Starting /dee2/code/volunteer_pipeline.sh SRR11389896 current disk space = 1544238092288 free memory = 1528644428 SRR11389896 SRAfilesize 6490e3b968738d7225c8512bec446482 SRR11389896.sra SRR11389896.sra file validated SRR11389896 is paired end SRR11389896 is conventional basespace SRR11389896 read1 length is 42-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389896_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 42-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.24925 32.0 32.0 32.0 32.0 32.0 2 31.387 32.0 32.0 32.0 32.0 32.0 3 31.4225 32.0 32.0 32.0 32.0 32.0 4 31.398 32.0 32.0 32.0 32.0 32.0 5 31.5 32.0 32.0 32.0 32.0 32.0 6 34.355 36.0 36.0 36.0 32.0 36.0 7 34.702 36.0 36.0 36.0 32.0 36.0 8 34.58 36.0 36.0 36.0 32.0 36.0 9 34.58525 36.0 36.0 36.0 32.0 36.0 10-11 34.545625 36.0 36.0 36.0 32.0 36.0 12-13 34.606624999999994 36.0 36.0 36.0 32.0 36.0 14-15 34.58825 36.0 36.0 36.0 32.0 36.0 16-17 34.464625 36.0 36.0 36.0 32.0 36.0 18-19 34.582375 36.0 36.0 36.0 32.0 36.0 20-21 34.732124999999996 36.0 36.0 36.0 32.0 36.0 22-23 34.548375 36.0 36.0 36.0 32.0 36.0 24-25 34.488375000000005 36.0 36.0 36.0 32.0 36.0 26-27 34.354 36.0 36.0 36.0 32.0 36.0 28-29 34.125125 36.0 36.0 36.0 32.0 36.0 30-31 34.148624999999996 36.0 36.0 36.0 32.0 36.0 32-33 34.178125 36.0 36.0 36.0 32.0 36.0 34-35 34.144 36.0 36.0 36.0 32.0 36.0 36-37 34.087374999999994 36.0 36.0 36.0 32.0 36.0 38-39 34.143875 36.0 36.0 36.0 32.0 36.0 40-41 34.062 36.0 36.0 36.0 32.0 36.0 42-43 33.91610471367842 36.0 36.0 36.0 32.0 36.0 44-45 33.99187296824206 36.0 36.0 36.0 32.0 36.0 46-47 33.88809702425606 36.0 36.0 36.0 32.0 36.0 48-49 33.91297824456114 36.0 36.0 36.0 32.0 36.0 50-51 33.883316658329164 36.0 36.0 36.0 32.0 36.0 52-53 33.93508772775179 36.0 36.0 36.0 32.0 36.0 54-55 33.6252979273995 36.0 36.0 36.0 27.0 36.0 56-57 33.66683354192741 36.0 36.0 36.0 32.0 36.0 58-59 33.5973717146433 36.0 36.0 36.0 29.5 36.0 60-61 33.24818523153942 36.0 34.0 36.0 24.0 36.0 62-63 33.461827284105134 36.0 36.0 36.0 27.0 36.0 64-65 33.124436654982475 36.0 34.0 36.0 21.0 36.0 66-67 33.11031805659905 36.0 34.0 36.0 24.0 36.0 68-69 33.03218131730529 36.0 32.0 36.0 27.0 36.0 70-71 32.7470201484863 36.0 32.0 36.0 21.0 36.0 72-73 33.009294260726655 36.0 32.0 36.0 27.0 36.0 74-75 32.93288577249453 36.0 32.0 36.0 21.0 36.0 76 32.09672880759761 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 7.0 24 3.0 25 14.0 26 18.0 27 41.0 28 60.0 29 104.0 30 150.0 31 215.0 32 344.0 33 589.0 34 1241.0 35 1214.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.099999999999994 9.975000000000001 9.5 39.425 2 28.275 10.525 36.65 24.55 3 25.974999999999998 17.175 20.9 35.949999999999996 4 33.35 22.2 17.675 26.775 5 31.275 26.575 21.625 20.525 6 26.125220015086747 28.89112396278602 22.755846115162182 22.22780990696505 7 18.525 22.650000000000002 35.675000000000004 23.150000000000002 8 20.7 21.5 30.8 27.0 9 21.0 18.275 32.074999999999996 28.65 10-11 24.4 28.6375 21.925 25.0375 12-13 25.650000000000002 22.175 23.525 28.65 14-15 25.1875 23.549999999999997 25.2375 26.025 16-17 25.912499999999998 22.675 24.1375 27.275 18-19 25.0375 23.7375 23.2375 27.987499999999997 20-21 26.787499999999998 22.775000000000002 23.849999999999998 26.5875 22-23 25.937500000000004 24.075 24.0375 25.95 24-25 25.137500000000003 23.849999999999998 23.3625 27.650000000000002 26-27 26.137500000000003 23.474999999999998 23.8875 26.5 28-29 25.6 23.875 22.875 27.650000000000002 30-31 25.6 24.275 23.2125 26.9125 32-33 25.5 23.200000000000003 24.275 27.025 34-35 26.075 23.1125 23.925 26.887499999999996 36-37 26.575 22.650000000000002 23.075000000000003 27.700000000000003 38-39 24.2375 23.5375 23.962500000000002 28.262500000000003 40-41 26.4125 23.175 24.275 26.137500000000003 42-43 25.978247280910118 22.977872234029252 23.215401925240656 27.82847855981998 44-45 25.531382845711427 22.95573893473368 24.74368592148037 26.76919229807452 46-47 26.319079769942487 23.518379594898725 23.218304576144035 26.944236059014752 48-49 25.85646411602901 23.005751437859466 24.06851712928232 27.069267316829208 50-51 24.874937468734366 23.386693346673336 23.899449724862432 27.838919459729865 52-53 27.166979362101312 23.039399624765476 22.93933708567855 26.85428392745466 54-55 25.935193294132365 22.682347053671965 23.19529588389841 28.187163768297257 56-57 26.12015018773467 22.290362953692114 24.167709637046308 27.42177722152691 58-59 25.819774718397998 22.76595744680851 24.155193992490613 27.25907384230288 60-61 26.47058823529412 22.02753441802253 23.804755944931163 27.697121401752188 62-63 26.107634543178975 22.7909887359199 23.74217772215269 27.359198998748436 64-65 26.089133700550825 22.734101151727593 23.43515272909364 27.74161241862794 66-67 26.584022038567497 23.29075882794891 23.203105434510395 26.922113698973206 68-69 26.521412471825695 22.58953168044077 23.25319308790383 27.635862759829706 70-71 26.261740763932373 23.16844082654978 24.17031934877896 26.399499060738883 72-73 27.418949484795174 22.254335260115607 23.07112339783865 27.255591857250565 74-75 25.98705928958141 19.27901756239271 24.79862670011884 29.93529644790704 76 28.420682377769964 0.0 32.43053112908899 39.148786493141046 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.5 22 4.0 23 3.5 24 1.5 25 1.5 26 3.5 27 5.5 28 7.5 29 11.5 30 16.0 31 21.5 32 32.0 33 37.5 34 33.0 35 43.5 36 62.5 37 75.5 38 90.5 39 107.0 40 126.0 41 152.5 42 167.5 43 171.0 44 167.5 45 174.0 46 196.0 47 185.0 48 168.5 49 169.5 50 166.5 51 159.5 52 138.5 53 124.5 54 129.5 55 134.0 56 122.5 57 116.5 58 124.5 59 127.0 60 130.5 61 137.0 62 146.0 63 141.0 64 131.0 65 124.5 66 104.5 67 88.5 68 96.0 69 97.5 70 82.5 71 76.5 72 62.5 73 53.5 74 61.5 75 62.0 76 48.0 77 27.5 78 17.5 79 13.0 80 14.5 81 15.5 82 9.5 83 6.0 84 5.0 85 3.0 86 1.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.575 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 1.0 53 0.0 54 1.0 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 7.0 72 12.0 73 65.0 74 243.0 75 822.0 76 2843.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.57759715519431 97.02499999999999 2 1.27000254000508 2.5 3 0.12700025400050802 0.375 4 0.025400050800101596 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389896 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389896_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9755 32.0 32.0 32.0 32.0 32.0 2 30.7175 32.0 32.0 32.0 32.0 32.0 3 30.90525 32.0 32.0 32.0 32.0 32.0 4 30.85775 32.0 32.0 32.0 32.0 32.0 5 30.964 32.0 32.0 32.0 32.0 32.0 6 33.94875 36.0 36.0 36.0 32.0 36.0 7 34.25775 36.0 36.0 36.0 32.0 36.0 8 33.9675 36.0 36.0 36.0 32.0 36.0 9 33.92675 36.0 36.0 36.0 32.0 36.0 10-11 34.009875 36.0 36.0 36.0 32.0 36.0 12-13 33.94225 36.0 36.0 36.0 32.0 36.0 14-15 33.831500000000005 36.0 36.0 36.0 32.0 36.0 16-17 33.828 36.0 36.0 36.0 32.0 36.0 18-19 33.884875 36.0 36.0 36.0 32.0 36.0 20-21 33.60725 36.0 36.0 36.0 29.5 36.0 22-23 33.565375 36.0 36.0 36.0 29.5 36.0 24-25 33.605625 36.0 36.0 36.0 27.0 36.0 26-27 33.496 36.0 36.0 36.0 27.0 36.0 28-29 33.44425 36.0 36.0 36.0 27.0 36.0 30-31 33.469375 36.0 36.0 36.0 27.0 36.0 32-33 33.52575 36.0 36.0 36.0 27.0 36.0 34-35 33.454125000000005 36.0 36.0 36.0 27.0 36.0 36-37 33.45946960220165 36.0 36.0 36.0 27.0 36.0 38-39 33.368651488616464 36.0 36.0 36.0 27.0 36.0 40-41 33.46034525894421 36.0 36.0 36.0 27.0 36.0 42-43 33.295893216208455 36.0 36.0 36.0 27.0 36.0 44-45 33.046671671671675 36.0 36.0 36.0 21.0 36.0 46-47 32.910763454317895 36.0 36.0 36.0 21.0 36.0 48-49 32.85156445556946 36.0 36.0 36.0 21.0 36.0 50-51 32.83600400600901 36.0 32.0 36.0 21.0 36.0 52-53 32.65786179268903 36.0 32.0 36.0 21.0 36.0 54-55 32.63152580109834 36.0 32.0 36.0 17.5 36.0 56-57 32.76816132264529 36.0 32.0 36.0 17.5 36.0 58-59 32.33266533066133 36.0 32.0 36.0 17.5 36.0 60-61 32.42246993987976 36.0 32.0 36.0 21.0 36.0 62-63 32.47545090180361 36.0 32.0 36.0 17.5 36.0 64-65 32.435229265848164 36.0 32.0 36.0 17.5 36.0 66-67 32.397789975063006 36.0 32.0 36.0 14.0 36.0 68-69 31.937578340436197 36.0 32.0 36.0 14.0 36.0 70-71 31.845400440627326 36.0 32.0 36.0 14.0 36.0 72-73 31.88320725273224 36.0 32.0 36.0 14.0 36.0 74-75 31.687136150956963 36.0 32.0 36.0 14.0 36.0 76 30.38175313059034 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 2.0 6 1.0 7 0.0 8 0.0 9 3.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.0 16 4.0 17 1.0 18 2.0 19 3.0 20 2.0 21 7.0 22 12.0 23 13.0 24 22.0 25 40.0 26 53.0 27 80.0 28 108.0 29 156.0 30 206.0 31 274.0 32 416.0 33 673.0 34 1170.0 35 745.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.607607607607605 20.27027027027027 9.334334334334335 37.787787787787785 2 29.41912869303956 23.56034051076615 28.367551326990487 18.652979469203807 3 24.91868901676257 25.819364523392547 19.53965474105579 29.72229171878909 4 30.297723292469353 28.921691268451337 16.587440580435324 24.193144858643983 5 29.522141606204656 31.573680260195147 19.06429822366775 19.83987990993245 6 24.31823867900926 31.673755316487366 20.115086314736054 23.892919689767325 7 23.267450587940957 15.061295971978982 33.500125093820365 28.171128346259692 8 24.94994994994995 20.295295295295297 24.24924924924925 30.505505505505504 9 25.894420815611706 20.31523642732049 24.64348261195897 29.146860145108832 10-11 28.43198598423226 26.842698035289704 18.63346264547616 26.091853335001876 12-13 27.823691460055095 20.072627097420487 22.401702980215376 29.701978462309043 14-15 26.253761283851556 23.432798395185557 23.182046138415245 27.13139418254764 16-17 27.584910389773153 22.571750845970673 22.396290261937587 27.447048502318587 18-19 28.002005515166704 22.98821759839559 22.436700927550763 26.57307595888694 20-21 27.807755050821935 23.516124984314217 21.734220102898732 26.941899861965112 22-23 27.925331996993236 22.95164119268354 22.325231771485843 26.797795038837386 24-25 26.936575582852846 22.699924793181246 22.236149410879918 28.12735021308599 26-27 27.711598746081506 23.97492163009404 21.768025078369906 26.545454545454543 28-29 28.16336757704836 23.615635179153095 21.272863943873716 26.94813329992483 30-31 27.2715879182855 24.175961899987467 21.982704599573882 26.569745582153153 32-33 27.146258929690436 23.198395788945984 22.233362576764005 27.421982704599575 34-35 27.887747431721372 23.076923076923077 21.83663242295164 27.19869706840391 36-37 27.04260651629073 23.759398496240603 21.842105263157897 27.355889724310778 38-39 27.779867117964148 23.317036479879654 23.141531904224646 25.761564497931555 40-41 27.22375344525182 22.751190177900277 21.999498872463043 28.025557504384867 42-43 27.259055019425993 23.198395788945984 21.71951372352425 27.823035468103775 44-45 27.460815047021942 23.42319749216301 22.206896551724135 26.90909090909091 46-47 27.310344827586206 23.347962382445143 21.592476489028215 27.74921630094044 48-49 28.433462937413772 22.81449893390192 21.24670763827919 27.505330490405118 50-51 27.092483373070646 22.78830468063747 22.813401932488393 27.305810013803487 52-53 27.172413793103452 22.921630094043888 21.592476489028215 28.31347962382445 54-55 28.181020433747022 22.71530650620534 21.900463833521375 27.203209226526265 56-57 27.260188087774296 23.686520376175547 21.617554858934167 27.435736677115983 58-59 28.725539387857502 22.31560461615655 21.801304565980935 27.157551430005018 60-61 27.79937304075235 22.620689655172413 21.768025078369906 27.811912225705328 62-63 27.770812437311935 23.633400200601805 21.552156469408224 27.043630892678035 64-65 28.59473023839398 22.371392722710162 22.04516938519448 26.988707653701383 66-67 28.02308078273959 23.845960863020572 22.22779729051681 25.90316106372303 68-69 28.073256397390868 22.930255895634723 22.453587556447566 26.542900150526844 70-71 28.393977415307404 22.358845671267254 21.90715181932246 27.340025094102888 72-73 26.836336147158875 22.80458611566083 22.212422829784554 28.146654907395742 74-75 27.919391432003206 19.538235686640864 23.221673561991192 29.320699319364742 76 31.303724928366762 0.0 28.689111747851005 40.00716332378224 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.5 8 1.5 9 1.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 2.0 24 2.5 25 4.0 26 5.5 27 6.0 28 5.0 29 7.0 30 8.0 31 17.5 32 26.5 33 24.5 34 28.0 35 43.5 36 57.0 37 59.0 38 70.5 39 90.0 40 103.5 41 115.0 42 122.5 43 153.0 44 167.5 45 153.5 46 171.0 47 167.5 48 159.0 49 164.5 50 154.5 51 153.0 52 148.5 53 130.5 54 120.0 55 123.0 56 126.0 57 133.5 58 135.5 59 137.0 60 144.0 61 144.5 62 143.0 63 135.0 64 139.0 65 140.5 66 128.0 67 127.0 68 130.0 69 117.5 70 98.5 71 96.0 72 93.5 73 73.5 74 59.5 75 60.5 76 50.5 77 33.0 78 21.5 79 17.5 80 16.0 81 13.0 82 10.0 83 8.0 84 6.0 85 3.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 2.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.15 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.1 9 0.075 10-11 0.11249999999999999 12-13 0.17500000000000002 14-15 0.3 16-17 0.2625 18-19 0.27499999999999997 20-21 0.3875 22-23 0.22499999999999998 24-25 0.27499999999999997 26-27 0.3125 28-29 0.22499999999999998 30-31 0.2625 32-33 0.2625 34-35 0.22499999999999998 36-37 0.17513134851138354 38-39 0.21265949462096573 40-41 0.15011258443832876 42-43 0.175153259101714 44-45 0.21271271271271272 46-47 0.18773466833541927 48-49 0.2127659574468085 50-51 0.23785678517776665 52-53 0.1627441161742614 54-55 0.12520345561537496 56-57 0.11272545090180361 58-59 0.15030060120240482 60-61 0.11272545090180361 62-63 0.1002004008016032 64-65 0.15033826108744675 66-67 0.08773029201654342 68-69 0.0752068187515668 70-71 0.07522567703109327 72-73 0.10069225928256766 74-75 0.08001066808907854 76 0.1073345259391771 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 0.0 44 0.0 45 1.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 1.0 66 1.0 67 0.0 68 0.0 69 0.0 70 2.0 71 4.0 72 21.0 73 80.0 74 265.0 75 822.0 76 2795.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.72935196950444 97.125 2 1.0419313850063534 2.0500000000000003 3 0.12706480304955528 0.375 4 0.05082592121982211 0.2 5 0.05082592121982211 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 961659 spots for SRR11389896.sra Written 961659 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra Read 961655 spots for SRR11389896.sra Written 961655 spots for SRR11389896.sra SRR ids: ['SRR11389896.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7ibnriij SRR11389896.sra spots: 19233104 blocks: [[1, 961655], [961656, 1923310], [1923311, 2884965], [2884966, 3846620], [3846621, 4808275], [4808276, 5769930], [5769931, 6731585], [6731586, 7693240], [7693241, 8654895], [8654896, 9616550], [9616551, 10578205], [10578206, 11539860], [11539861, 12501515], [12501516, 13463170], [13463171, 14424825], [14424826, 15386480], [15386481, 16348135], [16348136, 17309790], [17309791, 18271445], [18271446, 19233104]] SRR11389896 file size 3662176 SRR11389896 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389896 SRR11389896_1.fastq SRR11389896_2.fastq Input file: SRR11389896_1.fastq Paired file: SRR11389896_2.fastq trimmed: SRR11389896-trimmed-pair1.fastq, SRR11389896-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:29:03 2024 >> started Sat Dec 7 09:31:32 2024 >> done (149.546s) 19233104 read pairs processed; of these: 1140 ( 0.01%) short read pairs filtered out after trimming by size control 11332 ( 0.06%) empty read pairs filtered out after trimming by size control 19220632 (99.94%) read pairs available; of these: 6071 ( 0.03%) trimmed read pairs available after processing 19214561 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 0 0.00% 21 2 0.00% 22 6 0.00% 23 7 0.00% 24 2 0.00% 25 5 0.00% 26 5 0.00% 27 6 0.00% 28 5 0.00% 29 6 0.00% 30 5 0.00% 31 5 0.00% 32 10 0.00% 33 10 0.00% 34 9 0.00% 35 142 0.00% 36 130 0.00% 37 164 0.00% 38 160 0.00% 39 182 0.00% 40 210 0.00% 41 213 0.00% 42 240 0.00% 43 250 0.00% 44 328 0.00% 45 322 0.00% 46 323 0.00% 47 338 0.00% 48 383 0.00% 49 422 0.00% 50 437 0.00% 51 430 0.00% 52 509 0.00% 53 510 0.00% 54 572 0.00% 55 691 0.00% 56 743 0.00% 57 890 0.00% 58 855 0.00% 59 975 0.01% 60 1023 0.01% 61 969 0.01% 62 1061 0.01% 63 1312 0.01% 64 1312 0.01% 65 1386 0.01% 66 1563 0.01% 67 1696 0.01% 68 1740 0.01% 69 2067 0.01% 70 2687 0.01% 71 4118 0.02% 72 16119 0.08% 73 148292 0.77% 74 1280781 6.66% 75 8228307 42.81% 76 9515694 49.51% 19220632 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=33 prefix-density=0.34 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=30 fanout-score=9.85 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=5.1 sequence=GCGCCGAGCATGGCCCA criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=5.28 fanout-score-rank=11 prefix-density=0.40 prefix-fanout=3.7 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.19 sequence-density-rank=14 fanout-score=107.95 fanout-score-rank=1 prefix-density=1.21 prefix-fanout=16.6 sequence=GCCGCCGCCGCCTCC SRR11389896 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:35:22 Started mapping on | Dec 07 09:35:23 Finished on | Dec 07 09:52:30 Mapping speed, Million of reads per hour | 67.38 Number of input reads | 19220632 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 17766551 Uniquely mapped reads % | 92.43% Average mapped length | 150.36 Number of splices: Total | 7998233 Number of splices: Annotated (sjdb) | 7672652 Number of splices: GT/AG | 7885297 Number of splices: GC/AG | 99940 Number of splices: AT/AC | 2685 Number of splices: Non-canonical | 10311 Mismatch rate per base, % | 0.83% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 703795 % of reads mapped to multiple loci | 3.66% Number of reads mapped to too many loci | 48593 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.80% % of reads unmapped: other | 0.85% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 750290 750290 750290 N_multimapping 703795 703795 703795 N_noFeature 419507 17322765 523392 N_ambiguous 436116 2013 99548 UnstrandedReadsAssigned:16910928 PositiveStrandReadsAssigned:441773 NegativeStrandReadsAssigned:17143611 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389896 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389896-trimmed-pair1.fastq SRR11389896-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,220,632 reads, 17,662,179 reads pseudoaligned [quant] estimated average fragment length: 224.073 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52973 SRR11389896.ke.tsv 35125 SRR11389896.se.tsv 88098 total ==> SRR11389896.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 713.164 0 0 PNS24247 1044 820.927 22.7077 1.99274 PNS24249 1928 1704.93 155.8 6.5833 PNS24246 1044 820.927 22.7077 1.99274 PNS24248 1044 820.927 22.7077 1.99274 PNS24244 1471 1247.93 26.0774 1.50542 PNS24243 293 91.3233 0 0 KQK14069 1603 1379.93 2679.55 139.89 KQK14071 474 253.504 183.511 52.1508 ==> SRR11389896.se.tsv <== BRADI_1g14170v3 3009 BRADI_1g53295v3 32 BRADI_1g59795v3 260 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 181 BRADI_1g74790v3 290 BRADI_1g09890v3 0 BRADI_1g77505v3 268 BRADI_1g48960v3 0 SRR11389896 completed mapping pipeline successfully