Starting /dee2/code/volunteer_pipeline.sh SRR11389895 current disk space = 1544230240256 free memory = 1602363080 SRR11389895 SRAfilesize 8103a726532df9054bea2827cc52ee6c SRR11389895.sra SRR11389895.sra file validated SRR11389895 is paired end SRR11389895 is conventional basespace SRR11389895 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389895_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.33725 32.0 32.0 32.0 32.0 32.0 2 31.50025 32.0 32.0 32.0 32.0 32.0 3 31.3895 32.0 32.0 32.0 32.0 32.0 4 31.48525 32.0 32.0 32.0 32.0 32.0 5 31.44125 32.0 32.0 32.0 32.0 32.0 6 34.50225 36.0 36.0 36.0 32.0 36.0 7 34.728 36.0 36.0 36.0 32.0 36.0 8 34.67225 36.0 36.0 36.0 32.0 36.0 9 34.66875 36.0 36.0 36.0 32.0 36.0 10-11 34.59925 36.0 36.0 36.0 32.0 36.0 12-13 34.697625 36.0 36.0 36.0 32.0 36.0 14-15 34.62425 36.0 36.0 36.0 32.0 36.0 16-17 34.494375000000005 36.0 36.0 36.0 32.0 36.0 18-19 34.674125000000004 36.0 36.0 36.0 32.0 36.0 20-21 34.625 36.0 36.0 36.0 32.0 36.0 22-23 34.5535 36.0 36.0 36.0 32.0 36.0 24-25 34.507875 36.0 36.0 36.0 32.0 36.0 26-27 34.32725000000001 36.0 36.0 36.0 32.0 36.0 28-29 34.251625000000004 36.0 36.0 36.0 32.0 36.0 30-31 34.23775 36.0 36.0 36.0 32.0 36.0 32-33 34.217 36.0 36.0 36.0 32.0 36.0 34-35 34.1335 36.0 36.0 36.0 32.0 36.0 36-37 34.21480370092523 36.0 36.0 36.0 32.0 36.0 38-39 34.03738434608652 36.0 36.0 36.0 32.0 36.0 40-41 34.17341835458865 36.0 36.0 36.0 32.0 36.0 42-43 34.04288572143035 36.0 36.0 36.0 32.0 36.0 44-45 33.95023755938985 36.0 36.0 36.0 32.0 36.0 46-47 34.03138284571143 36.0 36.0 36.0 32.0 36.0 48-49 33.95648912228057 36.0 36.0 36.0 32.0 36.0 50-51 33.90947736934234 36.0 36.0 36.0 32.0 36.0 52-53 33.86046511627907 36.0 36.0 36.0 32.0 36.0 54-55 33.750437609402354 36.0 36.0 36.0 27.0 36.0 56-57 33.771817954488625 36.0 36.0 36.0 32.0 36.0 58-59 33.80530530530531 36.0 36.0 36.0 29.5 36.0 60-61 33.39161451814769 36.0 36.0 36.0 27.0 36.0 62-63 33.54769654481723 36.0 36.0 36.0 27.0 36.0 64-65 33.29569354031047 36.0 36.0 36.0 27.0 36.0 66-67 33.21008685580337 36.0 34.0 36.0 27.0 36.0 68-69 33.10683867735471 36.0 32.0 36.0 27.0 36.0 70-71 32.99650867759071 36.0 32.0 36.0 24.0 36.0 72-73 33.03680420032734 36.0 32.0 36.0 24.0 36.0 74-75 32.95902273691539 36.0 32.0 36.0 24.0 36.0 76 32.203645285664216 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 3.0 25 11.0 26 20.0 27 32.0 28 51.0 29 90.0 30 148.0 31 214.0 32 363.0 33 587.0 34 1238.0 35 1240.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.034258564641156 9.32733183295824 9.227306826706677 44.41110277569392 2 28.857214303575894 9.777444361090271 38.359589897474365 23.005751437859466 3 26.85671417854464 15.328832208052013 20.43010752688172 37.38434608652163 4 32.38309577394349 22.305576394098527 17.35433858464616 27.956989247311824 5 32.58314578644661 25.431357839459867 21.030257564391096 20.955238809702426 6 25.760241266649913 27.846192510681078 23.448102538326214 22.945463684342798 7 20.43010752688172 22.230557639409852 35.183795948987246 22.155538884721178 8 21.680420105026258 20.255063765941486 30.407601900475118 27.656914228557138 9 21.330332583145786 18.72968242060515 32.90822705676419 27.031757939484873 10-11 25.84396099024756 26.30657664416104 22.705676419104776 25.143785946486624 12-13 25.743935983995996 21.717929482370593 23.893473368342086 28.644661165291325 14-15 25.568892223055762 22.493123280820203 25.29382345586397 26.644161040260066 16-17 26.65666416604151 22.43060765191298 23.068267066766694 27.84446111527882 18-19 25.593898474618655 23.005751437859466 23.25581395348837 28.14453613403351 20-21 26.244061015253813 23.15578894723681 23.20580145036259 27.394348587146787 22-23 26.944236059014752 23.88097024256064 22.468117029257314 26.70667666916729 24-25 26.04401100275069 22.655663915978995 23.10577644411103 28.19454863715929 26-27 26.106526631657918 22.405601400350086 23.43085771442861 28.057014253563388 28-29 26.76919229807452 22.05551387846962 23.78094523630908 27.394348587146787 30-31 26.85671417854464 22.36809202300575 22.980745186296573 27.79444861215304 32-33 25.78144536134033 22.843210802700675 23.268317079269817 28.107026756689173 34-35 26.106526631657918 22.643160790197552 23.143285821455365 28.107026756689173 36-37 25.431357839459867 22.88072018004501 23.63090772693173 28.057014253563388 38-39 26.894223555888974 22.255563890972745 23.143285821455365 27.70692673168292 40-41 26.994248562140534 22.893223305826456 22.53063265816454 27.581895473868467 42-43 26.281570392598148 22.330582645661416 24.10602650662666 27.28182045511378 44-45 26.231557889472366 22.95573893473368 22.968242060515127 27.84446111527882 46-47 26.79419854963741 22.330582645661416 23.3183295823956 27.556889222305575 48-49 26.84421105276319 23.118279569892472 22.405601400350086 27.631907976994246 50-51 26.11902975743936 23.118279569892472 22.9057264316079 27.85696424106027 52-53 27.38184546136534 22.36809202300575 22.66816704176044 27.581895473868467 54-55 25.743935983995996 22.43060765191298 22.58064516129032 29.2448112028007 56-57 25.6064016004001 22.455613903475868 23.643410852713178 28.294573643410853 58-59 26.226226226226224 22.45995995995996 22.835335335335337 28.47847847847848 60-61 26.307884856070086 22.703379224030037 22.590738423028785 28.397997496871092 62-63 26.727591387080622 22.608913370055085 22.646469704556836 28.01702553830746 64-65 27.929394091136707 21.64496745117677 22.821732598898347 27.60390585878818 66-67 26.705897082759485 21.635157130336797 22.599223738575187 29.059722048328535 68-69 26.402805611222448 21.59318637274549 23.271543086172343 28.73246492985972 70-71 27.24539646749342 22.24727546035325 22.998872604284102 27.50845546786922 72-73 27.14716223003516 21.44650929181316 22.877950778503266 28.528377699648416 74-75 27.850442594794554 17.730215352094067 23.9926014004492 30.426740652662176 76 29.407641079565373 0.0 32.42201191728006 38.170347003154575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 1.5 24 2.5 25 2.5 26 1.5 27 3.0 28 4.0 29 3.5 30 8.0 31 12.0 32 15.5 33 20.0 34 26.0 35 38.5 36 51.0 37 57.5 38 72.0 39 100.5 40 115.0 41 124.5 42 141.5 43 155.5 44 161.0 45 167.0 46 178.0 47 188.0 48 180.5 49 165.0 50 161.5 51 144.0 52 125.0 53 117.5 54 119.5 55 135.0 56 135.5 57 151.0 58 179.0 59 174.0 60 165.5 61 160.5 62 152.0 63 140.5 64 121.0 65 121.0 66 121.0 67 108.5 68 105.5 69 94.0 70 80.0 71 76.5 72 79.0 73 69.0 74 51.0 75 44.5 76 41.5 77 37.0 78 25.0 79 12.0 80 11.5 81 10.0 82 6.5 83 5.5 84 2.5 85 2.5 86 2.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.525 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 3.0 58 0.0 59 1.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 1.0 68 0.0 69 0.0 70 1.0 71 3.0 72 12.0 73 66.0 74 251.0 75 806.0 76 2853.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.0 #Duplication Level Percentage of deduplicated Percentage of total 1 97.62886597938144 94.69999999999999 2 1.958762886597938 3.8 3 0.28350515463917525 0.8250000000000001 4 0.051546391752577324 0.2 5 0.051546391752577324 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025773195876288662 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAGGGTTCAAATGTACATATGCTCCTCGAGCCCATGTCGGTACATTCA 9 0.22499999999999998 No Hit CTCCAACAGATCAATCCAGATCAGTGAGCTGCTGTTTAGGCCTTGCCGGA 5 0.125 No Hit CGGGAGAGTTGCCGTGCTCACGGAAGACGAAACCGACCTTGCTGAACTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389895 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389895_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.97225 32.0 32.0 32.0 32.0 32.0 2 30.77275 32.0 32.0 32.0 32.0 32.0 3 30.7735 32.0 32.0 32.0 32.0 32.0 4 30.686 32.0 32.0 32.0 32.0 32.0 5 30.8345 32.0 32.0 32.0 32.0 32.0 6 33.836 36.0 36.0 36.0 32.0 36.0 7 34.01775 36.0 36.0 36.0 32.0 36.0 8 33.9135 36.0 36.0 36.0 32.0 36.0 9 33.881 36.0 36.0 36.0 32.0 36.0 10-11 33.883125 36.0 36.0 36.0 32.0 36.0 12-13 33.917249999999996 36.0 36.0 36.0 32.0 36.0 14-15 33.800375 36.0 36.0 36.0 32.0 36.0 16-17 33.792125 36.0 36.0 36.0 29.5 36.0 18-19 33.854 36.0 36.0 36.0 32.0 36.0 20-21 33.738875 36.0 36.0 36.0 29.5 36.0 22-23 33.63875 36.0 36.0 36.0 29.5 36.0 24-25 33.521625 36.0 36.0 36.0 27.0 36.0 26-27 33.554249999999996 36.0 36.0 36.0 27.0 36.0 28-29 33.49675 36.0 36.0 36.0 27.0 36.0 30-31 33.373625000000004 36.0 36.0 36.0 27.0 36.0 32-33 33.459625 36.0 36.0 36.0 27.0 36.0 34-35 33.348749999999995 36.0 36.0 36.0 27.0 36.0 36-37 33.53756574004508 36.0 36.0 36.0 27.0 36.0 38-39 33.564613072877535 36.0 36.0 36.0 27.0 36.0 40-41 33.52191334835963 36.0 36.0 36.0 27.0 36.0 42-43 33.31642875031305 36.0 36.0 36.0 27.0 36.0 44-45 33.09929877285249 36.0 36.0 36.0 21.0 36.0 46-47 32.989606811920865 36.0 36.0 36.0 21.0 36.0 48-49 32.87803656398698 36.0 36.0 36.0 17.5 36.0 50-51 32.860631104432755 36.0 32.0 36.0 21.0 36.0 52-53 32.68106686701728 36.0 32.0 36.0 21.0 36.0 54-55 32.71036814425244 36.0 32.0 36.0 21.0 36.0 56-57 32.728900576008016 36.0 34.0 36.0 21.0 36.0 58-59 32.37982456140351 36.0 32.0 36.0 17.5 36.0 60-61 32.384557533216345 36.0 32.0 36.0 17.5 36.0 62-63 32.43229689067202 36.0 32.0 36.0 17.5 36.0 64-65 32.349674022066196 36.0 32.0 36.0 17.5 36.0 66-67 32.49166200004579 36.0 32.0 36.0 17.5 36.0 68-69 31.970270948319115 36.0 32.0 36.0 14.0 36.0 70-71 31.888648812791622 36.0 32.0 36.0 14.0 36.0 72-73 31.76844188795201 36.0 32.0 36.0 14.0 36.0 74-75 31.709037565787632 36.0 32.0 36.0 14.0 36.0 76 30.558271342543392 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 2.0 17 3.0 18 2.0 19 1.0 20 8.0 21 6.0 22 9.0 23 9.0 24 19.0 25 36.0 26 55.0 27 62.0 28 103.0 29 156.0 30 242.0 31 303.0 32 431.0 33 703.0 34 1153.0 35 687.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.223057644110273 18.721804511278194 8.070175438596491 43.984962406015036 2 29.724310776942353 23.834586466165415 29.423558897243108 17.017543859649123 3 24.267468069120962 26.646631605309288 18.2068620085149 30.879038317054846 4 28.97570748810418 30.65364387678437 14.951164537941397 25.41948409717005 5 30.252942649636864 30.077635862759827 17.680941647883795 21.98847983971951 6 23.015276734285 33.283245679939895 19.408965689957427 24.292511895817682 7 23.340846481342346 14.52541948409717 32.65715001252191 29.476584022038566 8 23.441021788129227 20.686200851490106 23.791635361883294 32.08114199849737 9 22.96518908089156 20.736288504883547 25.820185324317556 30.47833708990734 10-11 29.02943018159048 25.91108328115216 17.97119599248591 27.08829054477145 12-13 28.319138276553108 20.453406813627254 21.330160320641284 29.897294589178358 14-15 26.234645274504885 22.5871145650539 22.913010779644022 28.26522938079719 16-17 27.826522938079716 22.098270243168713 21.521684632740033 28.55352218601153 18-19 27.49843260188088 22.620689655172413 22.0564263322884 27.82445141065831 20-21 28.166185515250408 22.34216141584034 21.639261955566713 27.852391113342538 22-23 28.288649461287896 23.08945126534703 20.446003507892758 28.175895765472315 24-25 27.416321925535915 23.630437507835026 21.08562116083741 27.86761940579165 26-27 27.375282025570318 23.276510403609926 21.910253196289798 27.437954374529955 28-29 27.151985966670843 23.430647788497684 20.949755669715575 28.4676105751159 30-31 27.973430254417845 22.91013911517734 21.0051384885324 28.11129214187241 32-33 27.385579937304076 23.272727272727273 22.106583072100314 27.23510971786834 34-35 26.999247931812487 22.524442216094258 21.78490849837052 28.69140135372274 36-37 27.139456208495176 22.666332539781983 21.313118656809923 28.881092594912914 38-39 28.01053687907677 22.955343702960363 22.70446562970396 26.329653788258906 40-41 27.768036072144287 22.46993987975952 21.492985971943888 28.269038076152302 42-43 27.669172932330827 22.005012531328322 22.05513784461153 28.270676691729324 44-45 28.145363408521302 22.531328320802004 22.13032581453634 27.192982456140353 46-47 27.923298658979824 22.346158666499562 21.017671387391903 28.71287128712871 48-49 28.782750407421336 22.213864861476747 21.486774476620283 27.516610254481634 50-51 28.101869276125957 22.694768535942792 21.264584117425667 27.93877807050558 52-53 28.029069038967545 22.315499310863302 20.736749780729234 28.918681869439922 54-55 28.00952023048979 22.610547413253162 21.2326193160466 28.14731304021045 56-57 27.55511022044088 22.945891783567134 21.64328657314629 27.85571142284569 58-59 28.32601880877743 21.36677115987461 21.46708463949843 28.84012539184953 60-61 27.5827482447342 23.58324974924774 20.937813440320962 27.896188565697088 62-63 28.053674441936295 22.37271131176323 21.10609480812641 28.467519438174065 64-65 27.411868021578222 22.418768034123698 21.22694768535943 28.942416258938653 66-67 27.19177223128057 22.81449893390192 21.535181236673772 28.458547598143735 68-69 27.365119196988708 22.8732747804266 21.54328732747804 28.218318695106646 70-71 28.49786485807586 21.50213514192414 21.263501632755588 28.736498367244412 72-73 27.98385061821852 21.170830179157203 21.839515518546555 29.00580368407772 74-75 28.630319148936167 19.49468085106383 23.337765957446805 28.537234042553187 76 31.148121899362152 0.0 29.588944011339475 39.26293408929837 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 3.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 2.0 21 4.0 22 2.0 23 1.0 24 3.0 25 3.0 26 2.0 27 2.5 28 3.5 29 5.0 30 7.0 31 11.5 32 20.5 33 26.5 34 23.5 35 28.5 36 47.0 37 62.0 38 69.0 39 78.0 40 82.0 41 104.0 42 129.5 43 135.0 44 144.0 45 136.0 46 130.5 47 155.0 48 157.5 49 135.0 50 129.5 51 132.5 52 131.5 53 137.0 54 151.5 55 159.5 56 155.5 57 151.5 58 152.5 59 161.5 60 181.5 61 172.0 62 153.0 63 141.5 64 132.5 65 140.5 66 141.0 67 138.5 68 138.5 69 123.0 70 115.0 71 119.0 72 103.5 73 76.0 74 57.0 75 49.0 76 41.0 77 35.0 78 28.0 79 19.0 80 14.0 81 10.5 82 6.5 83 4.0 84 4.0 85 3.5 86 2.0 87 1.0 88 1.5 89 1.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.25 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.17500000000000002 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-11 0.1875 12-13 0.2 14-15 0.27499999999999997 16-17 0.27499999999999997 18-19 0.3125 20-21 0.41250000000000003 22-23 0.22499999999999998 24-25 0.2875 26-27 0.27499999999999997 28-29 0.2375 30-31 0.2625 32-33 0.3125 34-35 0.27499999999999997 36-37 0.06260956674179814 38-39 0.1753067868770348 40-41 0.025043826696719257 42-43 0.07513148009015778 44-45 0.07513148009015778 46-47 0.0876533934385174 48-49 0.11269722013523666 50-51 0.18782870022539444 52-53 0.06260956674179814 54-55 0.03756574004507889 56-57 0.025043826696719257 58-59 0.06265664160401002 60-61 0.0250689395838556 62-63 0.025075225677031094 64-65 0.06268806419257773 66-67 0.025078369905956112 68-69 0.025087807325639738 70-71 0.025113008538422906 72-73 0.025227043390514632 74-75 0.026588673225206066 76 0.035423308537017355 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 7.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 3.0 58 0.0 59 1.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 1.0 68 0.0 69 1.0 70 6.0 71 5.0 72 20.0 73 69.0 74 248.0 75 814.0 76 2823.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.45 #Duplication Level Percentage of deduplicated Percentage of total 1 97.8707029245767 95.375 2 1.8471010774756287 3.5999999999999996 3 0.2052334530528476 0.6 4 0.02565418163160595 0.1 5 0.0 0.0 6 0.02565418163160595 0.15 7 0.02565418163160595 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTCAG 20 0.006668267 52.078125 5 >>END_MODULE Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954467 spots for SRR11389895.sra Written 954467 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra Read 954461 spots for SRR11389895.sra Written 954461 spots for SRR11389895.sra SRR ids: ['SRR11389895.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7pwoyd48 SRR11389895.sra spots: 19089226 blocks: [[1, 954461], [954462, 1908922], [1908923, 2863383], [2863384, 3817844], [3817845, 4772305], [4772306, 5726766], [5726767, 6681227], [6681228, 7635688], [7635689, 8590149], [8590150, 9544610], [9544611, 10499071], [10499072, 11453532], [11453533, 12407993], [12407994, 13362454], [13362455, 14316915], [14316916, 15271376], [15271377, 16225837], [16225838, 17180298], [17180299, 18134759], [18134760, 19089226]] SRR11389895 file size 3634608 SRR11389895 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389895 SRR11389895_1.fastq SRR11389895_2.fastq Input file: SRR11389895_1.fastq Paired file: SRR11389895_2.fastq trimmed: SRR11389895-trimmed-pair1.fastq, SRR11389895-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:25:25 2024 >> started Sat Dec 7 09:25:40 2024 >> done (15.020s) 19089226 read pairs processed; of these: 1135 ( 0.01%) short read pairs filtered out after trimming by size control 9083 ( 0.05%) empty read pairs filtered out after trimming by size control 19079008 (99.95%) read pairs available; of these: 10465 ( 0.05%) trimmed read pairs available after processing 19068543 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 5 0.00% 25 5 0.00% 26 4 0.00% 27 3 0.00% 28 12 0.00% 29 3 0.00% 30 5 0.00% 31 6 0.00% 32 6 0.00% 33 8 0.00% 34 12 0.00% 35 233 0.00% 36 285 0.00% 37 294 0.00% 38 319 0.00% 39 342 0.00% 40 373 0.00% 41 393 0.00% 42 471 0.00% 43 537 0.00% 44 516 0.00% 45 517 0.00% 46 597 0.00% 47 647 0.00% 48 633 0.00% 49 704 0.00% 50 754 0.00% 51 720 0.00% 52 939 0.00% 53 895 0.00% 54 905 0.00% 55 1068 0.01% 56 1236 0.01% 57 1273 0.01% 58 1390 0.01% 59 1438 0.01% 60 1473 0.01% 61 1507 0.01% 62 1608 0.01% 63 1703 0.01% 64 1923 0.01% 65 2064 0.01% 66 2197 0.01% 67 2363 0.01% 68 2421 0.01% 69 2838 0.01% 70 3388 0.02% 71 4748 0.02% 72 17570 0.09% 73 141729 0.74% 74 1198814 6.28% 75 7995269 41.91% 76 9679834 50.74% 19079008 reads passed initial QC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=23 prefix-density=0.93 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=10.29 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=2.5 sequence=CCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.97 prefix-fanout=2.0 sequence=CCCATGTTCGGGTGCACCGACGCCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=201.34 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=2.4 sequence=CCGCTCCAACACTTCAGTTCTCACTCCACAGCTCAGAGTCAGAGCTACTAGCAATGGCAGCGGCGACCATGGCGCTCTCCTCCCCCGCGATGGCCGGCACCCCGGTGAAGGTCTCCAGGGCCACCCCCTTCGGCGAGGGCCGCATCAC SRR11389895 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:26:21 Started mapping on | Dec 07 09:26:21 Finished on | Dec 07 09:27:29 Mapping speed, Million of reads per hour | 1010.07 Number of input reads | 19079008 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 17646911 Uniquely mapped reads % | 92.49% Average mapped length | 150.40 Number of splices: Total | 7670775 Number of splices: Annotated (sjdb) | 7381231 Number of splices: GT/AG | 7568268 Number of splices: GC/AG | 91222 Number of splices: AT/AC | 2053 Number of splices: Non-canonical | 9232 Mismatch rate per base, % | 0.84% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 741425 % of reads mapped to multiple loci | 3.89% Number of reads mapped to too many loci | 40354 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.67% % of reads unmapped: other | 0.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 690678 690678 690678 N_multimapping 741425 741425 741425 N_noFeature 382148 17250100 470452 N_ambiguous 410139 1693 103954 UnstrandedReadsAssigned:16854624 PositiveStrandReadsAssigned:395118 NegativeStrandReadsAssigned:17072505 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389895 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389895-trimmed-pair1.fastq SRR11389895-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,079,008 reads, 17,529,336 reads pseudoaligned [quant] estimated average fragment length: 220.413 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52973 SRR11389895.ke.tsv 35125 SRR11389895.se.tsv 88098 total ==> SRR11389895.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 716.718 0 0 PNS24247 1044 824.587 20.2933 1.74446 PNS24249 1928 1708.59 139.177 5.77398 PNS24246 1044 824.587 20.2933 1.74446 PNS24248 1044 824.587 20.2933 1.74446 PNS24244 1471 1251.59 22.9436 1.29941 PNS24243 293 93.8867 0 0 KQK14069 1603 1383.59 1501.54 76.9265 KQK14071 474 256.863 142.576 39.3453 ==> SRR11389895.se.tsv <== BRADI_1g14170v3 1748 BRADI_1g53295v3 10 BRADI_1g59795v3 276 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 218 BRADI_1g74790v3 245 BRADI_1g09890v3 0 BRADI_1g77505v3 170 BRADI_1g48960v3 0 SRR11389895 completed mapping pipeline successfully