Starting /dee2/code/volunteer_pipeline.sh SRR11389894 current disk space = 1544232886272 free memory = 1601453760 SRR11389894 SRAfilesize 721f2401fa9e99b2c87a85750446d79a SRR11389894.sra SRR11389894.sra file validated SRR11389894 is paired end SRR11389894 is conventional basespace SRR11389894 read1 length is 40-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389894_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 40-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.41525 32.0 32.0 32.0 32.0 32.0 2 31.522 32.0 32.0 32.0 32.0 32.0 3 31.33625 32.0 32.0 32.0 32.0 32.0 4 31.45175 32.0 32.0 32.0 32.0 32.0 5 31.3845 32.0 32.0 32.0 32.0 32.0 6 34.497 36.0 36.0 36.0 32.0 36.0 7 34.55525 36.0 36.0 36.0 32.0 36.0 8 34.5625 36.0 36.0 36.0 32.0 36.0 9 34.6855 36.0 36.0 36.0 32.0 36.0 10-11 34.5945 36.0 36.0 36.0 32.0 36.0 12-13 34.5985 36.0 36.0 36.0 32.0 36.0 14-15 34.579 36.0 36.0 36.0 32.0 36.0 16-17 34.558125000000004 36.0 36.0 36.0 32.0 36.0 18-19 34.677125000000004 36.0 36.0 36.0 32.0 36.0 20-21 34.598749999999995 36.0 36.0 36.0 32.0 36.0 22-23 34.648125 36.0 36.0 36.0 32.0 36.0 24-25 34.494 36.0 36.0 36.0 32.0 36.0 26-27 34.290125 36.0 36.0 36.0 32.0 36.0 28-29 34.29025 36.0 36.0 36.0 32.0 36.0 30-31 34.19975 36.0 36.0 36.0 32.0 36.0 32-33 34.221875 36.0 36.0 36.0 32.0 36.0 34-35 34.364875 36.0 36.0 36.0 32.0 36.0 36-37 34.158375 36.0 36.0 36.0 32.0 36.0 38-39 33.968625 36.0 36.0 36.0 32.0 36.0 40-41 33.968992029257315 36.0 36.0 36.0 32.0 36.0 42-43 34.05801450362591 36.0 36.0 36.0 32.0 36.0 44-45 34.01025256314078 36.0 36.0 36.0 32.0 36.0 46-47 33.91922980745186 36.0 36.0 36.0 32.0 36.0 48-49 33.88622155538884 36.0 36.0 36.0 32.0 36.0 50-51 33.798449612403104 36.0 36.0 36.0 32.0 36.0 52-53 33.814328582145535 36.0 36.0 36.0 32.0 36.0 54-55 33.630782695673915 36.0 36.0 36.0 27.0 36.0 56-57 33.717429357339334 36.0 36.0 36.0 32.0 36.0 58-59 33.78069517379345 36.0 36.0 36.0 32.0 36.0 60-61 33.347711927982 36.0 36.0 36.0 24.0 36.0 62-63 33.40578353692975 36.0 36.0 36.0 27.0 36.0 64-65 33.233241620810404 36.0 36.0 36.0 27.0 36.0 66-67 33.167821460780445 36.0 34.0 36.0 27.0 36.0 68-69 32.81043543543544 36.0 32.0 36.0 20.5 36.0 70-71 32.90382742461901 36.0 32.0 36.0 24.0 36.0 72-73 33.02813538370814 36.0 32.0 36.0 21.0 36.0 74-75 32.74721783128932 36.0 32.0 36.0 21.0 36.0 76 32.09023354564756 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 7.0 25 10.0 26 16.0 27 35.0 28 45.0 29 92.0 30 152.0 31 227.0 32 375.0 33 616.0 34 1256.0 35 1164.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.325 9.925 10.025 39.725 2 28.625 11.275 33.725 26.375 3 28.15 16.35 19.75 35.75 4 32.824999999999996 23.175 17.0 27.0 5 30.675 26.625 21.55 21.15 6 25.867269984917048 29.914529914529915 22.021116138763198 22.197083961789843 7 20.275000000000002 23.05 34.075 22.6 8 21.5 20.974999999999998 30.075000000000003 27.450000000000003 9 21.375 18.475 33.575 26.575 10-11 25.7125 27.237499999999997 21.45 25.6 12-13 25.7875 22.2125 24.0625 27.9375 14-15 25.974999999999998 22.7625 24.7875 26.474999999999998 16-17 26.450000000000003 23.150000000000002 23.35 27.05 18-19 26.075 22.8 24.625 26.5 20-21 26.8 23.0 23.4375 26.7625 22-23 26.224999999999998 23.075000000000003 23.825 26.875 24-25 26.450000000000003 22.95 23.5875 27.0125 26-27 26.4125 23.6125 22.7375 27.237499999999997 28-29 26.6 23.225 22.325 27.85 30-31 26.5625 23.3625 23.275000000000002 26.8 32-33 25.4875 23.474999999999998 23.3 27.737499999999997 34-35 26.375 21.975 24.15 27.500000000000004 36-37 26.200000000000003 22.925 23.825 27.05 38-39 27.400000000000002 22.5125 23.225 26.8625 40-41 26.715839479934996 23.1278909863733 23.1278909863733 27.028378547318415 42-43 26.081520380095025 22.58064516129032 23.58089522380595 27.7569392348087 44-45 26.219054763690924 23.34333583395849 23.55588897224306 26.881720430107524 46-47 26.59414853713428 23.193298324581146 22.58064516129032 27.631907976994246 48-49 25.64391097774444 22.518129532383096 22.73068267066767 29.107276819204802 50-51 26.056514128532132 23.118279569892472 23.355838959739934 27.46936734183546 52-53 26.93173293323331 23.78094523630908 21.930482620655166 27.35683920980245 54-55 26.731682920730183 22.53063265816454 23.330832708177045 27.406851712928233 56-57 26.78169542385596 22.61815453863466 23.543385846461614 27.056764191047762 58-59 26.581645411352838 22.780695173793447 23.58089522380595 27.056764191047762 60-61 26.569142285571395 22.53063265816454 22.405601400350086 28.49462365591398 62-63 27.11016631236714 21.30799049643616 23.571339252219584 28.010503938977116 64-65 26.413206603301653 22.56128064032016 22.848924462231114 28.176588294147077 66-67 26.80760570427821 22.004003002251686 23.067300475356518 28.121090818113586 68-69 26.58908908908909 22.785285285285287 23.035535535535537 27.59009009009009 70-71 27.315973960941413 23.172258387581373 22.421131697546322 27.090635953930896 72-73 26.242469879518072 22.163654618473895 23.581827309236946 28.012048192771083 74-75 27.441121989944428 19.11881450119079 24.252447737496695 29.187615771368087 76 30.36093418259023 0.0 29.016277423920734 40.62278839348903 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.5 26 2.0 27 5.0 28 9.0 29 10.0 30 10.5 31 11.5 32 20.0 33 32.5 34 35.0 35 42.5 36 57.5 37 70.5 38 84.0 39 101.5 40 123.0 41 149.0 42 167.0 43 171.0 44 175.5 45 186.5 46 184.0 47 170.0 48 156.0 49 152.5 50 155.5 51 147.0 52 137.5 53 130.5 54 129.5 55 118.0 56 112.0 57 126.5 58 134.0 59 132.5 60 147.5 61 144.0 62 122.0 63 120.0 64 139.0 65 139.0 66 120.5 67 120.0 68 115.0 69 97.5 70 83.5 71 75.5 72 64.5 73 64.5 74 61.0 75 50.0 76 42.5 77 38.0 78 27.5 79 18.5 80 15.5 81 9.0 82 7.0 83 6.0 84 4.0 85 3.0 86 3.5 87 3.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5499999999999999 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 0.0 66 2.0 67 0.0 68 0.0 69 0.0 70 4.0 71 2.0 72 12.0 73 63.0 74 272.0 75 817.0 76 2826.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.55329949238578 97.075 2 1.3705583756345179 2.7 3 0.07614213197969542 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389894 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389894_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9295 32.0 32.0 32.0 32.0 32.0 2 30.574 32.0 32.0 32.0 32.0 32.0 3 30.6325 32.0 32.0 32.0 32.0 32.0 4 30.59075 32.0 32.0 32.0 32.0 32.0 5 30.693 32.0 32.0 32.0 32.0 32.0 6 33.7775 36.0 36.0 36.0 32.0 36.0 7 34.1475 36.0 36.0 36.0 32.0 36.0 8 33.8055 36.0 36.0 36.0 32.0 36.0 9 33.86875 36.0 36.0 36.0 32.0 36.0 10-11 33.797124999999994 36.0 36.0 36.0 32.0 36.0 12-13 33.754375 36.0 36.0 36.0 32.0 36.0 14-15 33.46925 36.0 36.0 36.0 29.5 36.0 16-17 33.52525 36.0 36.0 36.0 29.5 36.0 18-19 33.754625 36.0 36.0 36.0 32.0 36.0 20-21 33.407375 36.0 36.0 36.0 27.0 36.0 22-23 33.464375000000004 36.0 36.0 36.0 29.5 36.0 24-25 33.380125 36.0 36.0 36.0 27.0 36.0 26-27 33.403499999999994 36.0 36.0 36.0 27.0 36.0 28-29 33.366875 36.0 36.0 36.0 27.0 36.0 30-31 33.291875000000005 36.0 36.0 36.0 27.0 36.0 32-33 33.200874999999996 36.0 36.0 36.0 20.5 36.0 34-35 33.388625000000005 36.0 36.0 36.0 27.0 36.0 36-37 33.44994994994995 36.0 36.0 36.0 27.0 36.0 38-39 33.192692692692695 36.0 36.0 36.0 24.0 36.0 40-41 33.29322656407033 36.0 36.0 36.0 27.0 36.0 42-43 33.09664496745118 36.0 36.0 36.0 17.5 36.0 44-45 32.83224837255884 36.0 36.0 36.0 17.5 36.0 46-47 32.912471825694965 36.0 36.0 36.0 21.0 36.0 48-49 32.81768094164788 36.0 36.0 36.0 17.5 36.0 50-51 32.53719008264463 36.0 32.0 36.0 14.0 36.0 52-53 32.63623841723015 36.0 32.0 36.0 17.5 36.0 54-55 32.501878287002256 36.0 32.0 36.0 17.5 36.0 56-57 32.579263711495116 36.0 32.0 36.0 17.5 36.0 58-59 32.19171049336339 36.0 32.0 36.0 14.0 36.0 60-61 32.16867017280241 36.0 32.0 36.0 17.5 36.0 62-63 32.24984140582693 36.0 32.0 36.0 14.0 36.0 64-65 32.239353707414836 36.0 32.0 36.0 14.0 36.0 66-67 32.03346216242008 36.0 32.0 36.0 14.0 36.0 68-69 31.937719298245614 36.0 32.0 36.0 17.5 36.0 70-71 31.658537898437963 36.0 32.0 36.0 14.0 36.0 72-73 31.56355816889389 36.0 32.0 36.0 14.0 36.0 74-75 31.644416542338508 36.0 32.0 36.0 14.0 36.0 76 30.63274647887324 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 2.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 3.0 16 2.0 17 4.0 18 5.0 19 4.0 20 4.0 21 5.0 22 17.0 23 24.0 24 19.0 25 36.0 26 56.0 27 77.0 28 134.0 29 153.0 30 204.0 31 321.0 32 461.0 33 732.0 34 1099.0 35 632.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.98271975957927 17.881292261457553 8.990733784122213 40.14525419484097 2 29.681624467285033 22.56204562547004 28.67886688393081 19.077463023314113 3 25.525525525525527 25.275275275275277 19.61961961961962 29.57957957957958 4 29.929929929929934 31.106106106106107 15.565565565565564 23.3983983983984 5 31.131131131131127 31.256256256256254 17.71771771771772 19.894894894894897 6 23.2982982982983 32.68268268268268 19.094094094094093 24.924924924924923 7 23.323323323323322 14.53953953953954 32.25725725725725 29.87987987987988 8 24.974974974974977 18.91891891891892 24.124124124124123 31.98198198198198 9 24.14914914914915 20.645645645645647 25.625625625625624 29.57957957957958 10-11 27.681141283944438 26.317106745088225 18.8962582905769 27.105493680390442 12-13 28.46943887775551 19.163326653306616 21.217434869739478 31.149799599198396 14-15 26.553884711779446 22.907268170426065 22.36842105263158 28.170426065162907 16-17 27.89473684210526 21.929824561403507 22.330827067669173 27.844611528822057 18-19 27.56763527054108 22.23196392785571 22.194388777555112 28.006012024048093 20-21 27.25448388310548 23.11551486266148 21.9992474601781 27.630753794054936 22-23 27.81813627254509 22.88326653306613 21.154809619238478 28.143787575150302 24-25 26.958265446797846 23.098132598069935 22.496553452813636 27.447048502318587 26-27 26.431883694698584 23.28612608096253 22.158165183606968 28.12382504073192 28-29 27.642785571142287 23.08366733466934 21.63076152304609 27.642785571142287 30-31 27.433295753476138 22.122009269698108 21.746210697732682 28.698484279093073 32-33 27.241983967935873 23.79759519038076 21.9063126252505 27.054108216432866 34-35 28.68236472945892 22.26953907815631 21.217434869739478 27.83066132264529 36-37 28.45691382765531 22.44488977955912 21.968937875751504 27.129258517034067 38-39 27.934360516096707 22.673180508580735 22.81097331830139 26.58148565702117 40-41 27.095077038707256 22.535387698860077 21.633471126143053 28.736064136289613 42-43 26.64745677774994 22.776246554748184 21.548484089200702 29.027812578301177 44-45 27.548589341692793 22.821316614420063 22.282131661442005 27.34796238244514 46-47 27.90872617853561 22.592778335005015 21.76529588766299 27.73319959879639 48-49 28.046639919759276 22.68054162487462 21.288866599799398 27.9839518555667 50-51 28.537380832915204 22.39086803813347 21.487706974410436 27.584044154540894 52-53 27.678235810048868 21.28805914045859 22.46585640897131 28.567848640521238 54-55 27.136056126284142 21.73640691556001 21.824104234527688 29.303432723628163 56-57 27.211225256827866 23.101979453770983 21.63618140816838 28.05061388123277 58-59 29.49505074552061 21.42588648039093 21.42588648039093 27.65317629369753 60-61 27.624655474818343 22.350288148333753 21.09746930593836 28.927587070909546 62-63 28.292193960656558 22.30296955268763 22.26538027816063 27.139456208495176 64-65 28.086226344153403 21.69444792580524 21.180599072565485 29.038726657475873 66-67 27.475557783905742 22.63725244422161 21.39633993482076 28.49084983705189 68-69 27.557673019057173 21.602306920762288 22.442326980942827 28.397693079237712 70-71 27.60005018190942 21.891857985196335 21.75385773428679 28.75423409860745 72-73 27.96823796319637 22.044366019662213 21.741870431056213 28.2455255860852 74-75 28.446679015612595 19.71421010849431 23.233659698332893 28.605451177560205 76 31.113460183227627 0.0 29.492600422832982 39.39393939393939 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 1.0 22 1.5 23 2.0 24 2.5 25 3.5 26 2.0 27 6.5 28 10.5 29 8.5 30 7.0 31 11.5 32 18.0 33 22.0 34 27.5 35 36.5 36 57.0 37 68.5 38 65.5 39 76.5 40 100.5 41 119.0 42 124.5 43 140.5 44 149.5 45 143.5 46 149.0 47 152.5 48 148.0 49 143.0 50 141.0 51 141.0 52 131.5 53 134.5 54 149.5 55 140.0 56 127.0 57 127.0 58 128.5 59 134.5 60 158.5 61 156.0 62 141.0 63 149.5 64 134.5 65 129.0 66 143.0 67 141.5 68 139.5 69 123.0 70 102.0 71 91.0 72 90.0 73 91.0 74 74.5 75 59.0 76 50.5 77 40.0 78 26.5 79 18.0 80 19.0 81 17.5 82 8.5 83 2.5 84 3.5 85 2.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 1.0 93 0.5 94 0.5 95 1.5 96 2.0 97 1.0 98 0.0 99 3.0 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.27499999999999997 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.1 9 0.1 10-11 0.11249999999999999 12-13 0.2 14-15 0.25 16-17 0.25 18-19 0.2 20-21 0.3375 22-23 0.2 24-25 0.2625 26-27 0.2625 28-29 0.2 30-31 0.21250000000000002 32-33 0.2 34-35 0.2 36-37 0.10010010010010009 38-39 0.11261261261261261 40-41 0.08760951188986232 42-43 0.07511266900350526 44-45 0.1627441161742614 46-47 0.12521913348359628 48-49 0.12521913348359628 50-51 0.1753067868770348 52-53 0.06260956674179814 54-55 0.050087653393438514 56-57 0.050087653393438514 58-59 0.06260956674179814 60-61 0.050087653393438514 62-63 0.050093926111458985 64-65 0.062625250501002 66-67 0.05011275369581559 68-69 0.05012531328320802 70-71 0.050156739811912224 72-73 0.05039052658100278 74-75 0.052896059243586355 76 0.07042253521126761 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 4.0 36 0.0 37 0.0 38 0.0 39 0.0 40 2.0 41 0.0 42 0.0 43 0.0 44 0.0 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 0.0 66 2.0 67 0.0 68 0.0 69 1.0 70 3.0 71 7.0 72 20.0 73 52.0 74 252.0 75 815.0 76 2840.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.39408615855213 96.5 2 1.401988274279888 2.75 3 0.1274534794799898 0.375 4 0.05098139179199593 0.2 5 0.0 0.0 6 0.0 0.0 7 0.025490695895997964 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988608 spots for SRR11389894.sra Written 988608 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra Read 988596 spots for SRR11389894.sra Written 988596 spots for SRR11389894.sra SRR ids: ['SRR11389894.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pee59gsd SRR11389894.sra spots: 19771932 blocks: [[1, 988596], [988597, 1977192], [1977193, 2965788], [2965789, 3954384], [3954385, 4942980], [4942981, 5931576], [5931577, 6920172], [6920173, 7908768], [7908769, 8897364], [8897365, 9885960], [9885961, 10874556], [10874557, 11863152], [11863153, 12851748], [12851749, 13840344], [13840345, 14828940], [14828941, 15817536], [15817537, 16806132], [16806133, 17794728], [17794729, 18783324], [18783325, 19771932]] SRR11389894 file size 3765534 SRR11389894 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389894 SRR11389894_1.fastq SRR11389894_2.fastq Input file: SRR11389894_1.fastq Paired file: SRR11389894_2.fastq trimmed: SRR11389894-trimmed-pair1.fastq, SRR11389894-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:21:43 2024 >> started Sat Dec 7 09:22:09 2024 >> done (26.494s) 19771932 read pairs processed; of these: 1153 ( 0.01%) short read pairs filtered out after trimming by size control 8179 ( 0.04%) empty read pairs filtered out after trimming by size control 19762600 (99.95%) read pairs available; of these: 4467 ( 0.02%) trimmed read pairs available after processing 19758133 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 4 0.00% 21 2 0.00% 22 4 0.00% 23 0 0.00% 24 5 0.00% 25 8 0.00% 26 8 0.00% 27 3 0.00% 28 6 0.00% 29 4 0.00% 30 6 0.00% 31 3 0.00% 32 8 0.00% 33 10 0.00% 34 8 0.00% 35 119 0.00% 36 133 0.00% 37 165 0.00% 38 186 0.00% 39 213 0.00% 40 205 0.00% 41 253 0.00% 42 268 0.00% 43 278 0.00% 44 300 0.00% 45 333 0.00% 46 362 0.00% 47 402 0.00% 48 382 0.00% 49 401 0.00% 50 472 0.00% 51 504 0.00% 52 540 0.00% 53 608 0.00% 54 566 0.00% 55 745 0.00% 56 818 0.00% 57 856 0.00% 58 919 0.00% 59 1038 0.01% 60 1036 0.01% 61 1077 0.01% 62 1184 0.01% 63 1278 0.01% 64 1300 0.01% 65 1489 0.01% 66 1599 0.01% 67 1785 0.01% 68 1795 0.01% 69 2014 0.01% 70 2743 0.01% 71 4250 0.02% 72 17367 0.09% 73 149749 0.76% 74 1274431 6.45% 75 8369880 42.35% 76 9918477 50.19% 19762600 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=18 prefix-density=0.45 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=32 fanout-score=9.12 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=2.7 sequence=CCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=4.88 fanout-score-rank=16 prefix-density=0.50 prefix-fanout=3.5 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.20 sequence-density-rank=23 fanout-score=91.29 fanout-score-rank=1 prefix-density=1.21 prefix-fanout=14.8 sequence=GCCGCCGCCGCCTCCACCGTCTCCGGCCTCGCCGGCGCCACCCTGGCCCGCCGGCCAGCCTTCTCTACCAACTTCACGACGGGTGGCCGGGTGTCAGCGAGGAACCCCTTGATGACGAGGAACCTGGAGAGGAACGGCAGGAT SRR11389894 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:22:35 Started mapping on | Dec 07 09:22:35 Finished on | Dec 07 09:23:59 Mapping speed, Million of reads per hour | 846.97 Number of input reads | 19762600 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 18104352 Uniquely mapped reads % | 91.61% Average mapped length | 150.38 Number of splices: Total | 7731289 Number of splices: Annotated (sjdb) | 7430761 Number of splices: GT/AG | 7626251 Number of splices: GC/AG | 92770 Number of splices: AT/AC | 2488 Number of splices: Non-canonical | 9780 Mismatch rate per base, % | 0.87% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 911504 % of reads mapped to multiple loci | 4.61% Number of reads mapped to too many loci | 41732 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.82% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 746755 746755 746755 N_multimapping 911504 911504 911504 N_noFeature 417382 17669458 532525 N_ambiguous 415416 1866 98634 UnstrandedReadsAssigned:17271554 PositiveStrandReadsAssigned:433028 NegativeStrandReadsAssigned:17473193 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389894 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389894-trimmed-pair1.fastq SRR11389894-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,762,600 reads, 18,160,099 reads pseudoaligned [quant] estimated average fragment length: 225.856 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52973 SRR11389894.ke.tsv 35125 SRR11389894.se.tsv 88098 total ==> SRR11389894.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 711.41 5.2998 0.525179 PNS24247 1044 819.144 25.396 2.18562 PNS24249 1928 1703.14 142.457 5.8966 PNS24246 1044 819.144 25.396 2.18562 PNS24248 1044 819.144 25.396 2.18562 PNS24244 1471 1246.14 7.05473 0.399099 PNS24243 293 90.7446 0 0 KQK14069 1603 1378.14 774.702 39.6286 KQK14071 474 252.003 67.7988 18.9664 ==> SRR11389894.se.tsv <== BRADI_1g14170v3 935 BRADI_1g53295v3 18 BRADI_1g59795v3 348 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 285 BRADI_1g74790v3 151 BRADI_1g09890v3 0 BRADI_1g77505v3 215 BRADI_1g48960v3 0 SRR11389894 completed mapping pipeline successfully