Starting /dee2/code/volunteer_pipeline.sh SRR11389891 current disk space = 1544262598656 free memory = 1598980720 SRR11389891 SRAfilesize 5eb224fc046cf3622b46cf5abcafacd3 SRR11389891.sra SRR11389891.sra file validated SRR11389891 is paired end SRR11389891 is conventional basespace SRR11389891 read1 length is 38-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389891_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 38-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.36275 32.0 32.0 32.0 32.0 32.0 2 31.51525 32.0 32.0 32.0 32.0 32.0 3 31.36 32.0 32.0 32.0 32.0 32.0 4 31.45825 32.0 32.0 32.0 32.0 32.0 5 31.577 32.0 32.0 32.0 32.0 32.0 6 34.5845 36.0 36.0 36.0 32.0 36.0 7 34.7225 36.0 36.0 36.0 32.0 36.0 8 34.6635 36.0 36.0 36.0 32.0 36.0 9 34.65725 36.0 36.0 36.0 32.0 36.0 10-11 34.713125000000005 36.0 36.0 36.0 32.0 36.0 12-13 34.77575 36.0 36.0 36.0 32.0 36.0 14-15 34.679874999999996 36.0 36.0 36.0 32.0 36.0 16-17 34.683625000000006 36.0 36.0 36.0 32.0 36.0 18-19 34.67575 36.0 36.0 36.0 32.0 36.0 20-21 34.619625 36.0 36.0 36.0 32.0 36.0 22-23 34.655 36.0 36.0 36.0 32.0 36.0 24-25 34.591750000000005 36.0 36.0 36.0 32.0 36.0 26-27 34.479124999999996 36.0 36.0 36.0 32.0 36.0 28-29 34.209875 36.0 36.0 36.0 32.0 36.0 30-31 34.261125 36.0 36.0 36.0 32.0 36.0 32-33 34.229375000000005 36.0 36.0 36.0 32.0 36.0 34-35 34.243375 36.0 36.0 36.0 32.0 36.0 36-37 34.264625 36.0 36.0 36.0 32.0 36.0 38-39 34.127274099774944 36.0 36.0 36.0 32.0 36.0 40-41 34.12128032008002 36.0 36.0 36.0 32.0 36.0 42-43 34.10302575643911 36.0 36.0 36.0 32.0 36.0 44-45 34.0225056264066 36.0 36.0 36.0 32.0 36.0 46-47 33.96049012253063 36.0 36.0 36.0 32.0 36.0 48-49 34.0008752188047 36.0 36.0 36.0 32.0 36.0 50-51 33.93698424606151 36.0 36.0 36.0 32.0 36.0 52-53 33.89784946236559 36.0 36.0 36.0 32.0 36.0 54-55 33.81503251625813 36.0 36.0 36.0 27.0 36.0 56-57 33.885317658829415 36.0 36.0 36.0 32.0 36.0 58-59 33.825537768884445 36.0 36.0 36.0 29.5 36.0 60-61 33.47723861930965 36.0 36.0 36.0 27.0 36.0 62-63 33.632974731048286 36.0 36.0 36.0 27.0 36.0 64-65 33.42156617463097 36.0 36.0 36.0 27.0 36.0 66-67 33.354170720633064 36.0 34.0 36.0 27.0 36.0 68-69 33.083708708708706 36.0 32.0 36.0 27.0 36.0 70-71 33.05467967967968 36.0 32.0 36.0 27.0 36.0 72-73 33.110359609430816 36.0 34.0 36.0 27.0 36.0 74-75 33.15007321828081 36.0 32.0 36.0 27.0 36.0 76 32.497884344146684 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 6.0 25 6.0 26 21.0 27 31.0 28 48.0 29 89.0 30 127.0 31 179.0 32 359.0 33 574.0 34 1323.0 35 1232.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.575 9.925 8.649999999999999 46.85 2 27.575 8.95 41.975 21.5 3 27.775 14.899999999999999 19.8 37.525 4 33.35 20.95 18.125 27.575 5 30.825000000000003 25.424999999999997 21.875 21.875 6 24.240140668173826 29.36448128610902 23.762873649836724 22.63250439588043 7 19.7 22.525000000000002 36.525 21.25 8 20.9 20.599999999999998 30.725 27.775 9 20.875 17.45 34.35 27.325 10-11 24.637500000000003 27.200000000000003 23.0875 25.074999999999996 12-13 26.5125 21.475 24.025 27.987499999999997 14-15 25.424999999999997 22.9875 25.2375 26.35 16-17 25.4 22.525000000000002 23.599999999999998 28.475 18-19 25.8125 22.375 24.325 27.487499999999997 20-21 25.224999999999998 23.0125 24.9375 26.825 22-23 26.3 23.0375 23.375 27.287499999999998 24-25 25.662499999999998 23.1625 23.05 28.125 26-27 25.85 22.525000000000002 24.0625 27.5625 28-29 25.7375 23.1625 23.1125 27.987499999999997 30-31 25.3 23.4875 23.525 27.6875 32-33 25.7625 22.625 23.375 28.237499999999997 34-35 25.9625 22.2 24.375 27.462500000000002 36-37 26.025 22.7375 23.7375 27.500000000000004 38-39 26.22827853481685 22.82785348168521 23.865483185398176 27.078384798099762 40-41 25.818954738684667 23.34333583395849 22.918229557389346 27.91947986996749 42-43 25.63140785196299 22.755688922230558 23.718429607401852 27.894473618404604 44-45 24.50612653163291 22.718179544886222 24.518629657414355 28.257064266066518 46-47 26.006501625406354 22.980745186296573 23.305826456614152 27.70692673168292 48-49 25.318829707426854 22.493123280820203 23.468367091772944 28.719679919979995 50-51 25.23130782695674 22.893223305826456 23.018254563640912 28.857214303575894 52-53 26.44411102775694 22.05551387846962 23.78094523630908 27.719429857464366 54-55 26.21310655327664 22.236118059029515 23.06153076538269 28.489244622311155 56-57 25.72536268134067 23.836918459229615 22.898949474737368 27.538769384692348 58-59 25.50025012506253 22.686343171585793 24.012006003001503 27.801400700350175 60-61 26.600800400200097 22.07353676838419 23.036518259129565 28.289144572286144 62-63 25.469101826369776 23.042281711283465 23.817863397548162 27.670753064798596 64-65 26.494871153365025 22.70452839629722 22.742056542406804 28.05854390793095 66-67 25.935193294132365 22.119354435130738 23.658200925810082 28.287251344926812 68-69 26.726726726726728 22.71021021021021 22.7977977977978 27.765265265265267 70-71 26.976976976976978 22.4974974974975 22.57257257257257 27.952952952952952 72-73 27.00803212851406 21.64909638554217 21.837349397590362 29.505522088353413 74-75 26.33245382585752 19.656992084432716 25.184696569920845 28.825857519788915 76 31.20592383638928 0.0 31.45275035260931 37.34132581100141 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 2.0 26 1.5 27 3.5 28 8.5 29 11.5 30 11.5 31 13.5 32 19.0 33 22.0 34 24.5 35 38.0 36 51.0 37 63.5 38 78.0 39 101.5 40 116.0 41 130.0 42 158.5 43 173.5 44 180.0 45 188.0 46 182.0 47 167.5 48 168.5 49 161.5 50 149.0 51 149.5 52 141.0 53 138.5 54 155.0 55 160.0 56 158.0 57 163.5 58 163.5 59 158.5 60 163.0 61 154.0 62 138.0 63 114.5 64 101.0 65 108.5 66 104.5 67 98.5 68 99.0 69 87.0 70 72.5 71 75.5 72 65.5 73 52.5 74 52.5 75 50.0 76 45.5 77 40.0 78 28.0 79 19.0 80 12.5 81 7.5 82 8.5 83 8.0 84 5.0 85 1.0 86 1.0 87 2.0 88 1.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.475 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 6.0 72 12.0 73 54.0 74 268.0 75 820.0 76 2836.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.775 #Duplication Level Percentage of deduplicated Percentage of total 1 97.5975200206665 94.45 2 1.8858176181865152 3.65 3 0.3099974166881943 0.8999999999999999 4 0.10333247222939809 0.4 5 0.051666236114699046 0.25 6 0.0 0.0 7 0.051666236114699046 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTTCTTCACCT 7 0.17500000000000002 No Hit CTGGCATCTTATACATATATATATGGGACTCCAACAGATCAATCCAGATC 7 0.17500000000000002 No Hit CCGGGTTGTTGGGAGAGATCACATGCATAAATACAACATGAAACAAACGT 5 0.125 No Hit CAACAGATCAATCCAGATCAGTGAGCTGCTGTTTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.025 61 0.0 0.0 0.0 0.0 0.025 62 0.0 0.0 0.0 0.0 0.025 63 0.0 0.0 0.0 0.0 0.025 64 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389891 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389891_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.01675 32.0 32.0 32.0 32.0 32.0 2 30.87425 32.0 32.0 32.0 32.0 32.0 3 30.70075 32.0 32.0 32.0 32.0 32.0 4 30.74825 32.0 32.0 32.0 32.0 32.0 5 30.8005 32.0 32.0 32.0 32.0 32.0 6 33.9445 36.0 36.0 36.0 32.0 36.0 7 34.13675 36.0 36.0 36.0 32.0 36.0 8 34.03225 36.0 36.0 36.0 32.0 36.0 9 34.07 36.0 36.0 36.0 32.0 36.0 10-11 33.979375 36.0 36.0 36.0 32.0 36.0 12-13 33.973375000000004 36.0 36.0 36.0 32.0 36.0 14-15 33.860625 36.0 36.0 36.0 32.0 36.0 16-17 33.897625000000005 36.0 36.0 36.0 32.0 36.0 18-19 33.806875000000005 36.0 36.0 36.0 32.0 36.0 20-21 33.6475 36.0 36.0 36.0 29.5 36.0 22-23 33.713375 36.0 36.0 36.0 32.0 36.0 24-25 33.5485 36.0 36.0 36.0 27.0 36.0 26-27 33.45675 36.0 36.0 36.0 26.5 36.0 28-29 33.622875 36.0 36.0 36.0 27.0 36.0 30-31 33.587 36.0 36.0 36.0 27.0 36.0 32-33 33.418375 36.0 36.0 36.0 27.0 36.0 34-35 33.602875 36.0 36.0 36.0 29.5 36.0 36-37 33.57838717756073 36.0 36.0 36.0 29.5 36.0 38-39 33.61755102993365 36.0 36.0 36.0 29.5 36.0 40-41 33.47883266533066 36.0 36.0 36.0 27.0 36.0 42-43 33.441883767535074 36.0 36.0 36.0 27.0 36.0 44-45 33.147920841683366 36.0 36.0 36.0 21.0 36.0 46-47 32.96580661322645 36.0 36.0 36.0 21.0 36.0 48-49 32.99073146292585 36.0 36.0 36.0 21.0 36.0 50-51 32.84168336673346 36.0 32.0 36.0 21.0 36.0 52-53 32.86598196392786 36.0 32.0 36.0 21.0 36.0 54-55 32.72074668003007 36.0 32.0 36.0 21.0 36.0 56-57 32.8856176396893 36.0 32.0 36.0 21.0 36.0 58-59 32.558130794287145 36.0 32.0 36.0 17.5 36.0 60-61 32.497243798546734 36.0 32.0 36.0 21.0 36.0 62-63 32.43333333333334 36.0 32.0 36.0 17.5 36.0 64-65 32.51466165413534 36.0 32.0 36.0 21.0 36.0 66-67 32.455764411027566 36.0 32.0 36.0 17.5 36.0 68-69 32.08145363408521 36.0 32.0 36.0 17.5 36.0 70-71 31.931749874938603 36.0 32.0 36.0 17.5 36.0 72-73 32.010542894805255 36.0 32.0 36.0 14.0 36.0 74-75 31.877992633223105 36.0 32.0 36.0 14.0 36.0 76 30.500357398141528 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 2.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 2.0 15 1.0 16 3.0 17 1.0 18 5.0 19 3.0 20 3.0 21 9.0 22 5.0 23 11.0 24 25.0 25 41.0 26 53.0 27 85.0 28 92.0 29 113.0 30 214.0 31 273.0 32 399.0 33 689.0 34 1230.0 35 733.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.286394387371587 20.846905537459286 8.068153345026309 43.798546730142824 2 29.460476787954832 24.642409033877037 30.489335006273528 15.407779171894607 3 22.814926120711245 26.771850738792885 19.509140996744303 30.904082143751566 4 29.07588279489106 29.351364888554972 17.129977460555974 24.442774855997996 5 30.954169797145003 29.676934635612323 17.63085399449036 21.738041572752316 6 23.39093413473579 34.25995492111195 18.2068620085149 24.142248935637365 7 23.09040821437516 16.353618832957675 32.2564487853744 28.299524167292763 8 24.780756702580806 19.99498872463042 22.25006264094212 32.974191931846654 9 22.890057600801402 20.686200851490106 27.122464312546956 29.301277235161532 10-11 27.78056112224449 25.964428857715433 18.75 27.505010020040082 12-13 27.875219243297416 20.370834377349034 21.611125031320473 30.14282134803307 14-15 27.00601805416249 23.345035105315947 21.915747241725175 27.73319959879639 16-17 28.105804187037737 21.775103422339225 21.66227905227529 28.456813338347747 18-19 27.146258929690436 23.49918536157413 22.170698082466476 27.183857626268953 20-21 27.97641450257182 22.594404717099486 21.854221553130095 27.57495922719859 22-23 27.518796992481203 23.671679197994987 20.601503759398497 28.208020050125317 24-25 28.25977933801404 22.80591775325978 21.00050150451354 27.933801404212637 26-27 27.34796238244514 24.0 20.99059561128527 27.661442006269592 28-29 27.39348370927318 23.195488721804512 20.852130325814535 28.55889724310777 30-31 27.45958140117809 22.997869407193882 21.869908509838325 27.672640681789694 32-33 27.731829573934835 24.398496240601503 20.852130325814535 27.017543859649123 34-35 27.61904761904762 23.483709273182956 21.19047619047619 27.706766917293237 36-37 26.516290726817044 23.50877192982456 21.979949874686717 27.994987468671678 38-39 27.93933316620707 23.451992980696918 21.133116069190272 27.475557783905742 40-41 28.27776385058912 22.06066683379293 21.408874404612686 28.252694911005268 42-43 27.742258994609504 23.141531904224646 21.76256738122101 27.353641719944843 44-45 27.35139202407825 23.43867569601204 21.695510408828696 27.514421871081012 46-47 28.329571106094807 22.598444946074743 21.595184349134687 27.476799598695763 48-49 27.66491096062202 22.284926009530974 21.95886631552546 28.091296714321544 50-51 27.43007650821523 23.554496425435843 21.008403361344538 28.007023705004393 52-53 28.883038736367055 21.925535915757806 21.386486147674564 27.80493920020058 54-55 28.698595787362084 22.818455366098295 20.68706118355065 27.795887662988967 56-57 28.318916886047386 23.530149178889307 21.135765325310267 27.015168609753037 58-59 28.514106583072103 22.783699059561126 20.564263322884013 28.13793103448276 60-61 27.9052275291463 22.289081108186036 21.900463833521375 27.9052275291463 62-63 27.811912225705328 21.818181818181817 22.13166144200627 28.23824451410658 64-65 27.843973410259625 22.9650068982817 20.456540825285337 28.734478866173337 66-67 27.49498495486459 22.981444332998997 21.715145436308926 27.80842527582748 68-69 28.109327983951854 23.332497492477433 21.602306920762288 26.955867602808425 70-71 27.262457637755745 22.844232458892932 21.3756746579641 28.517635245387225 72-73 27.523977788995456 22.778899545684 21.65572942958102 28.041393235739527 74-75 29.144456289978677 19.016524520255864 23.37420042643923 28.464818763326228 76 29.506437768240346 0.0 30.40057224606581 40.09298998569385 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 4.0 2 0.5 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 3.5 26 4.5 27 4.0 28 3.0 29 1.5 30 3.0 31 8.0 32 15.0 33 19.0 34 23.5 35 37.0 36 52.5 37 57.0 38 59.5 39 82.0 40 105.0 41 116.5 42 123.5 43 131.5 44 137.5 45 147.0 46 157.0 47 147.0 48 132.5 49 137.0 50 143.0 51 149.5 52 163.5 53 143.0 54 119.5 55 129.5 56 165.5 57 175.0 58 164.0 59 178.5 60 184.5 61 166.0 62 142.5 63 138.5 64 146.5 65 140.0 66 128.0 67 132.5 68 124.0 69 94.5 70 82.5 71 88.5 72 84.0 73 76.5 74 68.5 75 58.0 76 45.0 77 27.0 78 19.5 79 17.5 80 12.5 81 9.0 82 9.0 83 9.0 84 6.5 85 4.0 86 4.0 87 5.0 88 4.5 89 2.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.375 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.17500000000000002 7 0.17500000000000002 8 0.22499999999999998 9 0.17500000000000002 10-11 0.2 12-13 0.22499999999999998 14-15 0.3 16-17 0.2875 18-19 0.2625 20-21 0.36250000000000004 22-23 0.25 24-25 0.3 26-27 0.3125 28-29 0.25 30-31 0.2625 32-33 0.25 34-35 0.25 36-37 0.07513148009015778 38-39 0.08766437069505323 40-41 0.07515030060120241 42-43 0.08767535070140281 44-45 0.125250501002004 46-47 0.125250501002004 48-49 0.125250501002004 50-51 0.1377755511022044 52-53 0.08767535070140281 54-55 0.07516913054372337 56-57 0.06264094211976949 58-59 0.08769731896767727 60-61 0.06264094211976949 62-63 0.06265664160401002 64-65 0.08771929824561403 66-67 0.05012531328320802 68-69 0.05012531328320802 70-71 0.0501819094216535 72-73 0.0630596544330937 74-75 0.05327650506126798 76 0.07147962830593281 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 7.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 1.0 70 7.0 71 4.0 72 27.0 73 66.0 74 262.0 75 825.0 76 2798.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.75 #Duplication Level Percentage of deduplicated Percentage of total 1 97.41602067183463 94.25 2 2.041343669250646 3.95 3 0.3875968992248062 1.125 4 0.12919896640826875 0.5 5 0.0 0.0 6 0.0 0.0 7 0.025839793281653745 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812559 spots for SRR11389891.sra Written 812559 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra Read 812555 spots for SRR11389891.sra Written 812555 spots for SRR11389891.sra SRR ids: ['SRR11389891.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c90hxny6 SRR11389891.sra spots: 16251104 blocks: [[1, 812555], [812556, 1625110], [1625111, 2437665], [2437666, 3250220], [3250221, 4062775], [4062776, 4875330], [4875331, 5687885], [5687886, 6500440], [6500441, 7312995], [7312996, 8125550], [8125551, 8938105], [8938106, 9750660], [9750661, 10563215], [10563216, 11375770], [11375771, 12188325], [12188326, 13000880], [13000881, 13813435], [13813436, 14625990], [14625991, 15438545], [15438546, 16251104]] SRR11389891 file size 3091318 SRR11389891 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389891 SRR11389891_1.fastq SRR11389891_2.fastq Input file: SRR11389891_1.fastq Paired file: SRR11389891_2.fastq trimmed: SRR11389891-trimmed-pair1.fastq, SRR11389891-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:15:59 2024 >> started Sat Dec 7 09:16:14 2024 >> done (15.037s) 16251104 read pairs processed; of these: 993 ( 0.01%) short read pairs filtered out after trimming by size control 6690 ( 0.04%) empty read pairs filtered out after trimming by size control 16243421 (99.95%) read pairs available; of these: 28486 ( 0.18%) trimmed read pairs available after processing 16214935 (99.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 2 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 3 0.00% 29 5 0.00% 30 1 0.00% 31 2 0.00% 32 6 0.00% 33 5 0.00% 34 5 0.00% 35 189 0.00% 36 211 0.00% 37 241 0.00% 38 279 0.00% 39 282 0.00% 40 266 0.00% 41 297 0.00% 42 347 0.00% 43 398 0.00% 44 438 0.00% 45 427 0.00% 46 464 0.00% 47 449 0.00% 48 524 0.00% 49 500 0.00% 50 568 0.00% 51 587 0.00% 52 630 0.00% 53 705 0.00% 54 747 0.00% 55 791 0.00% 56 782 0.00% 57 862 0.01% 58 921 0.01% 59 970 0.01% 60 1061 0.01% 61 1052 0.01% 62 1093 0.01% 63 1262 0.01% 64 1273 0.01% 65 1293 0.01% 66 1514 0.01% 67 1633 0.01% 68 1620 0.01% 69 1757 0.01% 70 2198 0.01% 71 3541 0.02% 72 14492 0.09% 73 120512 0.74% 74 1046802 6.44% 75 6848864 42.16% 76 8180537 50.36% 16243421 reads passed initial QC criterion=sequence-density sequence-density=1.19 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=15 prefix-density=1.22 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=17.73 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.4 sequence=CTTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTC criterion=sequence-density sequence-density=1.04 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=20 prefix-density=1.05 prefix-fanout=2.0 sequence=TGAAGCAGATCGAGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=29.15 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.5 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR11389891 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:16:55 Started mapping on | Dec 07 09:16:55 Finished on | Dec 07 09:18:03 Mapping speed, Million of reads per hour | 859.95 Number of input reads | 16243421 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 15124236 Uniquely mapped reads % | 93.11% Average mapped length | 150.38 Number of splices: Total | 7459006 Number of splices: Annotated (sjdb) | 7169626 Number of splices: GT/AG | 7354494 Number of splices: GC/AG | 94309 Number of splices: AT/AC | 1885 Number of splices: Non-canonical | 8318 Mismatch rate per base, % | 0.83% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 514953 % of reads mapped to multiple loci | 3.17% Number of reads mapped to too many loci | 25472 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 604240 604240 604240 N_multimapping 514953 514953 514953 N_noFeature 371537 14780313 441852 N_ambiguous 370492 1501 98675 UnstrandedReadsAssigned:14382207 PositiveStrandReadsAssigned:342422 NegativeStrandReadsAssigned:14583709 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389891 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389891-trimmed-pair1.fastq SRR11389891-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,243,421 reads, 14,823,208 reads pseudoaligned [quant] estimated average fragment length: 232.223 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52973 SRR11389891.ke.tsv 35125 SRR11389891.se.tsv 88098 total ==> SRR11389891.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 704.998 32.9168 3.79109 PNS24247 1044 812.777 13.4887 1.34752 PNS24249 1928 1696.78 92.0325 4.40404 PNS24246 1044 812.777 13.4887 1.34752 PNS24248 1044 812.777 13.4887 1.34752 PNS24244 1471 1239.78 6.58457 0.43124 PNS24243 293 86.9659 0 0 KQK14069 1603 1371.78 789.758 46.7461 KQK14071 474 245.835 45.4534 15.0127 ==> SRR11389891.se.tsv <== BRADI_1g14170v3 872 BRADI_1g53295v3 9 BRADI_1g59795v3 209 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 113 BRADI_1g74790v3 319 BRADI_1g09890v3 0 BRADI_1g77505v3 209 BRADI_1g48960v3 0 SRR11389891 completed mapping pipeline successfully