Starting /dee2/code/volunteer_pipeline.sh SRR11389893 current disk space = 1544197541888 free memory = 1602318380 SRR11389893 SRAfilesize 3ab13c77967256e86dde42372f158989 SRR11389893.sra SRR11389893.sra file validated SRR11389893 is paired end SRR11389893 is conventional basespace SRR11389893 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389893_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.278 32.0 32.0 32.0 32.0 32.0 2 31.50275 32.0 32.0 32.0 32.0 32.0 3 31.31175 32.0 32.0 32.0 32.0 32.0 4 31.32675 32.0 32.0 32.0 32.0 32.0 5 31.4335 32.0 32.0 32.0 32.0 32.0 6 34.52325 36.0 36.0 36.0 32.0 36.0 7 34.595 36.0 36.0 36.0 32.0 36.0 8 34.6465 36.0 36.0 36.0 32.0 36.0 9 34.5205 36.0 36.0 36.0 32.0 36.0 10-11 34.571875000000006 36.0 36.0 36.0 32.0 36.0 12-13 34.733625 36.0 36.0 36.0 32.0 36.0 14-15 34.537625000000006 36.0 36.0 36.0 32.0 36.0 16-17 34.5085 36.0 36.0 36.0 32.0 36.0 18-19 34.586749999999995 36.0 36.0 36.0 32.0 36.0 20-21 34.5235 36.0 36.0 36.0 32.0 36.0 22-23 34.480125 36.0 36.0 36.0 32.0 36.0 24-25 34.492875 36.0 36.0 36.0 32.0 36.0 26-27 34.209625 36.0 36.0 36.0 32.0 36.0 28-29 34.258375 36.0 36.0 36.0 32.0 36.0 30-31 34.116625 36.0 36.0 36.0 32.0 36.0 32-33 34.166125 36.0 36.0 36.0 32.0 36.0 34-35 34.20975 36.0 36.0 36.0 32.0 36.0 36-37 34.018879719929984 36.0 36.0 36.0 32.0 36.0 38-39 34.03813453363341 36.0 36.0 36.0 32.0 36.0 40-41 34.03713428357089 36.0 36.0 36.0 32.0 36.0 42-43 34.06090545272637 36.0 36.0 36.0 32.0 36.0 44-45 34.02226113056528 36.0 36.0 36.0 32.0 36.0 46-47 34.058279139569784 36.0 36.0 36.0 32.0 36.0 48-49 33.96297554581644 36.0 36.0 36.0 32.0 36.0 50-51 33.85526644983737 36.0 36.0 36.0 32.0 36.0 52-53 33.88754065549162 36.0 36.0 36.0 32.0 36.0 54-55 33.63113113113113 36.0 36.0 36.0 27.0 36.0 56-57 33.89266998183695 36.0 36.0 36.0 32.0 36.0 58-59 33.75960389835045 36.0 36.0 36.0 29.5 36.0 60-61 33.30030067652217 36.0 36.0 36.0 27.0 36.0 62-63 33.431895858975594 36.0 36.0 36.0 27.0 36.0 64-65 33.28284854563691 36.0 36.0 36.0 27.0 36.0 66-67 33.13688978900584 36.0 34.0 36.0 24.0 36.0 68-69 32.955806200724645 36.0 32.0 36.0 24.0 36.0 70-71 32.969001004016064 36.0 32.0 36.0 24.0 36.0 72-73 32.9640469053971 36.0 34.0 36.0 21.0 36.0 74-75 33.056309931506846 36.0 32.0 36.0 27.0 36.0 76 32.16282369634622 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 6.0 25 10.0 26 19.0 27 36.0 28 66.0 29 88.0 30 152.0 31 244.0 32 323.0 33 575.0 34 1307.0 35 1173.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.73468367091773 9.502375593898476 10.227556889222306 41.53538384596149 2 29.03225806451613 10.127531882970743 37.109277319329834 23.730932733183295 3 28.632158039509875 15.628907226806701 19.02975743935984 36.70917729432358 4 33.10827706926732 22.005501375343837 16.504126031507877 28.382095523880967 5 30.9827456864216 25.506376594148538 22.005501375343837 21.50537634408602 6 25.326305220883533 29.24196787148594 22.79116465863454 22.640562248995984 7 20.38009502375594 22.405601400350086 34.25856464116029 22.95573893473368 8 21.005251312828207 22.305576394098527 29.882470617654416 26.806701675418854 9 20.730182545636406 18.6046511627907 33.25831457864466 27.406851712928233 10-11 24.99374843710928 26.806701675418854 22.655663915978995 25.543885971492873 12-13 25.29382345586397 21.342835708927232 24.756189047261813 28.60715178794699 14-15 25.18129532383096 24.643660915228807 23.50587646911728 26.669167291822955 16-17 25.85646411602901 23.080770192548137 23.0432608152038 28.019504876219052 18-19 25.943985996499126 23.118279569892472 22.9057264316079 28.032008002000502 20-21 26.106526631657918 23.293323330832706 24.168542135533883 26.431607901975497 22-23 26.19404851212803 22.918229557389346 23.605901475368842 27.28182045511378 24-25 26.019004751187797 22.29307326831708 24.06851712928232 27.619404851212803 26-27 25.331332833208304 23.1807951987997 23.843460865216304 27.644411102775695 28-29 26.84421105276319 22.95573893473368 23.23080770192548 26.969242310577645 30-31 25.78144536134033 23.055763940985248 23.69342335583896 27.46936734183546 32-33 25.331332833208304 22.655663915978995 23.980995248812203 28.032008002000502 34-35 26.356589147286826 22.193048262065513 23.755938984746187 27.694423605901473 36-37 26.506626656664167 23.055763940985248 22.31807951987997 28.119529882470616 38-39 25.593898474618655 22.080520130032507 24.406101525381345 27.91947986996749 40-41 27.394348587146787 22.718179544886222 23.25581395348837 26.63165791447862 42-43 26.32566283141571 22.098549274637318 23.699349674837418 27.876438219109556 44-45 26.80090045022511 22.198599299649825 23.88694347173587 27.113556778389196 46-47 27.37618809404702 22.873936968484244 23.499249624812407 26.25062531265633 48-49 26.091307066916826 22.689180737961227 22.82676672920575 28.392745465916196 50-51 26.64498373780335 22.91718789091819 22.504378283712782 27.933450087565674 52-53 26.80760570427821 22.504378283712782 23.092319239429575 27.595696772579437 54-55 26.163663663663662 22.57257257257257 22.56006006006006 28.703703703703702 56-57 26.311834690043835 22.442078897933627 23.231058234189106 28.01502817783344 58-59 25.591882750845546 24.001002129525244 22.710760365777276 27.69635475385194 60-61 26.058631921824105 22.613380105236782 22.939113004259585 28.388874968679527 62-63 27.246522120566485 22.471487655094624 22.947737811755857 27.334252412583034 64-65 27.670511534603808 22.642928786359075 22.956369107321965 26.730190571715145 66-67 27.485893416927897 22.13166144200627 23.02194357366771 27.36050156739812 68-69 27.54986827248777 21.94203989461799 22.782586877430685 27.725504955463553 70-71 26.982931726907633 22.602911646586346 22.201305220883537 28.21285140562249 72-73 26.519823788546255 21.85022026431718 23.17180616740088 28.45814977973568 74-75 27.773365104580357 19.062748212867355 23.722531109346043 29.441355573206245 76 30.43632493792125 0.0 31.713373536715146 37.850301525363605 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.5 21 2.5 22 2.5 23 3.0 24 4.0 25 4.5 26 5.0 27 4.0 28 4.5 29 7.0 30 7.5 31 16.0 32 26.0 33 28.5 34 31.5 35 45.5 36 65.0 37 65.5 38 69.5 39 106.5 40 136.0 41 134.0 42 128.5 43 146.0 44 166.5 45 160.5 46 153.0 47 156.0 48 154.5 49 154.0 50 158.0 51 158.0 52 160.0 53 154.0 54 142.5 55 142.5 56 144.5 57 147.5 58 150.0 59 149.5 60 149.5 61 140.0 62 128.0 63 124.0 64 128.0 65 128.0 66 116.0 67 111.5 68 117.0 69 103.5 70 85.0 71 78.5 72 71.5 73 70.5 74 55.0 75 37.0 76 37.0 77 32.5 78 24.5 79 19.5 80 13.0 81 9.0 82 6.5 83 4.5 84 3.5 85 1.5 86 2.0 87 3.0 88 1.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.4 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 3.0 56 1.0 57 0.0 58 1.0 59 0.0 60 0.0 61 1.0 62 1.0 63 1.0 64 0.0 65 0.0 66 1.0 67 0.0 68 3.0 69 0.0 70 0.0 71 4.0 72 15.0 73 61.0 74 254.0 75 831.0 76 2819.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.00256081946223 95.675 2 1.6901408450704223 3.3000000000000003 3 0.20486555697823303 0.6 4 0.07682458386683738 0.3 5 0.02560819462227913 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389893 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389893_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.021 32.0 32.0 32.0 32.0 32.0 2 30.711 32.0 32.0 32.0 32.0 32.0 3 30.7415 32.0 32.0 32.0 32.0 32.0 4 30.84325 32.0 32.0 32.0 32.0 32.0 5 30.7865 32.0 32.0 32.0 32.0 32.0 6 33.80525 36.0 36.0 36.0 32.0 36.0 7 34.1725 36.0 36.0 36.0 32.0 36.0 8 33.953 36.0 36.0 36.0 32.0 36.0 9 34.13925 36.0 36.0 36.0 32.0 36.0 10-11 33.879999999999995 36.0 36.0 36.0 32.0 36.0 12-13 33.876625000000004 36.0 36.0 36.0 32.0 36.0 14-15 33.817499999999995 36.0 36.0 36.0 29.5 36.0 16-17 33.62125 36.0 36.0 36.0 29.5 36.0 18-19 33.795874999999995 36.0 36.0 36.0 32.0 36.0 20-21 33.699375 36.0 36.0 36.0 32.0 36.0 22-23 33.673125 36.0 36.0 36.0 29.5 36.0 24-25 33.621125 36.0 36.0 36.0 27.0 36.0 26-27 33.475875 36.0 36.0 36.0 27.0 36.0 28-29 33.512 36.0 36.0 36.0 27.0 36.0 30-31 33.600875 36.0 36.0 36.0 29.5 36.0 32-33 33.430625 36.0 36.0 36.0 27.0 36.0 34-35 33.503375 36.0 36.0 36.0 27.0 36.0 36-37 33.481611208406306 36.0 36.0 36.0 27.0 36.0 38-39 33.425694270703026 36.0 36.0 36.0 27.0 36.0 40-41 33.3501376032024 36.0 36.0 36.0 27.0 36.0 42-43 33.45457957957958 36.0 36.0 36.0 27.0 36.0 44-45 33.092967967967965 36.0 36.0 36.0 21.0 36.0 46-47 33.162287287287285 36.0 36.0 36.0 21.0 36.0 48-49 33.02526180748959 36.0 36.0 36.0 21.0 36.0 50-51 32.691489361702125 36.0 32.0 36.0 14.0 36.0 52-53 32.75006257822278 36.0 32.0 36.0 21.0 36.0 54-55 32.73835753630446 36.0 32.0 36.0 21.0 36.0 56-57 32.74063299692479 36.0 32.0 36.0 17.5 36.0 58-59 32.37736177369973 36.0 32.0 36.0 14.0 36.0 60-61 32.50639257959388 36.0 32.0 36.0 21.0 36.0 62-63 32.42552657973921 36.0 32.0 36.0 17.5 36.0 64-65 32.33947830448959 36.0 32.0 36.0 14.0 36.0 66-67 32.30441414526967 36.0 32.0 36.0 14.0 36.0 68-69 31.950453848071565 36.0 32.0 36.0 17.5 36.0 70-71 31.871226424616175 36.0 32.0 36.0 14.0 36.0 72-73 31.92030734540633 36.0 32.0 36.0 14.0 36.0 74-75 31.81347923837596 36.0 32.0 36.0 14.0 36.0 76 30.497134670487107 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 4.0 17 2.0 18 1.0 19 2.0 20 1.0 21 8.0 22 16.0 23 14.0 24 26.0 25 36.0 26 71.0 27 78.0 28 93.0 29 158.0 30 180.0 31 281.0 32 443.0 33 684.0 34 1143.0 35 753.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.27420565424068 19.389542156617463 9.507130347760821 38.82912184138104 2 31.23904881101377 22.95369211514393 27.734668335419272 18.072590738423028 3 25.769326995246434 26.069552164123095 18.16362271703778 29.997498123592692 4 28.096072054040533 31.17338003502627 15.836877658243683 24.893670252689517 5 31.74881160870653 30.79809857393045 17.08781586189642 20.365273955466602 6 25.769326995246434 31.523642732049034 18.463847885914436 24.243182386790092 7 22.792094070552913 15.686765073805354 32.12409306980235 29.39704778583938 8 24.49337002752064 20.290217663247436 23.317488116087066 31.898924193144857 9 24.26820115086315 20.690517888416313 23.792844633475106 31.248436327245432 10-11 28.137119979982483 25.70999624671588 18.028274740397848 28.12460903290379 12-13 28.003003003003002 21.77177177177177 20.87087087087087 29.354354354354356 14-15 27.426424546023792 23.080776455854725 21.991233562930496 27.501565435190983 16-17 28.904195366311836 21.991233562930496 21.314965560425797 27.78960551033187 18-19 27.871727420769133 22.585494175122133 21.53325817361894 28.00952023048979 20-21 27.92679869641514 22.963148658811733 21.772374028578593 27.337678616194534 22-23 28.668002003004506 23.535302954431646 21.13169754631948 26.664997496244368 24-25 27.347858752817427 23.26571500125219 21.424993739043327 27.96143250688705 26-27 28.202880400751408 23.055729492799 21.089542892924232 27.65184721352536 28-29 27.391086629944915 22.684026039058587 21.557336004006007 28.367551326990487 30-31 27.37514081862561 22.731255476279884 21.917636750531983 27.975966954562526 32-33 27.476518472135254 23.469004383218532 21.227301189730746 27.827175954915468 34-35 28.09917355371901 23.541197094916104 21.57525669922364 26.784372652141247 36-37 28.151207910877456 22.418325197146075 21.104018024784075 28.32644886719239 38-39 28.41933867735471 23.171342685370742 22.019038076152306 26.390280561122243 40-41 29.0738423028786 21.46433041301627 22.090112640801003 27.37171464330413 42-43 27.83272818329786 23.600851383498185 21.572555402529108 26.993865030674847 44-45 28.027551659361304 22.492172824045085 21.728240450845334 27.752035065748277 46-47 28.558908225867036 22.336296481782895 20.921497433329158 28.18329785902091 48-49 27.896780658900163 22.435174746335964 21.55831141174997 28.1097331830139 50-51 28.79699248120301 22.982456140350877 20.413533834586467 27.807017543859647 52-53 28.566061365059486 22.567313713212272 21.302442078897936 27.56418284283031 54-55 27.742985971943888 23.196392785571142 21.367735470941884 27.692885771543086 56-57 28.231164598219884 22.95349128745142 21.44916635326564 27.366177761063053 58-59 28.229245046400802 22.54828191622774 21.582643591672937 27.63982944569852 60-61 27.915726109857037 22.736393278154 21.156257837973413 28.191622774015553 62-63 28.40837827668381 22.287721058572682 22.25009406747774 27.053806597265773 64-65 27.870498180449243 22.574978039904632 21.784414606600578 27.770109173045554 66-67 28.64132480240873 22.30585873792498 21.364947936268976 27.687868523397313 68-69 28.93184385590561 22.44257562445086 21.07443203213255 27.551148487510986 70-71 28.51400577816857 22.534857429971108 21.529958547921115 27.421178243939202 72-73 27.605349482715113 22.243250063083522 20.539994953318192 29.61140550088317 74-75 29.079052435453818 19.48363055629492 23.063614586105935 28.373702422145332 76 30.02508061626657 0.0 29.666786098172697 40.30813328556073 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.5 23 3.5 24 3.0 25 2.0 26 3.5 27 6.5 28 8.5 29 7.0 30 5.0 31 5.5 32 11.0 33 16.0 34 23.5 35 39.5 36 45.0 37 44.0 38 51.5 39 76.5 40 102.0 41 120.0 42 129.5 43 128.0 44 141.0 45 144.0 46 139.5 47 154.0 48 162.5 49 140.0 50 124.0 51 136.5 52 140.0 53 137.0 54 135.5 55 140.0 56 149.5 57 155.5 58 154.5 59 163.5 60 183.0 61 169.0 62 152.5 63 151.0 64 146.0 65 131.0 66 139.5 67 160.0 68 148.5 69 104.0 70 75.5 71 87.0 72 89.5 73 81.0 74 69.0 75 62.5 76 51.5 77 34.5 78 28.5 79 26.5 80 18.0 81 10.5 82 7.5 83 5.5 84 5.0 85 3.5 86 1.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 4.5 100 9.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.125 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.08750000000000001 12-13 0.1 14-15 0.1875 16-17 0.1875 18-19 0.21250000000000002 20-21 0.27499999999999997 22-23 0.15 24-25 0.17500000000000002 26-27 0.1875 28-29 0.15 30-31 0.13749999999999998 32-33 0.1875 34-35 0.17500000000000002 36-37 0.06254691018263697 38-39 0.12509382036527394 40-41 0.05003752814610958 42-43 0.06256256256256257 44-45 0.08758758758758758 46-47 0.06256256256256257 48-49 0.10011262670504316 50-51 0.1251564455569462 52-53 0.0625782227784731 54-55 0.050075112669003496 56-57 0.05011903270266884 58-59 0.06266449429753103 60-61 0.0501378791677112 62-63 0.037612838515546636 64-65 0.06270378730875345 66-67 0.02508466072996363 68-69 0.025097251850922327 70-71 0.02511616225040814 72-73 0.037835792659856225 74-75 0.026609898882384245 76 0.03581661891117478 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 3.0 56 1.0 57 0.0 58 1.0 59 0.0 60 0.0 61 1.0 62 0.0 63 1.0 64 0.0 65 0.0 66 1.0 67 0.0 68 3.0 69 0.0 70 3.0 71 6.0 72 19.0 73 70.0 74 254.0 75 839.0 76 2792.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.1296438636946 95.75 2 1.5372790161414296 3.0 3 0.23059185242121444 0.675 4 0.05124263387138099 0.2 5 0.025621316935690495 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025621316935690495 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit GGCAGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTGGA 20 0.00598683 53.490387 68 >>END_MODULE Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra Read 1043031 spots for SRR11389893.sra Written 1043031 spots for SRR11389893.sra Read 1043026 spots for SRR11389893.sra Written 1043026 spots for SRR11389893.sra SRR ids: ['SRR11389893.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ud19fpo0 SRR11389893.sra spots: 20860525 blocks: [[1, 1043026], [1043027, 2086052], [2086053, 3129078], [3129079, 4172104], [4172105, 5215130], [5215131, 6258156], [6258157, 7301182], [7301183, 8344208], [8344209, 9387234], [9387235, 10430260], [10430261, 11473286], [11473287, 12516312], [12516313, 13559338], [13559339, 14602364], [14602365, 15645390], [15645391, 16688416], [16688417, 17731442], [17731443, 18774468], [18774469, 19817494], [19817495, 20860525]] SRR11389893 file size 3973959 SRR11389893 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389893 SRR11389893_1.fastq SRR11389893_2.fastq Input file: SRR11389893_1.fastq Paired file: SRR11389893_2.fastq trimmed: SRR11389893-trimmed-pair1.fastq, SRR11389893-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:18:49 2024 >> started Sat Dec 7 09:19:06 2024 >> done (16.449s) 20860525 read pairs processed; of these: 1266 ( 0.01%) short read pairs filtered out after trimming by size control 12503 ( 0.06%) empty read pairs filtered out after trimming by size control 20846756 (99.93%) read pairs available; of these: 6666 ( 0.03%) trimmed read pairs available after processing 20840090 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 4 0.00% 21 2 0.00% 22 11 0.00% 23 3 0.00% 24 9 0.00% 25 12 0.00% 26 11 0.00% 27 11 0.00% 28 13 0.00% 29 15 0.00% 30 11 0.00% 31 5 0.00% 32 8 0.00% 33 19 0.00% 34 23 0.00% 35 219 0.00% 36 207 0.00% 37 229 0.00% 38 270 0.00% 39 290 0.00% 40 326 0.00% 41 430 0.00% 42 417 0.00% 43 482 0.00% 44 470 0.00% 45 510 0.00% 46 497 0.00% 47 557 0.00% 48 606 0.00% 49 613 0.00% 50 667 0.00% 51 723 0.00% 52 789 0.00% 53 873 0.00% 54 847 0.00% 55 987 0.00% 56 1046 0.01% 57 1176 0.01% 58 1255 0.01% 59 1285 0.01% 60 1400 0.01% 61 1451 0.01% 62 1564 0.01% 63 1756 0.01% 64 1834 0.01% 65 1968 0.01% 66 2084 0.01% 67 2300 0.01% 68 2365 0.01% 69 2663 0.01% 70 3401 0.02% 71 5077 0.02% 72 19603 0.09% 73 157978 0.76% 74 1319830 6.33% 75 8808714 42.25% 76 10496836 50.35% 20846756 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=18 prefix-density=0.79 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=11.21 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=3.0 sequence=TTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGA criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.82 fanout-score-rank=14 prefix-density=0.73 prefix-fanout=3.0 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.27 sequence-density-rank=15 fanout-score=61.48 fanout-score-rank=1 prefix-density=1.23 prefix-fanout=13.5 sequence=GCCGCCGCCACCCT SRR11389893 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:19:31 Started mapping on | Dec 07 09:19:31 Finished on | Dec 07 09:20:49 Mapping speed, Million of reads per hour | 962.16 Number of input reads | 20846756 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 19011929 Uniquely mapped reads % | 91.20% Average mapped length | 150.41 Number of splices: Total | 8141008 Number of splices: Annotated (sjdb) | 7824050 Number of splices: GT/AG | 8034557 Number of splices: GC/AG | 94720 Number of splices: AT/AC | 2022 Number of splices: Non-canonical | 9709 Mismatch rate per base, % | 0.82% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1065292 % of reads mapped to multiple loci | 5.11% Number of reads mapped to too many loci | 56765 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.50% % of reads unmapped: other | 0.92% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 769540 769540 769540 N_multimapping 1065292 1065292 1065292 N_noFeature 404796 18569867 514811 N_ambiguous 451301 1682 124808 UnstrandedReadsAssigned:18155832 PositiveStrandReadsAssigned:440380 NegativeStrandReadsAssigned:18372310 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389893 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389893-trimmed-pair1.fastq SRR11389893-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,846,756 reads, 19,168,537 reads pseudoaligned [quant] estimated average fragment length: 223.583 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,113 rounds 52973 SRR11389893.ke.tsv 35125 SRR11389893.se.tsv 88098 total ==> SRR11389893.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 713.564 40.4617 3.72237 PNS24247 1044 821.417 6.92003 0.553035 PNS24249 1928 1705.42 122.855 4.72901 PNS24246 1044 821.417 6.92003 0.553035 PNS24248 1044 821.417 6.92003 0.553035 PNS24244 1471 1248.42 8.92322 0.469213 PNS24243 293 93.9738 0 0 KQK14069 1603 1380.42 57.0405 2.71257 KQK14071 474 254.574 6.14787 1.58533 ==> SRR11389893.se.tsv <== BRADI_1g14170v3 68 BRADI_1g53295v3 13 BRADI_1g59795v3 209 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 133 BRADI_1g74790v3 137 BRADI_1g09890v3 0 BRADI_1g77505v3 173 BRADI_1g48960v3 0 SRR11389893 completed mapping pipeline successfully