Starting /dee2/code/volunteer_pipeline.sh SRR11389892 current disk space = 1544260055040 free memory = 1603125168 SRR11389892 SRAfilesize 2e2f43c91a8e37b89c5caf48bd578b96 SRR11389892.sra SRR11389892.sra file validated SRR11389892 is paired end SRR11389892 is conventional basespace SRR11389892 read1 length is 39-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389892_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 39-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.372 32.0 32.0 32.0 32.0 32.0 2 31.476 32.0 32.0 32.0 32.0 32.0 3 31.34175 32.0 32.0 32.0 32.0 32.0 4 31.493 32.0 32.0 32.0 32.0 32.0 5 31.61275 32.0 32.0 32.0 32.0 32.0 6 34.41275 36.0 36.0 36.0 32.0 36.0 7 34.7205 36.0 36.0 36.0 32.0 36.0 8 34.73275 36.0 36.0 36.0 32.0 36.0 9 34.5025 36.0 36.0 36.0 32.0 36.0 10-11 34.718375 36.0 36.0 36.0 32.0 36.0 12-13 34.715375 36.0 36.0 36.0 32.0 36.0 14-15 34.745625000000004 36.0 36.0 36.0 32.0 36.0 16-17 34.724 36.0 36.0 36.0 32.0 36.0 18-19 34.636 36.0 36.0 36.0 32.0 36.0 20-21 34.75025 36.0 36.0 36.0 32.0 36.0 22-23 34.641875 36.0 36.0 36.0 32.0 36.0 24-25 34.471 36.0 36.0 36.0 32.0 36.0 26-27 34.366375000000005 36.0 36.0 36.0 32.0 36.0 28-29 34.4375 36.0 36.0 36.0 32.0 36.0 30-31 34.216499999999996 36.0 36.0 36.0 32.0 36.0 32-33 34.30575 36.0 36.0 36.0 32.0 36.0 34-35 34.288124999999994 36.0 36.0 36.0 32.0 36.0 36-37 34.252375 36.0 36.0 36.0 32.0 36.0 38-39 34.2365 36.0 36.0 36.0 32.0 36.0 40-41 34.18679669917479 36.0 36.0 36.0 32.0 36.0 42-43 34.12165541385346 36.0 36.0 36.0 32.0 36.0 44-45 34.07689422355589 36.0 36.0 36.0 32.0 36.0 46-47 34.02975743935984 36.0 36.0 36.0 32.0 36.0 48-49 34.000250125062536 36.0 36.0 36.0 32.0 36.0 50-51 34.07091045522762 36.0 36.0 36.0 32.0 36.0 52-53 33.9032016008004 36.0 36.0 36.0 32.0 36.0 54-55 33.725987993996995 36.0 36.0 36.0 27.0 36.0 56-57 33.836793396698354 36.0 36.0 36.0 32.0 36.0 58-59 33.81214017521903 36.0 36.0 36.0 29.5 36.0 60-61 33.62711163115136 36.0 36.0 36.0 27.0 36.0 62-63 33.68502754131197 36.0 36.0 36.0 27.0 36.0 64-65 33.38404708239419 36.0 36.0 36.0 27.0 36.0 66-67 33.25292565080035 36.0 34.0 36.0 27.0 36.0 68-69 33.138881925294555 36.0 32.0 36.0 24.0 36.0 70-71 33.15412590920492 36.0 32.0 36.0 27.0 36.0 72-73 33.07142807843179 36.0 34.0 36.0 27.0 36.0 74-75 33.08392080445169 36.0 32.0 36.0 27.0 36.0 76 32.280070546737214 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 3.0 25 14.0 26 15.0 27 28.0 28 51.0 29 85.0 30 154.0 31 189.0 32 331.0 33 578.0 34 1223.0 35 1327.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.55 9.625 8.4 44.425 2 25.3 8.450000000000001 42.875 23.375 3 27.275 13.925 22.0 36.8 4 32.675 20.75 17.974999999999998 28.599999999999998 5 30.55 25.374999999999996 23.025000000000002 21.05 6 25.390035228988424 29.667840966280824 24.609964771011576 20.332159033719176 7 18.75 22.975 36.525 21.75 8 19.900000000000002 21.05 33.324999999999996 25.724999999999998 9 20.974999999999998 18.8 33.575 26.650000000000002 10-11 23.775 27.3875 24.15 24.6875 12-13 25.275 21.85 25.1 27.775 14-15 25.0375 23.025000000000002 25.912499999999998 26.025 16-17 25.575 23.3625 23.974999999999998 27.0875 18-19 25.7 22.775000000000002 23.425 28.1 20-21 24.9875 24.0625 24.0125 26.937499999999996 22-23 25.525 23.625 24.15 26.700000000000003 24-25 25.15 23.35 23.8375 27.6625 26-27 25.412499999999998 23.9 24.4 26.2875 28-29 24.9125 23.525 24.375 27.187499999999996 30-31 25.4875 24.224999999999998 22.875 27.4125 32-33 25.0125 23.1125 24.85 27.025 34-35 26.1125 23.0 23.4875 27.400000000000002 36-37 25.7125 22.6 24.1125 27.575 38-39 25.912499999999998 23.3125 23.400000000000002 27.375 40-41 25.581395348837212 23.055763940985248 23.55588897224306 27.806951737934483 42-43 25.03125781445361 21.630407601900476 24.031007751937985 29.307326831707925 44-45 25.406351587896975 22.930732683170792 24.493623405851466 27.169292323080768 46-47 25.818954738684667 23.93098274568642 22.918229557389346 27.33183295823956 48-49 26.18809404702351 22.623811905952977 24.249624812406203 26.93846923461731 50-51 25.3751875937969 23.224112056028016 23.299149574787396 28.101550775387697 52-53 25.46273136568284 23.78689344672336 23.649324662331164 27.101050525262632 54-55 26.038019009504755 22.448724362181093 23.32416208104052 28.189094547273637 56-57 25.68784392196098 22.748874437218607 24.12456228114057 27.43871935967984 58-59 26.095118898623284 22.90362953692115 23.967459324155193 27.033792240300375 60-61 25.747903367129805 23.056702966579046 23.34459882338215 27.850794842909 62-63 25.51326990485729 22.8342513770656 23.99849774661993 27.653980971457187 64-65 26.784372652141247 22.551965940395693 23.64137240170298 27.02228900576008 66-67 26.221498371335507 22.500626409421198 24.417439238286143 26.860435980957153 68-69 26.197041865129105 22.524442216094258 23.802958134870895 27.475557783905742 70-71 26.097316277903186 22.284926009530974 24.47955856533735 27.13819914722849 72-73 26.220432813286358 22.672370407649723 23.20080523402114 27.90639154504278 74-75 27.065003282994088 19.43532501641497 24.96388706500328 28.535784635587657 76 28.888888888888886 0.0 32.13403880070547 38.97707231040564 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 2.0 24 2.5 25 1.0 26 1.5 27 6.5 28 6.5 29 4.0 30 10.0 31 17.5 32 23.0 33 27.0 34 37.0 35 52.0 36 64.0 37 76.0 38 84.5 39 99.0 40 111.5 41 136.5 42 161.0 43 174.0 44 185.5 45 198.5 46 206.5 47 202.0 48 190.0 49 178.5 50 182.0 51 170.5 52 161.0 53 154.5 54 137.0 55 136.0 56 149.0 57 144.5 58 135.0 59 140.5 60 140.5 61 128.5 62 117.0 63 107.0 64 111.0 65 110.5 66 92.0 67 86.5 68 86.5 69 81.0 70 71.0 71 61.5 72 54.5 73 52.0 74 50.5 75 47.0 76 44.0 77 33.5 78 21.5 79 14.5 80 13.5 81 11.5 82 6.5 83 4.5 84 3.0 85 3.0 86 2.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.65 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 39 1.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 3.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 1.0 64 0.0 65 1.0 66 2.0 67 1.0 68 0.0 69 2.0 70 0.0 71 6.0 72 14.0 73 47.0 74 225.0 75 860.0 76 2835.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.3 #Duplication Level Percentage of deduplicated Percentage of total 1 97.94450154162384 95.3 2 1.695786228160329 3.3000000000000003 3 0.2312435765673176 0.675 4 0.025693730729701953 0.1 5 0.051387461459403906 0.25 6 0.0 0.0 7 0.025693730729701953 0.17500000000000002 8 0.025693730729701953 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAGGGTTCAAATGTACATATGCTCCTCGAGCCCATGTCGGTACATTCA 8 0.2 No Hit CTCCAACAGATCAATCCAGATCAGTGAGCTGCTGTTTAGGCCTTGCCGGA 7 0.17500000000000002 No Hit CTGGCATCTTATACATATATATATGGGACTCCAACAGATCAATCCAGATC 5 0.125 No Hit GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.025 51 0.0 0.0 0.0 0.0 0.025 52 0.0 0.0 0.0 0.0 0.025 53 0.0 0.0 0.0 0.0 0.025 54 0.0 0.0 0.0 0.0 0.025 55 0.0 0.0 0.0 0.0 0.025 56 0.0 0.0 0.0 0.0 0.025 57 0.0 0.0 0.0 0.0 0.025 58 0.0 0.0 0.0 0.0 0.025 59 0.0 0.0 0.0 0.0 0.025 60 0.0 0.0 0.0 0.0 0.025 61 0.0 0.0 0.0 0.0 0.025 62 0.0 0.0 0.0 0.0 0.025 63 0.0 0.0 0.0 0.0 0.025 64 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389892 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389892_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0155 32.0 32.0 32.0 32.0 32.0 2 30.68425 32.0 32.0 32.0 32.0 32.0 3 30.5945 32.0 32.0 32.0 32.0 32.0 4 30.73375 32.0 32.0 32.0 32.0 32.0 5 30.8 32.0 32.0 32.0 32.0 32.0 6 34.047 36.0 36.0 36.0 32.0 36.0 7 34.17625 36.0 36.0 36.0 32.0 36.0 8 34.019 36.0 36.0 36.0 32.0 36.0 9 33.90175 36.0 36.0 36.0 32.0 36.0 10-11 33.854875 36.0 36.0 36.0 32.0 36.0 12-13 33.834625 36.0 36.0 36.0 32.0 36.0 14-15 33.658874999999995 36.0 36.0 36.0 29.5 36.0 16-17 33.713125000000005 36.0 36.0 36.0 29.5 36.0 18-19 33.757374999999996 36.0 36.0 36.0 32.0 36.0 20-21 33.544125 36.0 36.0 36.0 29.5 36.0 22-23 33.622625 36.0 36.0 36.0 29.5 36.0 24-25 33.46825 36.0 36.0 36.0 27.0 36.0 26-27 33.482124999999996 36.0 36.0 36.0 27.0 36.0 28-29 33.470625 36.0 36.0 36.0 27.0 36.0 30-31 33.468 36.0 36.0 36.0 29.5 36.0 32-33 33.379374999999996 36.0 36.0 36.0 27.0 36.0 34-35 33.384375 36.0 36.0 36.0 27.0 36.0 36-37 33.41725087631447 36.0 36.0 36.0 27.0 36.0 38-39 33.216324486730095 36.0 36.0 36.0 27.0 36.0 40-41 33.35345691382766 36.0 36.0 36.0 27.0 36.0 42-43 33.315631262525045 36.0 36.0 36.0 27.0 36.0 44-45 33.10470941883767 36.0 36.0 36.0 21.0 36.0 46-47 32.88712102230018 36.0 36.0 36.0 21.0 36.0 48-49 33.00876973189676 36.0 36.0 36.0 21.0 36.0 50-51 32.69869706840391 36.0 32.0 36.0 14.0 36.0 52-53 32.74517664745677 36.0 32.0 36.0 21.0 36.0 54-55 32.577173640691555 36.0 32.0 36.0 17.5 36.0 56-57 32.66562265096467 36.0 32.0 36.0 17.5 36.0 58-59 32.32915517673602 36.0 32.0 36.0 17.5 36.0 60-61 32.366304761615 36.0 32.0 36.0 14.0 36.0 62-63 32.44433299899699 36.0 32.0 36.0 17.5 36.0 64-65 32.39152244795586 36.0 32.0 36.0 17.5 36.0 66-67 32.32988023342744 36.0 32.0 36.0 14.0 36.0 68-69 31.927065026362037 36.0 32.0 36.0 14.0 36.0 70-71 31.885350442224876 36.0 32.0 36.0 14.0 36.0 72-73 31.756995447647952 36.0 32.0 36.0 14.0 36.0 74-75 31.72521355953136 36.0 32.0 36.0 14.0 36.0 76 30.632379572618618 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 1.0 9 1.0 10 2.0 11 0.0 12 0.0 13 0.0 14 1.0 15 3.0 16 2.0 17 4.0 18 0.0 19 1.0 20 5.0 21 7.0 22 7.0 23 14.0 24 31.0 25 27.0 26 55.0 27 91.0 28 108.0 29 147.0 30 197.0 31 303.0 32 442.0 33 715.0 34 1099.0 35 729.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.258517034068138 19.664328657314627 8.46693386773547 42.61022044088176 2 30.842527582748247 23.294884653961887 29.087261785356066 16.775325977933804 3 23.910866299449175 27.215823735603408 19.654481722583874 29.218828242363543 4 27.791687531296944 31.096644967451176 17.57636454682023 23.535302954431646 5 30.39559339008513 31.447170756134202 18.70305458187281 19.45418127190786 6 25.338007010515774 33.400100150225335 18.252378567851775 23.00951427140711 7 23.335002503755632 17.1256885327992 32.29844767150726 27.240861291937907 8 24.887330996494743 20.70605908863295 22.934401602403607 31.4722083124687 9 24.361542313470206 18.803204807210815 27.41612418627942 29.41912869303956 10-11 27.25338007010516 26.70255383074612 19.241362043064598 26.802704056084124 12-13 27.437954374529955 21.5968914514916 21.83504637753823 29.130107796440214 14-15 26.975169300225733 23.25056433408578 22.89942312515676 26.874843240531725 16-17 27.87460815047022 23.385579937304072 21.47962382445141 27.260188087774296 18-19 26.47685940047661 23.44161545215101 22.626363978427193 27.455161168945192 20-21 27.467972871137903 22.73298166289877 23.285606631499622 26.513438834463702 22-23 27.444834503510528 22.342026078234703 21.865596790371114 28.347542627883648 24-25 27.827940807624778 23.46375721093554 21.344369199899674 27.363932781540008 26-27 26.521139129343872 24.363317024212773 22.556768285033247 26.558775561410116 28-29 26.846394984326018 23.774294670846395 21.74294670846395 27.636363636363637 30-31 26.373212942061702 23.526460998244296 21.51993980436418 28.58038625532982 32-33 27.80285929270128 23.85252069224981 22.36017055430148 25.984449460747427 34-35 28.309929789368105 22.617853560682047 22.10381143430291 26.96840521564694 36-37 26.90909090909091 23.523510971786834 22.106583072100314 27.460815047021942 38-39 27.627288688236767 23.375971908703285 21.708051166290442 27.2886882367695 40-41 27.752696262854275 23.012289942312517 21.8459994983697 27.389014296463504 42-43 27.19518314099348 22.96788760662318 22.616658304064224 27.22027094831912 44-45 27.67185148018063 22.892624184646262 22.08981435022579 27.345709984947312 46-47 27.04804917827123 24.124952954459918 21.427675323046042 27.39932254422281 48-49 27.725504955463553 22.995859992472713 21.854221553130095 27.424413498933635 50-51 26.295970879879505 23.948788753608635 22.59319693736664 27.16204342914522 52-53 28.483632258873698 22.576194656967264 21.321961620469082 27.618211463689953 54-55 28.14498933901919 22.576194656967264 22.325348049667628 26.953467954345918 56-57 28.56784549786807 23.388512666165038 22.15951843491347 25.884123401053422 58-59 28.309700087840383 22.838499184339316 21.345212699209437 27.506588028610867 60-61 27.10503199899611 23.503576358388756 22.487137658426402 26.90425398418873 62-63 28.39754046931861 24.09336177688543 21.94754674363157 25.561551010164386 64-65 28.14814814814815 23.52793471437539 21.8706842435656 26.45323289391086 66-67 27.489639583071707 23.52128594750722 21.650131859851815 27.338942609569255 68-69 27.176781002638524 23.98542530468652 21.8117854001759 27.02600829249906 70-71 28.232189973614773 23.08078904384973 21.761527830129413 26.925493152406084 72-73 28.145904329168243 22.668181244478102 22.882746434431404 26.30316799192225 74-75 27.099799062290693 19.678499665103818 24.380442062960483 28.84125920964501 76 30.40956868430591 0.0 30.22834360275462 39.36208771293947 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.0 2 0.5 3 1.0 4 1.0 5 0.5 6 0.5 7 0.5 8 0.5 9 1.0 10 1.0 11 0.5 12 0.5 13 1.0 14 1.0 15 1.5 16 1.5 17 1.0 18 1.0 19 1.0 20 2.0 21 2.5 22 1.5 23 1.5 24 2.0 25 2.5 26 3.5 27 3.0 28 5.0 29 7.5 30 7.5 31 11.0 32 17.5 33 18.5 34 23.0 35 36.0 36 55.0 37 69.0 38 78.5 39 95.5 40 109.5 41 118.0 42 121.0 43 136.5 44 157.5 45 168.0 46 173.0 47 176.5 48 167.0 49 156.5 50 155.0 51 150.0 52 148.0 53 141.0 54 131.0 55 142.0 56 157.5 57 145.5 58 133.0 59 149.5 60 168.0 61 175.0 62 176.5 63 142.0 64 113.5 65 116.5 66 112.0 67 106.0 68 99.5 69 80.0 70 75.5 71 87.5 72 85.0 73 69.5 74 62.5 75 67.0 76 52.5 77 31.0 78 20.5 79 15.5 80 16.5 81 14.5 82 8.0 83 5.0 84 5.0 85 4.0 86 2.5 87 2.5 88 2.0 89 0.5 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 2.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.3 3 0.15 4 0.15 5 0.15 6 0.15 7 0.15 8 0.15 9 0.15 10-11 0.15 12-13 0.27499999999999997 14-15 0.325 16-17 0.3125 18-19 0.3375 20-21 0.475 22-23 0.3 24-25 0.325 26-27 0.36250000000000004 28-29 0.3125 30-31 0.325 32-33 0.325 34-35 0.3 36-37 0.1627441161742614 38-39 0.17526289434151227 40-41 0.125250501002004 42-43 0.15030060120240482 44-45 0.15030060120240482 46-47 0.13781007266349285 48-49 0.13781007266349285 50-51 0.18792282635930843 52-53 0.11275369581558506 54-55 0.11275369581558506 56-57 0.10022550739163118 58-59 0.11281022812735021 60-61 0.10028832894571893 62-63 0.08776328986960882 64-65 0.1128668171557562 66-67 0.08782936010037641 68-69 0.08787346221441124 70-71 0.05023232450081628 72-73 0.07567158531971245 74-75 0.053554692729950455 76 0.07243752263672583 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 6.0 36 0.0 37 0.0 38 0.0 39 2.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 2.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 1.0 64 0.0 65 1.0 66 2.0 67 1.0 68 0.0 69 1.0 70 1.0 71 6.0 72 21.0 73 80.0 74 279.0 75 834.0 76 2761.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.2881962187021 96.175 2 1.4052120592743995 2.75 3 0.2043944813490036 0.6 4 0.0510986203372509 0.2 5 0.02554931016862545 0.125 6 0.02554931016862545 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra Read 771306 spots for SRR11389892.sra Written 771306 spots for SRR11389892.sra Read 771304 spots for SRR11389892.sra Written 771304 spots for SRR11389892.sra SRR ids: ['SRR11389892.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d12wh8wo SRR11389892.sra spots: 15426082 blocks: [[1, 771304], [771305, 1542608], [1542609, 2313912], [2313913, 3085216], [3085217, 3856520], [3856521, 4627824], [4627825, 5399128], [5399129, 6170432], [6170433, 6941736], [6941737, 7713040], [7713041, 8484344], [8484345, 9255648], [9255649, 10026952], [10026953, 10798256], [10798257, 11569560], [11569561, 12340864], [12340865, 13112168], [13112169, 13883472], [13883473, 14654776], [14654777, 15426082]] SRR11389892 file size 2932876 SRR11389892 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389892 SRR11389892_1.fastq SRR11389892_2.fastq Input file: SRR11389892_1.fastq Paired file: SRR11389892_2.fastq trimmed: SRR11389892-trimmed-pair1.fastq, SRR11389892-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:17:43 2024 >> started Sat Dec 7 09:17:57 2024 >> done (13.182s) 15426082 read pairs processed; of these: 897 ( 0.01%) short read pairs filtered out after trimming by size control 5121 ( 0.03%) empty read pairs filtered out after trimming by size control 15420064 (99.96%) read pairs available; of these: 10285 ( 0.07%) trimmed read pairs available after processing 15409779 (99.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 11 0.00% 21 3 0.00% 22 12 0.00% 23 4 0.00% 24 13 0.00% 25 9 0.00% 26 15 0.00% 27 0 0.00% 28 18 0.00% 29 10 0.00% 30 12 0.00% 31 16 0.00% 32 14 0.00% 33 14 0.00% 34 9 0.00% 35 145 0.00% 36 188 0.00% 37 194 0.00% 38 232 0.00% 39 225 0.00% 40 258 0.00% 41 270 0.00% 42 303 0.00% 43 326 0.00% 44 354 0.00% 45 399 0.00% 46 377 0.00% 47 397 0.00% 48 451 0.00% 49 460 0.00% 50 509 0.00% 51 551 0.00% 52 626 0.00% 53 700 0.00% 54 695 0.00% 55 775 0.01% 56 790 0.01% 57 963 0.01% 58 972 0.01% 59 1021 0.01% 60 1095 0.01% 61 1118 0.01% 62 1197 0.01% 63 1335 0.01% 64 1358 0.01% 65 1509 0.01% 66 1654 0.01% 67 1760 0.01% 68 1821 0.01% 69 2074 0.01% 70 2573 0.02% 71 3789 0.02% 72 13585 0.09% 73 118129 0.77% 74 1018152 6.60% 75 6602309 42.82% 76 7634263 49.51% 15420064 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=24 prefix-density=0.84 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=6.75 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=1.6 sequence=ATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTTGAGCTGACCCACTTGCGCACCTCATCGTCGTACACCCGGGCACGCAGCG criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=7 prefix-density=0.71 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.21 sequence-density-rank=22 fanout-score=99.22 fanout-score-rank=1 prefix-density=1.20 prefix-fanout=17.8 sequence=GCCGCCGCCACCCTCCCTTCCATGGTCGCCGCCGCTCCCCGGAGCAGCAGCCGGCTGGTGGTGCGCGCATCGGCCGTAGGAGGGTTCCGGAAGGCGGCGGGGG SRR11389892 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:18:24 Started mapping on | Dec 07 09:18:24 Finished on | Dec 07 09:19:27 Mapping speed, Million of reads per hour | 881.15 Number of input reads | 15420064 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 14375895 Uniquely mapped reads % | 93.23% Average mapped length | 150.35 Number of splices: Total | 7271465 Number of splices: Annotated (sjdb) | 6963669 Number of splices: GT/AG | 7167636 Number of splices: GC/AG | 93387 Number of splices: AT/AC | 2066 Number of splices: Non-canonical | 8376 Mismatch rate per base, % | 0.83% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 497933 % of reads mapped to multiple loci | 3.23% Number of reads mapped to too many loci | 23889 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 546239 546239 546239 N_multimapping 497933 497933 497933 N_noFeature 378387 14018574 459811 N_ambiguous 364022 1543 90362 UnstrandedReadsAssigned:13633486 PositiveStrandReadsAssigned:355778 NegativeStrandReadsAssigned:13825722 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389892 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389892-trimmed-pair1.fastq SRR11389892-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,420,064 reads, 14,132,939 reads pseudoaligned [quant] estimated average fragment length: 218.165 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52973 SRR11389892.ke.tsv 35125 SRR11389892.se.tsv 88098 total ==> SRR11389892.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 719.002 1.78946 0.22209 PNS24247 1044 826.835 32.104 3.4648 PNS24249 1928 1710.83 142.292 7.42179 PNS24246 1044 826.835 32.104 3.4648 PNS24248 1044 826.835 32.104 3.4648 PNS24244 1471 1253.83 32.6068 2.32062 PNS24243 293 96.0289 0 0 KQK14069 1603 1385.83 5209.1 335.42 KQK14071 474 259.269 310.982 107.034 ==> SRR11389892.se.tsv <== BRADI_1g14170v3 5771 BRADI_1g53295v3 15 BRADI_1g59795v3 204 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 96 BRADI_1g74790v3 336 BRADI_1g09890v3 0 BRADI_1g77505v3 246 BRADI_1g48960v3 0 SRR11389892 completed mapping pipeline successfully