Starting /dee2/code/volunteer_pipeline.sh SRR11389897 current disk space = 1544237617152 free memory = 1605933684 SRR11389897 SRAfilesize b054b467e65a4cdb54de594e5283569b SRR11389897.sra SRR11389897.sra file validated SRR11389897 is paired end SRR11389897 is conventional basespace SRR11389897 read1 length is 53-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389897_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 53-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.32125 32.0 32.0 32.0 32.0 32.0 2 31.55175 32.0 32.0 32.0 32.0 32.0 3 31.38925 32.0 32.0 32.0 32.0 32.0 4 31.42925 32.0 32.0 32.0 32.0 32.0 5 31.5225 32.0 32.0 32.0 32.0 32.0 6 34.40175 36.0 36.0 36.0 32.0 36.0 7 34.54375 36.0 36.0 36.0 32.0 36.0 8 34.636 36.0 36.0 36.0 32.0 36.0 9 34.61725 36.0 36.0 36.0 32.0 36.0 10-11 34.546625000000006 36.0 36.0 36.0 32.0 36.0 12-13 34.68625 36.0 36.0 36.0 32.0 36.0 14-15 34.596125 36.0 36.0 36.0 32.0 36.0 16-17 34.534875 36.0 36.0 36.0 32.0 36.0 18-19 34.528875 36.0 36.0 36.0 32.0 36.0 20-21 34.524125 36.0 36.0 36.0 32.0 36.0 22-23 34.55275 36.0 36.0 36.0 32.0 36.0 24-25 34.478624999999994 36.0 36.0 36.0 32.0 36.0 26-27 34.416624999999996 36.0 36.0 36.0 32.0 36.0 28-29 34.220124999999996 36.0 36.0 36.0 32.0 36.0 30-31 34.21825 36.0 36.0 36.0 32.0 36.0 32-33 34.16275 36.0 36.0 36.0 32.0 36.0 34-35 34.060500000000005 36.0 36.0 36.0 32.0 36.0 36-37 34.011375 36.0 36.0 36.0 32.0 36.0 38-39 34.036 36.0 36.0 36.0 32.0 36.0 40-41 33.982375 36.0 36.0 36.0 32.0 36.0 42-43 33.942499999999995 36.0 36.0 36.0 32.0 36.0 44-45 33.825125 36.0 36.0 36.0 32.0 36.0 46-47 33.910250000000005 36.0 36.0 36.0 32.0 36.0 48-49 33.93962500000001 36.0 36.0 36.0 32.0 36.0 50-51 33.892875000000004 36.0 36.0 36.0 32.0 36.0 52-53 33.93025 36.0 36.0 36.0 32.0 36.0 54-55 33.601775443860966 36.0 36.0 36.0 27.0 36.0 56-57 33.75006251562891 36.0 36.0 36.0 32.0 36.0 58-59 33.87234308577145 36.0 36.0 36.0 32.0 36.0 60-61 33.331207801950484 36.0 36.0 36.0 24.0 36.0 62-63 33.42741516419625 36.0 36.0 36.0 27.0 36.0 64-65 33.246623311655824 36.0 36.0 36.0 27.0 36.0 66-67 33.12847135351514 36.0 34.0 36.0 24.0 36.0 68-69 32.99024268201151 36.0 32.0 36.0 24.0 36.0 70-71 32.94982482482483 36.0 32.0 36.0 24.0 36.0 72-73 32.93342574617888 36.0 32.0 36.0 21.0 36.0 74-75 32.940359949713475 36.0 32.0 36.0 24.0 36.0 76 32.04477611940298 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 4.0 25 8.0 26 20.0 27 46.0 28 48.0 29 87.0 30 139.0 31 245.0 32 386.0 33 596.0 34 1264.0 35 1156.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.4 10.15 8.575000000000001 42.875 2 27.900000000000002 9.75 39.375 22.975 3 26.400000000000002 16.175 21.025 36.4 4 32.05 23.225 16.950000000000003 27.775 5 30.975 26.674999999999997 21.0 21.349999999999998 6 24.5093105183694 28.636134876698538 22.99949672873679 23.855057876195268 7 19.125 22.95 34.8 23.125 8 20.0 20.75 31.775 27.474999999999998 9 22.325 17.925 32.7 27.05 10-11 25.2 27.375 21.987499999999997 25.4375 12-13 25.75 20.8125 24.474999999999998 28.962500000000002 14-15 25.662499999999998 22.912499999999998 25.6 25.825 16-17 25.837500000000002 23.575 23.9375 26.650000000000002 18-19 25.937500000000004 22.375 23.799999999999997 27.8875 20-21 25.7875 23.125 24.4 26.687499999999996 22-23 25.474999999999998 23.599999999999998 24.55 26.375 24-25 25.624999999999996 22.7625 23.3625 28.249999999999996 26-27 25.337500000000002 22.925 24.1375 27.6 28-29 25.874999999999996 23.7125 23.200000000000003 27.212500000000002 30-31 25.2375 23.2375 23.65 27.875 32-33 25.4625 23.2375 23.7125 27.5875 34-35 26.4625 23.05 23.8625 26.625 36-37 25.587500000000002 22.0625 23.925 28.425 38-39 26.137500000000003 24.2 23.1875 26.474999999999998 40-41 26.200000000000003 23.8875 22.7375 27.175 42-43 26.1125 23.3375 23.2375 27.3125 44-45 25.912499999999998 23.9 23.1125 27.075 46-47 26.0 23.925 22.6 27.474999999999998 48-49 26.5375 22.975 22.875 27.6125 50-51 25.9875 23.3375 23.3125 27.3625 52-53 26.924999999999997 23.1 23.2625 26.7125 54-55 25.456364091022753 22.36809202300575 23.730932733183295 28.444611152788195 56-57 24.706176544136035 23.393348337084273 24.36859214803701 27.53188297074269 58-59 25.056264066016503 23.53088272068017 23.568392098024507 27.84446111527882 60-61 26.131532883220803 23.23080770192548 22.18054513628407 28.457114278569644 62-63 26.04726772539702 23.22120795298237 23.40877829185945 27.32274602976116 64-65 26.050525262631314 23.59929964982491 22.698849424712357 27.651325662831418 66-67 26.032024018013512 22.842131598699027 23.329997498123593 27.795846885163872 68-69 26.28221165874406 22.95471603702777 23.2424318238679 27.52064048036027 70-71 26.93943943943944 23.523523523523522 22.722722722722725 26.814314314314313 72-73 26.678378717530432 21.94754674363157 22.77575605471201 28.59831848412599 74-75 25.416393442622955 20.262295081967213 24.249180327868853 30.072131147540983 76 30.49040511727079 0.0 31.449893390191896 38.059701492537314 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.5 20 1.5 21 1.0 22 2.0 23 1.5 24 1.0 25 2.5 26 2.5 27 5.5 28 9.0 29 9.5 30 13.5 31 15.5 32 19.0 33 24.0 34 32.5 35 54.0 36 68.5 37 71.5 38 83.0 39 107.0 40 121.5 41 127.0 42 138.5 43 163.5 44 189.0 45 195.5 46 182.0 47 174.5 48 179.5 49 178.0 50 165.0 51 150.0 52 156.0 53 153.5 54 137.0 55 128.5 56 137.0 57 132.0 58 109.5 59 123.5 60 129.5 61 116.0 62 116.5 63 119.5 64 110.5 65 112.5 66 117.5 67 106.0 68 94.5 69 76.5 70 71.0 71 70.5 72 67.0 73 61.0 74 52.5 75 50.0 76 44.0 77 37.5 78 28.5 79 20.5 80 20.5 81 18.0 82 11.0 83 7.0 84 5.5 85 4.0 86 2.5 87 1.5 88 1.5 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.65 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 0.0 69 1.0 70 0.0 71 7.0 72 9.0 73 51.0 74 233.0 75 882.0 76 2814.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83455789206992 97.52499999999999 2 1.064099315936154 2.1 3 0.07600709399543958 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.02533569799847986 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389897 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389897_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.952 32.0 32.0 32.0 32.0 32.0 2 30.6765 32.0 32.0 32.0 32.0 32.0 3 30.64325 32.0 32.0 32.0 32.0 32.0 4 30.6425 32.0 32.0 32.0 32.0 32.0 5 30.6335 32.0 32.0 32.0 32.0 32.0 6 33.8845 36.0 36.0 36.0 32.0 36.0 7 34.1015 36.0 36.0 36.0 32.0 36.0 8 33.94825 36.0 36.0 36.0 32.0 36.0 9 34.04775 36.0 36.0 36.0 32.0 36.0 10-11 33.719750000000005 36.0 36.0 36.0 32.0 36.0 12-13 33.7755 36.0 36.0 36.0 32.0 36.0 14-15 33.732875 36.0 36.0 36.0 29.5 36.0 16-17 33.615 36.0 36.0 36.0 29.5 36.0 18-19 33.707499999999996 36.0 36.0 36.0 32.0 36.0 20-21 33.548249999999996 36.0 36.0 36.0 27.0 36.0 22-23 33.5195 36.0 36.0 36.0 29.5 36.0 24-25 33.40075 36.0 36.0 36.0 27.0 36.0 26-27 33.3705 36.0 36.0 36.0 27.0 36.0 28-29 33.508875 36.0 36.0 36.0 27.0 36.0 30-31 33.343999999999994 36.0 36.0 36.0 27.0 36.0 32-33 33.467625 36.0 36.0 36.0 27.0 36.0 34-35 33.427125000000004 36.0 36.0 36.0 27.0 36.0 36-37 33.37640871525169 36.0 36.0 36.0 27.0 36.0 38-39 33.33608815426997 36.0 36.0 36.0 27.0 36.0 40-41 33.07062359128474 36.0 36.0 36.0 21.0 36.0 42-43 33.08727773603806 36.0 36.0 36.0 17.5 36.0 44-45 32.74092161282244 36.0 36.0 36.0 14.0 36.0 46-47 32.80440771349862 36.0 36.0 36.0 14.0 36.0 48-49 32.7443025294265 36.0 36.0 36.0 17.5 36.0 50-51 32.58039068369647 36.0 32.0 36.0 17.5 36.0 52-53 32.489857250187825 36.0 32.0 36.0 17.5 36.0 54-55 32.31254695717506 36.0 32.0 36.0 14.0 36.0 56-57 32.49674430252942 36.0 32.0 36.0 14.0 36.0 58-59 32.239544202354125 36.0 32.0 36.0 14.0 36.0 60-61 32.1694214876033 36.0 32.0 36.0 14.0 36.0 62-63 32.21138304031052 36.0 32.0 36.0 14.0 36.0 64-65 32.168211422845694 36.0 32.0 36.0 14.0 36.0 66-67 32.27010774242045 36.0 32.0 36.0 14.0 36.0 68-69 31.751566023552996 36.0 32.0 36.0 14.0 36.0 70-71 31.805741792435462 36.0 32.0 36.0 14.0 36.0 72-73 31.574157927449672 36.0 32.0 36.0 14.0 36.0 74-75 31.65429512845736 36.0 32.0 36.0 14.0 36.0 76 30.151146131805156 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 2.0 6 3.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 2.0 18 3.0 19 3.0 20 7.0 21 8.0 22 11.0 23 16.0 24 15.0 25 40.0 26 52.0 27 87.0 28 132.0 29 168.0 30 225.0 31 303.0 32 430.0 33 686.0 34 1157.0 35 639.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.470809320972187 20.79679278376347 8.819844650463542 38.912553244800804 2 29.062186559679038 22.642928786359075 31.3691073219659 16.925777331995988 3 24.64312546957175 25.19408965689958 20.2854996243426 29.877285249186077 4 28.875532181317304 30.553468569997495 17.20510894064613 23.36589030803907 5 30.227898822940148 31.05434510393188 18.782870022539445 19.93488605058853 6 24.793388429752067 32.60706235912848 18.732782369146005 23.86676684197345 7 23.94189832206361 15.852742299023289 32.40671174555472 27.798647633358375 8 24.248496993987974 20.66633266533066 24.69939879759519 30.38577154308617 9 24.74330077635863 19.93488605058853 25.870272977710997 29.451540195341845 10-11 28.473005135913816 26.418639609169485 19.165727170236753 25.942628084679946 12-13 27.921263791374123 20.561685055165498 22.668004012036107 28.849047141424272 14-15 26.598946576373212 23.08753448708302 23.6267870579383 26.686731878605467 16-17 28.2041635314773 22.598444946074743 22.071733132681214 27.125658389766745 18-19 26.373902132998744 22.44667503136763 22.383939774153074 28.795483061480553 20-21 27.358372063811082 22.949378218816733 22.509734957919857 27.18251475945233 22-23 27.43007650821523 22.70161796061708 21.93653580835319 27.931769722814497 24-25 26.439232409381663 23.71754672018061 22.099586103097955 27.74363476733977 26-27 27.809834420471653 23.30657300551932 22.139989964877067 26.743602609131962 28-29 27.65237020316027 23.150238274391775 21.46977677451718 27.727614747930772 30-31 26.674191121143714 24.003009781790823 22.20968146476047 27.113117632304988 32-33 26.743602609131962 23.670346211741094 22.905168088309082 26.680883090817865 34-35 28.048168590065224 22.641746111389864 21.38735574510788 27.92272955343703 36-37 27.476799598695763 22.598444946074743 22.385252069224983 27.539503386004515 38-39 27.722027094831915 23.569994982438537 22.027094831911693 26.680883090817865 40-41 26.4233759719087 23.413594181088538 22.397792826686732 27.765237020316025 42-43 27.13819914722849 23.27564584900928 22.134436919989966 27.45171808377226 44-45 26.85312931142606 23.692462059450644 22.5511099962373 26.903298632885992 46-47 27.379907186755297 23.26602282704126 21.79857017433839 27.55549981186504 48-49 27.59312680295999 22.88975291609181 21.221622977549227 28.29549730339897 50-51 27.214554579673777 23.613550815558344 22.04516938519448 27.1267252195734 52-53 27.765237020316025 23.927765237020317 20.70479056935039 27.60220717331327 54-55 27.389014296463504 23.401053423626784 21.65788813644344 27.552044143466265 56-57 27.67398119122257 23.0846394984326 21.341692789968654 27.89968652037618 58-59 28.429897165788816 22.56082267368949 22.02157010283421 26.987710057687487 60-61 26.996865203761754 23.03448275862069 21.56739811912226 28.4012539184953 62-63 27.57366771159875 23.435736677115987 22.0564263322884 26.934169278996865 64-65 28.157531669384174 23.679919729085665 21.02094569170952 27.141602909820644 66-67 27.370797792272956 23.331660812844955 22.08981435022579 27.2077270446563 68-69 27.471149021575513 22.729553437029605 22.742097340692425 27.057200200702457 70-71 29.58965993223742 21.972643995482493 21.771865980675116 26.66583009160497 72-73 27.03997982091058 22.33572960020179 22.386177323748267 28.238113255139364 74-75 28.070876632027712 19.997335464961363 23.967492672528643 27.964295230482282 76 30.104054538930754 0.0 29.852888410477213 40.04305705059203 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 3.5 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.5 8 1.0 9 2.0 10 1.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 2.0 22 2.0 23 1.5 24 2.0 25 1.5 26 2.0 27 5.5 28 8.0 29 7.0 30 7.5 31 12.0 32 18.0 33 21.0 34 20.5 35 33.5 36 54.5 37 66.5 38 71.0 39 89.0 40 113.0 41 137.5 42 161.5 43 172.0 44 181.0 45 176.5 46 168.0 47 153.0 48 145.5 49 162.5 50 177.5 51 164.0 52 133.5 53 128.0 54 129.5 55 130.5 56 139.5 57 138.0 58 130.5 59 138.5 60 144.0 61 145.0 62 147.5 63 138.5 64 126.5 65 112.0 66 105.5 67 102.0 68 97.0 69 104.5 70 103.5 71 91.5 72 78.5 73 62.0 74 60.5 75 63.5 76 55.0 77 44.0 78 27.0 79 16.5 80 18.0 81 14.5 82 10.5 83 9.0 84 5.5 85 3.0 86 2.0 87 1.0 88 0.5 89 0.0 90 0.5 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 2.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.3 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.17500000000000002 7 0.17500000000000002 8 0.2 9 0.17500000000000002 10-11 0.21250000000000002 12-13 0.3 14-15 0.325 16-17 0.325 18-19 0.375 20-21 0.4875 22-23 0.3375 24-25 0.3375 26-27 0.35000000000000003 28-29 0.325 30-31 0.325 32-33 0.35000000000000003 34-35 0.35000000000000003 36-37 0.15026296018031557 38-39 0.1753067868770348 40-41 0.15026296018031557 42-43 0.15026296018031557 44-45 0.16278487352867518 46-47 0.16278487352867518 48-49 0.16278487352867518 50-51 0.20035061357375405 52-53 0.15026296018031557 54-55 0.15026296018031557 56-57 0.13774104683195593 58-59 0.15026296018031557 60-61 0.13774104683195593 62-63 0.12523481527864747 64-65 0.1377755511022044 66-67 0.12528188423953898 68-69 0.12528188423953898 70-71 0.12532898859506206 72-73 0.1385390428211587 74-75 0.13304949441192124 76 0.17908309455587393 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 7.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 0.0 69 1.0 70 1.0 71 7.0 72 24.0 73 67.0 74 266.0 75 833.0 76 2792.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.65277071682766 97.02499999999999 2 1.1438739196746313 2.25 3 0.1525165226232842 0.44999999999999996 4 0.02541942043721403 0.1 5 0.0 0.0 6 0.0 0.0 7 0.02541942043721403 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986802 spots for SRR11389897.sra Written 986802 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra Read 986793 spots for SRR11389897.sra Written 986793 spots for SRR11389897.sra SRR ids: ['SRR11389897.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_647v2n6u SRR11389897.sra spots: 19735869 blocks: [[1, 986793], [986794, 1973586], [1973587, 2960379], [2960380, 3947172], [3947173, 4933965], [4933966, 5920758], [5920759, 6907551], [6907552, 7894344], [7894345, 8881137], [8881138, 9867930], [9867931, 10854723], [10854724, 11841516], [11841517, 12828309], [12828310, 13815102], [13815103, 14801895], [14801896, 15788688], [15788689, 16775481], [16775482, 17762274], [17762275, 18749067], [18749068, 19735869]] SRR11389897 file size 3758478 SRR11389897 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389897 SRR11389897_1.fastq SRR11389897_2.fastq Input file: SRR11389897_1.fastq Paired file: SRR11389897_2.fastq trimmed: SRR11389897-trimmed-pair1.fastq, SRR11389897-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:27:24 2024 >> started Sat Dec 7 09:27:41 2024 >> done (17.384s) 19735869 read pairs processed; of these: 1155 ( 0.01%) short read pairs filtered out after trimming by size control 7301 ( 0.04%) empty read pairs filtered out after trimming by size control 19727413 (99.96%) read pairs available; of these: 5256 ( 0.03%) trimmed read pairs available after processing 19722157 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 6 0.00% 21 4 0.00% 22 9 0.00% 23 10 0.00% 24 10 0.00% 25 16 0.00% 26 14 0.00% 27 15 0.00% 28 17 0.00% 29 17 0.00% 30 12 0.00% 31 28 0.00% 32 27 0.00% 33 24 0.00% 34 28 0.00% 35 209 0.00% 36 170 0.00% 37 193 0.00% 38 261 0.00% 39 248 0.00% 40 305 0.00% 41 298 0.00% 42 335 0.00% 43 362 0.00% 44 401 0.00% 45 379 0.00% 46 376 0.00% 47 461 0.00% 48 456 0.00% 49 516 0.00% 50 524 0.00% 51 551 0.00% 52 610 0.00% 53 692 0.00% 54 701 0.00% 55 831 0.00% 56 865 0.00% 57 955 0.00% 58 1042 0.01% 59 1079 0.01% 60 1113 0.01% 61 1197 0.01% 62 1263 0.01% 63 1394 0.01% 64 1516 0.01% 65 1703 0.01% 66 1893 0.01% 67 2040 0.01% 68 1944 0.01% 69 2240 0.01% 70 2984 0.02% 71 4565 0.02% 72 17108 0.09% 73 153739 0.78% 74 1313368 6.66% 75 8448482 42.83% 76 9757800 49.46% 19727413 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=15 prefix-density=0.52 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=109.38 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=16.3 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=26 prefix-density=0.32 prefix-fanout=2.1 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.14 sequence-density-rank=20 fanout-score=163.77 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=22.1 sequence=CCGCCGCCGCCTCC SRR11389897 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:28:06 Started mapping on | Dec 07 09:28:06 Finished on | Dec 07 09:29:15 Mapping speed, Million of reads per hour | 1029.26 Number of input reads | 19727413 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 18273373 Uniquely mapped reads % | 92.63% Average mapped length | 150.35 Number of splices: Total | 8591437 Number of splices: Annotated (sjdb) | 8234485 Number of splices: GT/AG | 8466044 Number of splices: GC/AG | 111401 Number of splices: AT/AC | 3074 Number of splices: Non-canonical | 10918 Mismatch rate per base, % | 0.85% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.00% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 787011 % of reads mapped to multiple loci | 3.99% Number of reads mapped to too many loci | 31562 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.64% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 667035 667035 667035 N_multimapping 787011 787011 787011 N_noFeature 418522 17802542 558983 N_ambiguous 434051 2346 107243 UnstrandedReadsAssigned:17420800 PositiveStrandReadsAssigned:468485 NegativeStrandReadsAssigned:17607147 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389897 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389897-trimmed-pair1.fastq SRR11389897-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,727,413 reads, 18,220,146 reads pseudoaligned [quant] estimated average fragment length: 223.332 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 SRR11389897.ke.tsv 35125 SRR11389897.se.tsv 88098 total ==> SRR11389897.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 713.851 9.24075 0.932955 PNS24247 1044 821.668 35.6346 3.12563 PNS24249 1928 1705.67 157.244 6.64418 PNS24246 1044 821.668 35.6346 3.12563 PNS24248 1044 821.668 35.6346 3.12563 PNS24244 1471 1248.67 38.6112 2.22857 PNS24243 293 93.0553 0 0 KQK14069 1603 1380.67 5950.27 310.605 KQK14071 474 254.34 331.552 93.9501 ==> SRR11389897.se.tsv <== BRADI_1g14170v3 6672 BRADI_1g53295v3 27 BRADI_1g59795v3 134 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 186 BRADI_1g74790v3 405 BRADI_1g09890v3 0 BRADI_1g77505v3 217 BRADI_1g48960v3 0 SRR11389897 completed mapping pipeline successfully