Starting /dee2/code/volunteer_pipeline.sh SRR11389898 current disk space = 1544219357184 free memory = 1601973152 SRR11389898 SRAfilesize 28ce27280dff0d84ae50dc2e950bba42 SRR11389898.sra SRR11389898.sra file validated SRR11389898 is paired end SRR11389898 is conventional basespace SRR11389898 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389898_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.32925 32.0 32.0 32.0 32.0 32.0 2 31.454 32.0 32.0 32.0 32.0 32.0 3 31.2745 32.0 32.0 32.0 32.0 32.0 4 31.26975 32.0 32.0 32.0 32.0 32.0 5 31.43025 32.0 32.0 32.0 32.0 32.0 6 34.4565 36.0 36.0 36.0 32.0 36.0 7 34.57175 36.0 36.0 36.0 32.0 36.0 8 34.63875 36.0 36.0 36.0 32.0 36.0 9 34.645 36.0 36.0 36.0 32.0 36.0 10-11 34.58525 36.0 36.0 36.0 32.0 36.0 12-13 34.639375 36.0 36.0 36.0 32.0 36.0 14-15 34.616749999999996 36.0 36.0 36.0 32.0 36.0 16-17 34.542500000000004 36.0 36.0 36.0 32.0 36.0 18-19 34.5625 36.0 36.0 36.0 32.0 36.0 20-21 34.591375 36.0 36.0 36.0 32.0 36.0 22-23 34.427875 36.0 36.0 36.0 32.0 36.0 24-25 34.33375 36.0 36.0 36.0 32.0 36.0 26-27 34.274249999999995 36.0 36.0 36.0 32.0 36.0 28-29 34.127875 36.0 36.0 36.0 32.0 36.0 30-31 34.120875 36.0 36.0 36.0 32.0 36.0 32-33 34.099125 36.0 36.0 36.0 32.0 36.0 34-35 34.150375 36.0 36.0 36.0 32.0 36.0 36-37 34.078394598649666 36.0 36.0 36.0 32.0 36.0 38-39 33.97386846711677 36.0 36.0 36.0 32.0 36.0 40-41 34.039009752438105 36.0 36.0 36.0 32.0 36.0 42-43 33.98336668334167 36.0 36.0 36.0 32.0 36.0 44-45 33.855552776388194 36.0 36.0 36.0 32.0 36.0 46-47 33.85992996498249 36.0 36.0 36.0 32.0 36.0 48-49 33.84254157977162 36.0 36.0 36.0 32.0 36.0 50-51 33.728921691268454 36.0 36.0 36.0 32.0 36.0 52-53 33.66925193895422 36.0 36.0 36.0 32.0 36.0 54-55 33.71778834125594 36.0 36.0 36.0 27.0 36.0 56-57 33.68751563672755 36.0 36.0 36.0 29.5 36.0 58-59 33.59894921190893 36.0 36.0 36.0 29.5 36.0 60-61 33.26820115086315 36.0 36.0 36.0 27.0 36.0 62-63 33.42244183137353 36.0 36.0 36.0 27.0 36.0 64-65 33.20165123842882 36.0 36.0 36.0 24.0 36.0 66-67 32.936939347403445 36.0 32.0 36.0 21.0 36.0 68-69 32.91591591591592 36.0 32.0 36.0 24.0 36.0 70-71 32.88804806658886 36.0 32.0 36.0 21.0 36.0 72-73 33.02638535459429 36.0 34.0 36.0 24.0 36.0 74-75 32.93058154356 36.0 32.0 36.0 24.0 36.0 76 32.00177367860944 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 4.0 25 10.0 26 20.0 27 39.0 28 58.0 29 108.0 30 142.0 31 254.0 32 369.0 33 615.0 34 1230.0 35 1149.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.75893973493373 10.37759439859965 9.177294323580895 44.686171542885724 2 26.93173293323331 10.652663165791449 38.834708677169296 23.58089522380595 3 25.78144536134033 16.054013503375845 20.605151287821954 37.559389847461865 4 30.607651912978245 24.381095273818453 18.37959489872468 26.63165791447862 5 30.38259564891223 27.906976744186046 21.530382595648913 20.180045011252815 6 24.748490945674046 27.842052313883297 24.245472837022135 23.163983903420522 7 18.229557389347338 23.43085771442861 36.05901475368842 22.280570142535634 8 19.904976244061015 21.80545136284071 32.65816454113528 25.63140785196299 9 20.880220055013755 18.67966991747937 32.208052013003254 28.232058014503625 10-11 25.1937984496124 28.132033008252062 22.255563890972745 24.418604651162788 12-13 25.29382345586397 21.8304576144036 24.36859214803701 28.507126781695426 14-15 24.656164041010253 23.58089522380595 25.681420355088775 26.081520380095025 16-17 25.818954738684667 23.393348337084273 23.943485871467868 26.84421105276319 18-19 25.468867216804203 24.081020255063766 23.593398349587396 26.85671417854464 20-21 24.681170292573142 24.093523380845213 24.85621405351338 26.36909227306827 22-23 25.28132033008252 23.455863965991497 24.406101525381345 26.85671417854464 24-25 25.49387346836709 23.168292073018254 23.668417104276067 27.66941735433858 26-27 24.456114028507127 23.380845211302827 25.51887971992998 26.644161040260066 28-29 25.381345336334082 23.48087021755439 24.006001500375092 27.131782945736433 30-31 25.581395348837212 22.780695173793447 23.830957739434858 27.806951737934483 32-33 25.168792198049513 23.36834208552138 24.88122030507627 26.581645411352838 34-35 25.30632658164541 23.48087021755439 23.80595148787197 27.406851712928233 36-37 25.331332833208304 22.943235808952238 24.48112028007002 27.24431107776944 38-39 26.081520380095025 23.55588897224306 24.456114028507127 25.906476619154787 40-41 25.006251562890725 23.355838959739934 23.74343585896474 27.894473618404604 42-43 25.975487743871934 22.311155577788895 24.149574787393696 27.56378189094547 44-45 25.400200100050025 23.04902451225613 24.212106053026513 27.33866933466733 46-47 25.46273136568284 23.411705852926463 24.287143571785894 26.8384192096048 48-49 26.028767979987492 23.12695434646654 23.402126328955596 27.44215134459037 50-51 25.23142356767576 24.193144858643983 23.642732049036777 26.932699524643482 52-53 25.74430823117338 23.992994746059544 22.9672254190643 27.295471603702776 54-55 25.856892669502123 23.642732049036777 22.66700025018764 27.833375031273455 56-57 25.39404553415061 23.05479109331999 24.55591693770328 26.99524643482612 58-59 26.444833625218916 22.566925193895422 23.042281711283465 27.9459594696022 60-61 25.956967725794343 23.00475356517388 24.11808856642482 26.920190142606952 62-63 25.13134851138354 23.73029772329247 24.168126094570926 26.970227670753065 64-65 26.932699524643482 22.992244183137352 23.15486614961221 26.920190142606952 66-67 25.572375828850248 22.93256599524584 23.97097460277743 27.524083573126486 68-69 26.476476476476474 22.535035035035033 23.94894894894895 27.039539539539543 70-71 25.64487853744052 23.153017781116954 23.954420235411973 27.247683446030553 72-73 25.839305922293477 22.519803847604678 22.89701999245568 28.743870237646167 74-75 26.937907193192395 20.396223906395424 24.996675973939634 27.66919292647254 76 28.875487761617595 0.0 32.67115998581057 38.45335225257183 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 2.0 21 4.0 22 3.5 23 1.5 24 0.0 25 0.0 26 3.5 27 6.0 28 9.0 29 18.0 30 18.0 31 17.0 32 25.5 33 31.5 34 31.5 35 38.0 36 57.5 37 78.0 38 102.0 39 112.5 40 130.5 41 158.0 42 165.5 43 176.0 44 199.5 45 219.0 46 221.0 47 205.5 48 183.0 49 171.5 50 163.5 51 153.0 52 140.5 53 138.5 54 145.5 55 134.5 56 114.0 57 123.0 58 137.0 59 140.0 60 139.0 61 121.5 62 109.0 63 107.5 64 109.0 65 95.5 66 83.0 67 88.5 68 89.5 69 77.5 70 65.5 71 63.5 72 68.0 73 62.5 74 50.5 75 45.5 76 35.0 77 28.0 78 28.0 79 25.5 80 20.5 81 15.5 82 11.5 83 9.5 84 7.0 85 2.5 86 1.5 87 2.0 88 2.0 89 1.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.6 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 2.0 70 2.0 71 10.0 72 11.0 73 71.0 74 279.0 75 802.0 76 2819.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.31804281345565 96.45 2 1.452599388379205 2.85 3 0.20387359836901123 0.6 4 0.025484199796126403 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389898 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389898_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.92625 32.0 32.0 32.0 32.0 32.0 2 30.63975 32.0 32.0 32.0 32.0 32.0 3 30.594 32.0 32.0 32.0 32.0 32.0 4 30.60225 32.0 32.0 32.0 32.0 32.0 5 30.71025 32.0 32.0 32.0 32.0 32.0 6 33.71275 36.0 36.0 36.0 32.0 36.0 7 33.86625 36.0 36.0 36.0 32.0 36.0 8 33.68225 36.0 36.0 36.0 32.0 36.0 9 33.86675 36.0 36.0 36.0 32.0 36.0 10-11 33.610875 36.0 36.0 36.0 32.0 36.0 12-13 33.755250000000004 36.0 36.0 36.0 32.0 36.0 14-15 33.610875 36.0 36.0 36.0 29.5 36.0 16-17 33.711125 36.0 36.0 36.0 32.0 36.0 18-19 33.67675 36.0 36.0 36.0 32.0 36.0 20-21 33.35425 36.0 36.0 36.0 27.0 36.0 22-23 33.48025 36.0 36.0 36.0 29.5 36.0 24-25 33.353625 36.0 36.0 36.0 27.0 36.0 26-27 33.375 36.0 36.0 36.0 24.0 36.0 28-29 33.46325 36.0 36.0 36.0 27.0 36.0 30-31 33.243625 36.0 36.0 36.0 24.0 36.0 32-33 33.16425 36.0 36.0 36.0 20.5 36.0 34-35 33.276875000000004 36.0 36.0 36.0 24.0 36.0 36-37 33.34755944931164 36.0 36.0 36.0 27.0 36.0 38-39 33.34643304130162 36.0 36.0 36.0 24.0 36.0 40-41 32.96332916145182 36.0 34.0 36.0 14.0 36.0 42-43 33.249499248873306 36.0 36.0 36.0 24.0 36.0 44-45 32.94629444166249 36.0 36.0 36.0 21.0 36.0 46-47 32.64471707561342 36.0 36.0 36.0 14.0 36.0 48-49 32.74558764016298 36.0 36.0 36.0 14.0 36.0 50-51 32.43137991485099 36.0 32.0 36.0 14.0 36.0 52-53 32.592411720510896 36.0 32.0 36.0 21.0 36.0 54-55 32.337716003005255 36.0 32.0 36.0 14.0 36.0 56-57 32.514525419484094 36.0 32.0 36.0 14.0 36.0 58-59 32.12484347608314 36.0 32.0 36.0 14.0 36.0 60-61 32.19258702729777 36.0 32.0 36.0 14.0 36.0 62-63 32.138492361632856 36.0 32.0 36.0 14.0 36.0 64-65 32.06173303280741 36.0 32.0 36.0 14.0 36.0 66-67 32.14377098173306 36.0 32.0 36.0 14.0 36.0 68-69 31.79609218436874 36.0 32.0 36.0 14.0 36.0 70-71 31.68152279533114 36.0 32.0 36.0 14.0 36.0 72-73 31.63336060516832 36.0 32.0 36.0 14.0 36.0 74-75 31.566156654558764 36.0 32.0 36.0 14.0 36.0 76 30.431575196008552 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 2.0 17 0.0 18 5.0 19 6.0 20 7.0 21 8.0 22 10.0 23 16.0 24 36.0 25 38.0 26 48.0 27 86.0 28 126.0 29 178.0 30 220.0 31 319.0 32 451.0 33 685.0 34 1127.0 35 622.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.97746055597295 21.187077385424494 7.988980716253444 40.84648134234911 2 29.008016032064127 25.100200400801604 29.13326653306613 16.758517034068134 3 24.005006257822277 27.384230287859822 20.275344180225282 28.335419274092615 4 28.410513141426787 31.639549436795996 17.04630788485607 22.90362953692115 5 30.58823529411765 31.1639549436796 18.32290362953692 19.924906132665832 6 23.554443053817273 33.917396745932415 19.67459324155194 22.853566958698373 7 22.703379224030037 17.246558197747184 33.141426783479346 26.90863579474343 8 24.636955433149723 21.657486229344016 23.71056584877316 29.994992488733104 9 24.755944931163956 21.051314142678347 26.5081351689612 27.684605757196497 10-11 28.97734384779071 26.123419702090374 18.5505069470522 26.348729503066714 12-13 27.07237665915352 21.7129977460556 22.827448034059607 28.38717756073128 14-15 26.150181772596216 24.382599974927917 22.414441519368182 27.052776733107684 16-17 27.359318210302042 22.897606216317833 22.54668504825166 27.19639052512846 18-19 27.53477879433513 22.596816643689685 22.772277227722775 27.09612733425241 20-21 27.770109173045554 22.80085330656293 22.625172543606475 26.803864976785043 22-23 27.158791828549944 24.978067426995864 21.343526757739063 26.51961398671513 24-25 26.72348959639007 24.51742291301078 21.910253196289798 26.84883429430935 26-27 26.660817247430437 23.539734269240412 23.113562296314864 26.68588618701429 28-29 27.146258929690436 22.534152149392153 22.296027071061538 28.02356184985587 30-31 27.192982456140353 22.45614035087719 23.082706766917294 27.268170426065165 32-33 27.751316119328152 23.965906242165957 22.3614941087992 25.921283529706695 34-35 26.560541489095012 23.82802707445475 22.92554524943595 26.68588618701429 36-37 27.44360902255639 23.358395989974937 21.81704260651629 27.380952380952383 38-39 28.415643018300322 23.21383805465029 22.248683880671845 26.12183504637754 40-41 27.25563909774436 23.671679197994987 22.19298245614035 26.879699248120303 42-43 26.97417899222863 24.32940586613186 22.850338430684385 25.846076710955128 44-45 27.118856569709127 24.54864593781344 21.70260782347041 26.629889669007024 46-47 27.027704650871254 24.47035226275542 21.988216121348877 26.513726965024446 48-49 27.21003134796238 23.836990595611283 22.094043887147336 26.858934169278996 50-51 27.302383939774156 24.303638644918443 22.082810539523212 26.311166875784192 52-53 27.369608826479435 23.696088264794383 22.141424272818455 26.792878635907723 54-55 28.021564694082247 23.68355065195587 22.141424272818455 26.15346038114343 56-57 26.983331244516854 23.687178844466725 23.13573129464845 26.19375861636797 58-59 27.90872617853561 24.059679037111334 21.915747241725175 26.115847542627886 60-61 27.719298245614034 23.734335839598998 21.67919799498747 26.8671679197995 62-63 27.465229921062523 23.16752286680867 22.75404084701165 26.613206365117154 64-65 27.813988468287793 24.166457758836803 21.333667585861118 26.68588618701429 66-67 28.32978323518356 23.60606440295702 21.977195840120288 26.08695652173913 68-69 27.468671679197993 23.195488721804512 22.305764411027567 27.030075187969928 70-71 27.924764890282134 23.385579937304072 22.783699059561126 25.905956112852664 72-73 26.6473478644324 22.212422829784554 23.056570492629458 28.083658813153583 74-75 27.45618693574084 20.671800318640468 24.243228890069037 27.628783855549656 76 29.055258467023172 0.0 31.76470588235294 39.180035650623886 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 0.5 20 1.0 21 2.5 22 3.5 23 3.0 24 3.0 25 4.0 26 3.5 27 3.5 28 6.0 29 9.5 30 12.5 31 15.0 32 16.0 33 18.0 34 24.0 35 39.0 36 57.5 37 68.0 38 81.0 39 97.0 40 114.5 41 131.5 42 145.5 43 164.0 44 181.5 45 184.0 46 173.0 47 175.0 48 175.5 49 168.0 50 168.5 51 159.5 52 134.0 53 131.0 54 143.5 55 139.0 56 134.0 57 136.0 58 145.5 59 148.5 60 148.0 61 142.5 62 126.5 63 121.0 64 123.0 65 116.0 66 107.5 67 104.0 68 98.5 69 88.0 70 86.5 71 91.0 72 81.5 73 66.5 74 54.0 75 46.0 76 41.0 77 32.5 78 20.5 79 14.5 80 12.5 81 10.0 82 7.5 83 4.5 84 3.5 85 2.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 1.0 97 0.5 98 0.0 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.2 3 0.125 4 0.125 5 0.125 6 0.125 7 0.125 8 0.15 9 0.125 10-11 0.13749999999999998 12-13 0.17500000000000002 14-15 0.2875 16-17 0.2625 18-19 0.2625 20-21 0.3875 22-23 0.2625 24-25 0.27499999999999997 26-27 0.27499999999999997 28-29 0.2625 30-31 0.25 32-33 0.27499999999999997 34-35 0.27499999999999997 36-37 0.1251564455569462 38-39 0.1501877346683354 40-41 0.1251564455569462 42-43 0.12518778167250877 44-45 0.15022533800701052 46-47 0.13770655983975966 48-49 0.15024414673845 50-51 0.20035061357375405 52-53 0.12521913348359628 54-55 0.12521913348359628 56-57 0.0876533934385174 58-59 0.12521913348359628 60-61 0.07513148009015778 62-63 0.06260956674179814 64-65 0.10017530678687703 66-67 0.050093926111458985 68-69 0.0501002004008016 70-71 0.025072082236429732 72-73 0.05037148973680896 74-75 0.026546323334218212 76 0.03563791874554526 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 1.0 70 5.0 71 4.0 72 23.0 73 62.0 74 260.0 75 831.0 76 2806.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.52417302798983 96.8 2 1.2468193384223918 2.45 3 0.178117048346056 0.525 4 0.02544529262086514 0.1 5 0.02544529262086514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024455 spots for SRR11389898.sra Written 1024455 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra Read 1024447 spots for SRR11389898.sra Written 1024447 spots for SRR11389898.sra SRR ids: ['SRR11389898.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6evxnc8u SRR11389898.sra spots: 20488948 blocks: [[1, 1024447], [1024448, 2048894], [2048895, 3073341], [3073342, 4097788], [4097789, 5122235], [5122236, 6146682], [6146683, 7171129], [7171130, 8195576], [8195577, 9220023], [9220024, 10244470], [10244471, 11268917], [11268918, 12293364], [12293365, 13317811], [13317812, 14342258], [14342259, 15366705], [15366706, 16391152], [16391153, 17415599], [17415600, 18440046], [18440047, 19464493], [19464494, 20488948]] SRR11389898 file size 3902904 SRR11389898 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389898 SRR11389898_1.fastq SRR11389898_2.fastq Input file: SRR11389898_1.fastq Paired file: SRR11389898_2.fastq trimmed: SRR11389898-trimmed-pair1.fastq, SRR11389898-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:28:47 2024 >> started Sat Dec 7 09:29:04 2024 >> done (17.450s) 20488948 read pairs processed; of these: 1181 ( 0.01%) short read pairs filtered out after trimming by size control 4762 ( 0.02%) empty read pairs filtered out after trimming by size control 20483005 (99.97%) read pairs available; of these: 4684 ( 0.02%) trimmed read pairs available after processing 20478321 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 1 0.00% 24 2 0.00% 25 1 0.00% 26 3 0.00% 27 3 0.00% 28 5 0.00% 29 4 0.00% 30 7 0.00% 31 5 0.00% 32 3 0.00% 33 5 0.00% 34 8 0.00% 35 117 0.00% 36 140 0.00% 37 144 0.00% 38 152 0.00% 39 155 0.00% 40 197 0.00% 41 216 0.00% 42 223 0.00% 43 270 0.00% 44 271 0.00% 45 272 0.00% 46 289 0.00% 47 357 0.00% 48 353 0.00% 49 373 0.00% 50 384 0.00% 51 464 0.00% 52 501 0.00% 53 505 0.00% 54 556 0.00% 55 659 0.00% 56 680 0.00% 57 802 0.00% 58 782 0.00% 59 911 0.00% 60 982 0.00% 61 959 0.00% 62 1068 0.01% 63 1173 0.01% 64 1270 0.01% 65 1366 0.01% 66 1488 0.01% 67 1732 0.01% 68 1673 0.01% 69 2004 0.01% 70 2595 0.01% 71 4294 0.02% 72 18494 0.09% 73 161998 0.79% 74 1363955 6.66% 75 8850513 43.21% 76 10057618 49.10% 20483005 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=23 prefix-density=0.73 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=10.26 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.0 sequence=TTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGATCTCCCC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=19 prefix-density=0.65 prefix-fanout=2.0 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.16 sequence-density-rank=22 fanout-score=123.79 fanout-score-rank=1 prefix-density=1.17 prefix-fanout=17.1 sequence=GCCGCCGCCGCC SRR11389898 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:29:32 Started mapping on | Dec 07 09:29:32 Finished on | Dec 07 09:31:05 Mapping speed, Million of reads per hour | 792.89 Number of input reads | 20483005 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 18750449 Uniquely mapped reads % | 91.54% Average mapped length | 150.36 Number of splices: Total | 8940912 Number of splices: Annotated (sjdb) | 8558909 Number of splices: GT/AG | 8816085 Number of splices: GC/AG | 110768 Number of splices: AT/AC | 2717 Number of splices: Non-canonical | 11342 Mismatch rate per base, % | 0.84% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 991131 % of reads mapped to multiple loci | 4.84% Number of reads mapped to too many loci | 44116 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.64% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 741430 741430 741430 N_multimapping 991131 991131 991131 N_noFeature 493008 18300160 607285 N_ambiguous 455693 2257 124062 UnstrandedReadsAssigned:17801748 PositiveStrandReadsAssigned:448032 NegativeStrandReadsAssigned:18019102 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389898 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389898-trimmed-pair1.fastq SRR11389898-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,483,005 reads, 18,806,078 reads pseudoaligned [quant] estimated average fragment length: 216.955 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR11389898.ke.tsv 35125 SRR11389898.se.tsv 88098 total ==> SRR11389898.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 720.254 0 0 PNS24247 1044 828.045 45.5465 3.85724 PNS24249 1928 1712.04 147.117 6.02594 PNS24246 1044 828.045 45.5465 3.85724 PNS24248 1044 828.045 45.5465 3.85724 PNS24244 1471 1255.04 28.2432 1.57808 PNS24243 293 98.7083 0 0 KQK14069 1603 1387.04 4566.68 230.88 KQK14071 474 260.988 240.839 64.7114 ==> SRR11389898.se.tsv <== BRADI_1g14170v3 5085 BRADI_1g53295v3 8 BRADI_1g59795v3 268 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 169 BRADI_1g74790v3 311 BRADI_1g09890v3 0 BRADI_1g77505v3 249 BRADI_1g48960v3 0 SRR11389898 completed mapping pipeline successfully