.954124870698024 36.0 32.0 36.0 24.0 36.0 72-73 33.07456323082516 36.0 34.0 36.0 27.0 36.0 74-75 32.90945310457413 36.0 32.0 36.0 24.0 36.0 76 32.36455784690668 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 7.0 25 8.0 26 15.0 27 32.0 28 65.0 29 88.0 30 119.0 31 225.0 32 357.0 33 614.0 34 1288.0 35 1177.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.403052289216916 9.4070552914686 9.55716787590693 43.632724543407555 2 28.096072054040533 9.98248686514886 39.50462847135351 22.416812609457093 3 26.319739804853644 14.660995746810107 20.815611708781585 38.20365273955467 4 33.02476857643232 21.816362271703778 18.28871653740305 26.870152614460846 5 31.698774080560423 25.344008006004504 22.842131598699027 20.115086314736054 6 25.440806045340054 28.41309823677582 23.40050377833753 22.7455919395466 7 20.765574180635475 23.117338003502628 34.35076307230423 21.766324743557668 8 21.36602451838879 21.26594946209657 30.047535651738805 27.32049036777583 9 20.89066800100075 19.11433575181386 32.79959969977483 27.195396547410557 10-11 25.193895421566175 27.5331498623968 22.992244183137352 24.280710532899676 12-13 26.35726795096322 21.37853390042532 24.043032274205654 28.221165874405806 14-15 24.418313735301474 23.39254440830623 25.68176132099074 26.507380535401552 16-17 26.332249186890166 22.929697272954716 23.317488116087066 27.420565424068048 18-19 26.332249186890166 23.067300475356518 23.279959969977483 27.32049036777583 20-21 25.268951713785338 22.466850137603203 24.468351263447584 27.795846885163872 22-23 26.782586940205157 23.380035026269702 22.942206654991242 26.8951713785339 24-25 26.51988991743808 22.39179384538404 23.63022266700025 27.45809357017763 26-27 26.695021265949464 23.455091318488865 23.14235676757568 26.70753064798599 28-29 26.207155366524894 23.067300475356518 23.48011008256192 27.24543407555667 30-31 26.244683512634477 22.679509632224168 23.39254440830623 27.683262446835126 32-33 25.569176882662 22.12909682261696 24.518388791593697 27.78333750312735 34-35 26.53239929947461 23.430072554415812 22.504378283712782 27.5331498623968 36-37 27.157868401300977 22.004003002251686 23.68026019514636 27.157868401300977 38-39 26.64498373780335 22.454340755566676 23.217413059794847 27.683262446835126 40-41 26.93943943943944 22.54754754754755 22.384884884884883 28.128128128128125 42-43 26.476476476476474 21.834334334334336 23.96146146146146 27.72772772772773 44-45 26.14518147684606 22.165206508135167 23.979974968710888 27.709637046307883 46-47 26.345431789737173 23.128911138923655 23.31664580725907 27.2090112640801 48-49 26.057571964956196 21.70212765957447 22.991239048811014 29.24906132665832 50-51 26.824383527350104 21.942671172862685 24.08311428213794 27.149831017649266 52-53 26.646631605309288 22.61457550713749 23.203105434510395 27.535687453042822 54-55 26.183320811419986 22.514400200350615 22.551965940395693 28.750313047833707 56-57 25.106436263461056 22.68970698722765 23.754069621838216 28.449787127473076 58-59 26.30853994490358 22.777360380666163 23.303280741297268 27.61081893313298 60-61 25.785848465873514 22.14151534126487 23.343769567939887 28.72886662492173 62-63 27.273866198947633 22.76371836632423 22.099724379854674 27.862691054873466 64-65 26.478696741854634 22.305764411027567 23.671679197994987 27.54385964912281 66-67 27.04024069198947 22.025824244703525 23.05377961639714 27.880155446909864 68-69 26.294670846394986 22.344827586206897 22.44514106583072 28.9153605015674 70-71 26.869041645760163 22.32814851981937 22.566482689412943 28.23632714500753 72-73 26.525732980999116 21.555303888259722 23.027557568893922 28.89140556184724 74-75 26.94800899589893 19.777748379415268 23.627463950257972 29.646778674427832 76 29.88465571478504 0.0 32.29639986018874 37.81894442502621 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.0 22 0.5 23 2.0 24 2.5 25 2.0 26 5.0 27 8.0 28 9.0 29 11.5 30 15.0 31 15.5 32 17.5 33 24.5 34 29.0 35 32.5 36 37.0 37 50.5 38 70.5 39 100.5 40 123.5 41 140.0 42 151.5 43 159.5 44 176.0 45 165.5 46 154.5 47 163.5 48 158.5 49 151.0 50 156.0 51 142.0 52 126.0 53 120.0 54 112.0 55 130.0 56 139.5 57 157.5 58 187.5 59 176.0 60 178.0 61 165.5 62 138.0 63 132.0 64 124.0 65 123.0 66 111.0 67 98.0 68 96.0 69 99.0 70 87.5 71 71.5 72 74.0 73 67.5 74 50.5 75 46.0 76 44.0 77 31.5 78 18.5 79 12.5 80 10.5 81 8.0 82 5.5 83 3.0 84 3.0 85 4.0 86 2.0 87 0.0 88 0.5 89 1.0 90 0.5 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.075 5 0.075 6 0.75 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.075 24-25 0.075 26-27 0.075 28-29 0.075 30-31 0.075 32-33 0.075 34-35 0.075 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 1.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 1.0 62 0.0 63 1.0 64 0.0 65 1.0 66 1.0 67 0.0 68 1.0 69 0.0 70 2.0 71 5.0 72 13.0 73 53.0 74 269.0 75 784.0 76 2861.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.975 #Duplication Level Percentage of deduplicated Percentage of total 1 97.7313740654808 94.77499999999999 2 1.7272492910543953 3.35 3 0.3866976024748647 1.125 4 0.07733952049497293 0.3 5 0.025779840164990978 0.125 6 0.025779840164990978 0.15 7 0.025779840164990978 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCTGTTTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGCG 7 0.17500000000000002 No Hit GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 6 0.15 No Hit CCGGGTTGTTGGGAGAGATCACATGCATAAATACAACATGAAACAAACGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.075 0.0 0.0 0.0 0.0 47 0.075 0.0 0.0 0.0 0.0 48 0.075 0.0 0.0 0.0 0.0 49 0.075 0.0 0.0 0.0 0.0 50 0.075 0.0 0.0 0.0 0.0 51 0.075 0.0 0.0 0.0 0.0 52 0.075 0.0 0.0 0.0 0.0 53 0.075 0.0 0.0 0.0 0.0 54 0.075 0.0 0.0 0.0 0.0 55 0.075 0.0 0.0 0.0 0.0 56 0.075 0.0 0.0 0.0 0.0 57 0.075 0.0 0.0 0.0 0.0 58 0.075 0.0 0.0 0.0 0.0 59 0.075 0.0 0.0 0.0 0.0 60 0.075 0.0 0.0 0.0 0.0 61 0.075 0.0 0.0 0.0 0.0 62 0.075 0.0 0.0 0.0 0.0 63 0.075 0.0 0.0 0.0 0.0 64 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389890 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389890_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.798 32.0 32.0 32.0 32.0 32.0 2 30.58925 32.0 32.0 32.0 32.0 32.0 3 30.569 32.0 32.0 32.0 32.0 32.0 4 30.7095 32.0 32.0 32.0 32.0 32.0 5 30.7025 32.0 32.0 32.0 32.0 32.0 6 33.9055 36.0 36.0 36.0 32.0 36.0 7 34.04775 36.0 36.0 36.0 32.0 36.0 8 33.733 36.0 36.0 36.0 32.0 36.0 9 33.8235 36.0 36.0 36.0 32.0 36.0 10-11 33.673874999999995 36.0 36.0 36.0 32.0 36.0 12-13 33.713875 36.0 36.0 36.0 32.0 36.0 14-15 33.604375 36.0 36.0 36.0 29.5 36.0 16-17 33.478375 36.0 36.0 36.0 29.5 36.0 18-19 33.618624999999994 36.0 36.0 36.0 32.0 36.0 20-21 33.59025 36.0 36.0 36.0 27.0 36.0 22-23 33.428875 36.0 36.0 36.0 29.5 36.0 24-25 33.36425 36.0 36.0 36.0 27.0 36.0 26-27 33.402249999999995 36.0 36.0 36.0 27.0 36.0 28-29 33.363625 36.0 36.0 36.0 27.0 36.0 30-31 33.293125 36.0 36.0 36.0 27.0 36.0 32-33 33.152125 36.0 36.0 36.0 24.0 36.0 34-35 33.18275 36.0 36.0 36.0 24.0 36.0 36-37 33.50890393779784 36.0 36.0 36.0 27.0 36.0 38-39 33.24128417356408 36.0 36.0 36.0 27.0 36.0 40-41 33.20434019066734 36.0 36.0 36.0 24.0 36.0 42-43 33.30180632212745 36.0 36.0 36.0 24.0 36.0 44-45 32.8483061480552 36.0 36.0 36.0 21.0 36.0 46-47 32.80120481927711 36.0 36.0 36.0 17.5 36.0 48-49 32.78752510040161 36.0 36.0 36.0 17.5 36.0 50-51 32.50758592365949 36.0 32.0 36.0 14.0 36.0 52-53 32.70052737317931 36.0 32.0 36.0 17.5 36.0 54-55 32.55688096433953 36.0 32.0 36.0 14.0 36.0 56-57 32.57370668006027 36.0 32.0 36.0 17.5 36.0 58-59 32.20140632847816 36.0 32.0 36.0 14.0 36.0 60-61 32.310195711144765 36.0 32.0 36.0 14.0 36.0 62-63 32.36482412060302 36.0 32.0 36.0 14.0 36.0 64-65 32.06408645388289 36.0 32.0 36.0 14.0 36.0 66-67 32.106479211221185 36.0 32.0 36.0 14.0 36.0 68-69 31.68262874329204 36.0 32.0 36.0 14.0 36.0 70-71 31.76155380113626 36.0 32.0 36.0 14.0 36.0 72-73 31.60316371564288 36.0 32.0 36.0 14.0 36.0 74-75 31.585496526003297 36.0 32.0 36.0 14.0 36.0 76 30.31234611326064 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 0.0 4 0.0 5 2.0 6 1.0 7 0.0 8 2.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 1.0 18 0.0 19 3.0 20 8.0 21 8.0 22 13.0 23 15.0 24 22.0 25 39.0 26 58.0 27 92.0 28 113.0 29 156.0 30 217.0 31 301.0 32 454.0 33 707.0 34 1143.0 35 627.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.84700275896664 19.81439678956609 7.875595685979434 42.46300476548783 2 29.144720341108606 23.150238274391775 30.147980938048658 17.557060446450965 3 23.200401304238778 27.915726109857037 18.735891647855528 30.147980938048658 4 28.141459744168547 30.17306245297216 16.553799849510913 25.13167795334838 5 31.22648607975922 29.947328818660644 17.757712565838975 21.068472535741158 6 24.253824931025832 32.40531728116378 18.510158013544018 24.830699774266364 7 23.6017055430148 15.274642588412341 32.380235766240276 28.74341610233258 8 24.128417356408328 21.51993980436418 22.89942312515676 31.45221971407073 9 23.5766240280913 19.237521946325558 26.987710057687487 30.198143967895664 10-11 28.098344204716508 25.95333667837431 17.937782237832415 28.01053687907677 12-13 27.812656956303368 20.32898041185334 22.626820693119036 29.23154193872426 14-15 27.335596630202442 22.49465610461461 22.243178674713945 27.926568590469003 16-17 28.02563780319216 22.181726781450294 21.591051903983914 28.201583511373634 18-19 27.02600829249906 22.7792436235708 20.88202035431587 29.312727729614274 20-21 29.07810338322224 22.978241730599926 21.292919129669226 26.650735756508613 22-23 28.359708615925648 22.996734488821904 20.89927153981412 27.74428535543833 24-25 28.928840834800102 22.039225546894645 20.631128991702287 28.400804626602966 26-27 27.38244908222278 23.987930600955494 21.636912245411114 26.99270807141061 28-29 27.889447236180903 21.809045226130653 21.4321608040201 28.869346733668344 30-31 26.809954751131222 22.561588738059328 22.42332830568125 28.205128205128204 32-33 28.2518537137112 23.237401030539147 21.56591680281513 26.944828452934523 34-35 26.96558653604622 22.808339613162524 22.368751569957297 27.857322280833962 36-37 27.783362653933146 22.44282483035939 22.090977632571 27.682834883136465 38-39 28.284098051539914 22.63984915147706 22.325581395348838 26.75047140163419 40-41 28.04020100502513 23.203517587939697 21.168341708542712 27.587939698492463 42-43 26.96078431372549 23.353443941679235 21.4429361488185 28.24283559577677 44-45 28.30734406438632 23.80533199195171 20.787223340040242 27.10010060362173 46-47 28.58759904414539 22.613507734876116 20.827568859262986 27.971324361715507 48-49 27.701597685243428 21.889545854824508 22.12856963140018 28.280286828531892 50-51 28.287404051843463 22.285139046180948 21.643387441801938 27.78406946017365 52-53 27.500314504969182 21.864385457290226 21.210215121398917 29.425084916341675 54-55 27.297875015717338 23.55086131019741 20.98579152521061 28.16547214887464 56-57 28.89112396278602 22.39124968569273 21.83806889615288 26.87955745536837 58-59 27.459119496855344 22.69182389937107 21.39622641509434 28.452830188679247 60-61 27.662517289073307 22.582673205079846 21.715076071922546 28.039733433924308 62-63 27.443088919632753 22.76443214689976 21.78342346874607 28.009055464721417 64-65 27.681268882175225 22.872608257804632 20.896273917421954 28.54984894259819 66-67 29.16823958726564 22.083805209513024 20.67446835283755 28.073486850383794 68-69 28.093140339836374 22.781623662680932 21.72435494021397 27.400881057268723 70-71 27.754690844981738 21.62196196952525 21.773076438735675 28.850270746757335 72-73 27.64505119453925 22.04525344457085 21.1351283023638 29.1745670585261 74-75 28.90042598509052 17.95793397231097 23.722044728434504 29.419595314164006 76 30.598591549295772 0.0 28.87323943661972 40.52816901408451 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 13.0 1 6.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 2.0 19 2.5 20 1.0 21 0.0 22 1.5 23 3.5 24 3.0 25 2.5 26 5.0 27 6.5 28 6.0 29 6.5 30 11.0 31 14.0 32 16.0 33 14.5 34 17.5 35 27.0 36 37.5 37 46.0 38 54.0 39 75.0 40 95.0 41 106.0 42 111.5 43 131.0 44 145.5 45 145.0 46 143.5 47 149.0 48 151.5 49 137.0 50 127.0 51 127.0 52 127.5 53 129.0 54 138.0 55 147.0 56 154.0 57 156.5 58 163.5 59 182.0 60 189.0 61 178.5 62 167.0 63 145.0 64 140.5 65 148.5 66 134.5 67 126.5 68 129.0 69 107.5 70 88.0 71 95.5 72 88.0 73 77.5 74 67.0 75 55.0 76 49.5 77 33.5 78 22.5 79 23.5 80 19.5 81 11.0 82 6.5 83 4.5 84 3.0 85 2.5 86 3.0 87 3.0 88 2.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.325 3 0.325 4 0.325 5 0.325 6 0.325 7 0.325 8 0.325 9 0.325 10-11 0.35000000000000003 12-13 0.44999999999999996 14-15 0.5875 16-17 0.5375 18-19 0.5125000000000001 20-21 0.6125 22-23 0.475 24-25 0.575 26-27 0.575 28-29 0.5 30-31 0.5499999999999999 32-33 0.5375 34-35 0.475 36-37 0.200652119388011 38-39 0.2382743917732631 40-41 0.15052684395383845 42-43 0.2007024586051179 44-45 0.2258469259723965 46-47 0.2133534136546185 48-49 0.2384538152610442 50-51 0.25103552152629593 52-53 0.1883475640381718 54-55 0.13812154696132595 56-57 0.12556504269211452 58-59 0.1757910597689603 60-61 0.12558081125204068 62-63 0.11306532663316582 64-65 0.17592359889419454 66-67 0.1005656819610308 68-69 0.10059097196026656 70-71 0.07550018875047187 72-73 0.10102285642126531 74-75 0.09309748636786806 76 0.1055223355610271 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 13.0 36 0.0 37 0.0 38 0.0 39 1.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 1.0 62 0.0 63 1.0 64 0.0 65 1.0 66 1.0 67 0.0 68 1.0 69 1.0 70 3.0 71 7.0 72 11.0 73 61.0 74 267.0 75 783.0 76 2843.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.95 #Duplication Level Percentage of deduplicated Percentage of total 1 97.57607013924704 94.6 2 2.0887055183084065 4.05 3 0.23207839092315627 0.675 4 0.0257864878803507 0.1 5 0.0515729757607014 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0257864878803507 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 13 0.325 No Hit GGCAGGTACTGGACAATGTGGAAGCTTCCCATGTTCGGGTGCACCGACGC 5 0.125 No Hit CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912647 spots for SRR11389890.sra Written 912647 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra Read 912633 spots for SRR11389890.sra Written 912633 spots for SRR11389890.sra SRR ids: ['SRR11389890.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_subhg3g0 SRR11389890.sra spots: 18252674 blocks: [[1, 912633], [912634, 1825266], [1825267, 2737899], [2737900, 3650532], [3650533, 4563165], [4563166, 5475798], [5475799, 6388431], [6388432, 7301064], [7301065, 8213697], [8213698, 9126330], [9126331, 10038963], [10038964, 10951596], [10951597, 11864229], [11864230, 12776862], [12776863, 13689495], [13689496, 14602128], [14602129, 15514761], [15514762, 16427394], [16427395, 17340027], [17340028, 18252674]] SRR11389890 file size 3473561 SRR11389890 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389890 SRR11389890_1.fastq SRR11389890_2.fastq Input file: SRR11389890_1.fastq Paired file: SRR11389890_2.fastq trimmed: SRR11389890-trimmed-pair1.fastq, SRR11389890-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:15:59 2024 >> started Sat Dec 7 09:16:15 2024 >> done (15.670s) 18252674 read pairs processed; of these: 1080 ( 0.01%) short read pairs filtered out after trimming by size control 21969 ( 0.12%) empty read pairs filtered out after trimming by size control 18229625 (99.87%) read pairs available; of these: 13709 ( 0.08%) trimmed read pairs available after processing 18215916 (99.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 1 0.00% 20 23 0.00% 21 0 0.00% 22 21 0.00% 23 3 0.00% 24 26 0.00% 25 1 0.00% 26 20 0.00% 27 3 0.00% 28 9 0.00% 29 4 0.00% 30 16 0.00% 31 4 0.00% 32 10 0.00% 33 3 0.00% 34 8 0.00% 35 239 0.00% 36 266 0.00% 37 246 0.00% 38 329 0.00% 39 332 0.00% 40 418 0.00% 41 395 0.00% 42 405 0.00% 43 467 0.00% 44 506 0.00% 45 531 0.00% 46 562 0.00% 47 641 0.00% 48 589 0.00% 49 605 0.00% 50 655 0.00% 51 730 0.00% 52 751 0.00% 53 856 0.00% 54 836 0.00% 55 938 0.01% 56 975 0.01% 57 1024 0.01% 58 1160 0.01% 59 1175 0.01% 60 1238 0.01% 61 1295 0.01% 62 1424 0.01% 63 1553 0.01% 64 1602 0.01% 65 1754 0.01% 66 1855 0.01% 67 2082 0.01% 68 2038 0.01% 69 2296 0.01% 70 2836 0.02% 71 4236 0.02% 72 16086 0.09% 73 135182 0.74% 74 1146685 6.29% 75 7644040 41.93% 76 9247627 50.73% 18229625 reads passed initial QC criterion=sequence-density sequence-density=1.14 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=24 prefix-density=1.17 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=27 fanout-score=10.89 fanout-score-rank=1 prefix-density=1.17 prefix-fanout=1.4 sequence=CCGAACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=3.65 fanout-score-rank=7 prefix-density=1.01 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=28.99 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.1 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR11389890 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:16:48 Started mapping on | Dec 07 09:16:48 Finished on | Dec 07 09:18:19 Mapping speed, Million of reads per hour | 721.17 Number of input reads | 18229625 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 16928119 Uniquely mapped reads % | 92.86% Average mapped length | 150.38 Number of splices: Total | 7860835 Number of splices: Annotated (sjdb) | 7553974 Number of splices: GT/AG | 7756465 Number of splices: GC/AG | 93404 Number of splices: AT/AC | 1880 Number of splices: Non-canonical | 9086 Mismatch rate per base, % | 0.87% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 614072 % of reads mapped to multiple loci | 3.37% Number of reads mapped to too many loci | 31153 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.60% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 687440 687440 687440 N_multimapping 614072 614072 614072 N_noFeature 392166 16546107 472679 N_ambiguous 422244 1416 123732 UnstrandedReadsAssigned:16113709 PositiveStrandReadsAssigned:380596 NegativeStrandReadsAssigned:16331708 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389890 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389890-trimmed-pair1.fastq SRR11389890-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,229,625 reads, 16,683,468 reads pseudoaligned [quant] estimated average fragment length: 234.745 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52973 SRR11389890.ke.tsv 35125 SRR11389890.se.tsv 88098 total ==> SRR11389890.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 702.414 0 0 PNS24247 1044 810.255 22.3381 1.97678 PNS24249 1928 1694.25 96.8003 4.09668 PNS24246 1044 810.255 22.3381 1.97678 PNS24248 1044 810.255 22.3381 1.97678 PNS24244 1471 1237.25 4.18541 0.242557 PNS24243 293 86.0403 0 0 KQK14069 1603 1369.25 1340.48 70.1955 KQK14071 474 243.672 79.6512 23.438 ==> SRR11389890.se.tsv <== BRADI_1g14170v3 1504 BRADI_1g53295v3 9 BRADI_1g59795v3 293 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 113 BRADI_1g74790v3 240 BRADI_1g09890v3 0 BRADI_1g77505v3 219 BRADI_1g48960v3 0 SRR11389890 completed mapping pipeline successfully