Starting /dee2/code/volunteer_pipeline.sh SRR11389899 current disk space = 1544202649600 free memory = 1474823904 SRR11389899 SRAfilesize 7a4cfd66b3092466897af9020eb57676 SRR11389899.sra SRR11389899.sra file validated SRR11389899 is paired end SRR11389899 is conventional basespace SRR11389899 read1 length is 49-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389899_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.32375 32.0 32.0 32.0 32.0 32.0 2 31.5235 32.0 32.0 32.0 32.0 32.0 3 31.38925 32.0 32.0 32.0 32.0 32.0 4 31.50275 32.0 32.0 32.0 32.0 32.0 5 31.577 32.0 32.0 32.0 32.0 32.0 6 34.6025 36.0 36.0 36.0 32.0 36.0 7 34.9105 36.0 36.0 36.0 32.0 36.0 8 34.91875 36.0 36.0 36.0 32.0 36.0 9 34.772 36.0 36.0 36.0 32.0 36.0 10-11 34.821375 36.0 36.0 36.0 32.0 36.0 12-13 34.79225 36.0 36.0 36.0 32.0 36.0 14-15 34.737125 36.0 36.0 36.0 32.0 36.0 16-17 34.772375 36.0 36.0 36.0 32.0 36.0 18-19 34.858000000000004 36.0 36.0 36.0 32.0 36.0 20-21 34.82575 36.0 36.0 36.0 32.0 36.0 22-23 34.76475 36.0 36.0 36.0 32.0 36.0 24-25 34.61775 36.0 36.0 36.0 32.0 36.0 26-27 34.477375 36.0 36.0 36.0 32.0 36.0 28-29 34.38875 36.0 36.0 36.0 32.0 36.0 30-31 34.3425 36.0 36.0 36.0 32.0 36.0 32-33 34.507 36.0 36.0 36.0 32.0 36.0 34-35 34.43725 36.0 36.0 36.0 32.0 36.0 36-37 34.317499999999995 36.0 36.0 36.0 32.0 36.0 38-39 34.349625 36.0 36.0 36.0 32.0 36.0 40-41 34.37475 36.0 36.0 36.0 32.0 36.0 42-43 34.225875 36.0 36.0 36.0 32.0 36.0 44-45 34.161874999999995 36.0 36.0 36.0 32.0 36.0 46-47 34.147375 36.0 36.0 36.0 32.0 36.0 48-49 34.1965 36.0 36.0 36.0 32.0 36.0 50-51 34.13290822705676 36.0 36.0 36.0 32.0 36.0 52-53 34.014138164356 36.0 36.0 36.0 32.0 36.0 54-55 33.95172586293147 36.0 36.0 36.0 32.0 36.0 56-57 33.99599436946394 36.0 36.0 36.0 32.0 36.0 58-59 33.92456842631974 36.0 36.0 36.0 29.5 36.0 60-61 33.65221610847394 36.0 36.0 36.0 27.0 36.0 62-63 33.81326658322904 36.0 36.0 36.0 27.0 36.0 64-65 33.58886107634543 36.0 36.0 36.0 27.0 36.0 66-67 33.520215522381996 36.0 34.0 36.0 27.0 36.0 68-69 33.332582018532435 36.0 32.0 36.0 27.0 36.0 70-71 33.26133840362429 36.0 32.0 36.0 27.0 36.0 72-73 33.361841980381755 36.0 34.0 36.0 27.0 36.0 74-75 33.254146999654495 36.0 32.0 36.0 27.0 36.0 76 32.45817154959407 36.0 32.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 2.0 24 3.0 25 6.0 26 18.0 27 34.0 28 53.0 29 81.0 30 107.0 31 186.0 32 287.0 33 526.0 34 1211.0 35 1485.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.0 9.525 10.424999999999999 40.050000000000004 2 27.6 10.9 35.35 26.150000000000002 3 26.3 16.85 20.325 36.525 4 31.05 24.925 17.575 26.450000000000003 5 30.95 26.900000000000002 21.45 20.7 6 24.415975885455914 31.37402662647576 23.285606631499622 20.9243908565687 7 17.974999999999998 23.075000000000003 37.025000000000006 21.925 8 21.85 21.6 30.625000000000004 25.924999999999997 9 20.225 19.5 32.85 27.425 10-11 24.9125 28.1125 22.162499999999998 24.8125 12-13 25.2 22.650000000000002 24.725 27.425 14-15 24.85 23.875 25.5625 25.7125 16-17 24.825 23.6375 24.2625 27.275 18-19 24.9125 23.1 24.7 27.287499999999998 20-21 24.5125 24.125 24.3875 26.974999999999998 22-23 24.625 24.175 23.849999999999998 27.35 24-25 25.074999999999996 23.3125 23.6875 27.925 26-27 24.025 24.0 25.2125 26.7625 28-29 25.6 24.099999999999998 23.0875 27.212500000000002 30-31 24.762500000000003 23.9875 23.7625 27.487499999999997 32-33 24.375 24.525 24.3125 26.787499999999998 34-35 25.575 23.4875 23.8875 27.05 36-37 25.4375 23.825 24.025 26.7125 38-39 24.95 24.1625 24.462500000000002 26.424999999999997 40-41 25.074999999999996 24.6625 22.8875 27.375 42-43 25.112499999999997 22.8 24.8 27.287499999999998 44-45 24.75 23.724999999999998 24.85 26.674999999999997 46-47 25.2375 24.2625 22.975 27.525 48-49 25.2125 22.650000000000002 24.725 27.4125 50-51 24.868717179294826 23.868467116779193 24.093523380845213 27.169292323080768 52-53 24.98436913842691 24.0090033762661 23.296236088533202 27.710391396773794 54-55 24.599799899949975 23.56178089044522 23.936968484242122 27.901450725362682 56-57 24.9906191369606 23.677298311444652 23.602251407129458 27.72983114446529 58-59 25.381536152114087 24.305729296972732 23.655241431073303 26.65749311983988 60-61 24.978100362908272 24.18971342760606 23.63909398072832 27.193092228757354 62-63 25.168961201501876 23.729662077597 23.74217772215269 27.359198998748436 64-65 26.357947434292868 22.11514392991239 24.105131414267834 27.42177722152691 66-67 24.62751971954426 23.237761362213597 23.81369725804432 28.32102166019782 68-69 25.607312797395444 23.140495867768596 24.61808164287503 26.634109691960933 70-71 25.557504384865947 23.37759959909797 24.104234527687296 26.960661488348787 72-73 25.066029430260343 23.544208275688593 23.393283863664948 27.996478430386112 74-75 25.8804907004353 20.894341115947764 25.141801873103812 28.083366310513124 76 28.132721496646663 0.0 32.403812213201554 39.463466290151786 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.0 25 0.0 26 1.5 27 3.5 28 6.5 29 9.0 30 12.5 31 20.0 32 26.0 33 30.5 34 44.0 35 59.5 36 71.5 37 86.5 38 109.5 39 131.5 40 142.0 41 154.5 42 164.0 43 192.5 44 202.5 45 193.5 46 204.0 47 192.0 48 189.0 49 188.0 50 165.5 51 150.0 52 134.0 53 133.0 54 139.5 55 137.0 56 131.0 57 120.5 58 113.5 59 111.0 60 105.0 61 106.0 62 113.5 63 104.5 64 92.5 65 93.0 66 100.5 67 103.0 68 95.5 69 81.5 70 73.0 71 66.0 72 61.0 73 61.0 74 52.0 75 40.5 76 35.0 77 31.5 78 23.0 79 13.5 80 12.5 81 10.5 82 5.5 83 3.5 84 4.0 85 3.0 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.475 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 49 1.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 0.0 59 1.0 60 1.0 61 0.0 62 0.0 63 0.0 64 0.0 65 1.0 66 1.0 67 0.0 68 0.0 69 1.0 70 2.0 71 3.0 72 23.0 73 63.0 74 221.0 75 847.0 76 2833.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16750756811302 98.275 2 0.7820383451059535 1.55 3 0.025227043390514632 0.075 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.025 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10 0.0 0.0 0.0 0.025 0.0 11 0.0 0.0 0.0 0.025 0.0 12 0.0 0.0 0.0 0.025 0.0 13 0.0 0.0 0.0 0.025 0.0 14 0.0 0.0 0.0 0.025 0.0 15 0.0 0.0 0.0 0.025 0.0 16 0.0 0.0 0.0 0.025 0.0 17 0.0 0.0 0.0 0.025 0.0 18 0.0 0.0 0.0 0.025 0.0 19 0.0 0.0 0.0 0.025 0.0 20 0.0 0.0 0.0 0.025 0.0 21 0.0 0.0 0.0 0.025 0.0 22 0.0 0.0 0.0 0.025 0.0 23 0.0 0.0 0.0 0.025 0.0 24 0.0 0.0 0.0 0.025 0.0 25 0.0 0.0 0.0 0.025 0.0 26 0.0 0.0 0.0 0.025 0.0 27 0.0 0.0 0.0 0.025 0.0 28 0.0 0.0 0.0 0.025 0.0 29 0.0 0.0 0.0 0.025 0.0 30 0.0 0.0 0.0 0.025 0.0 31 0.0 0.0 0.0 0.025 0.0 32 0.0 0.0 0.0 0.025 0.0 33 0.0 0.0 0.0 0.025 0.0 34 0.0 0.0 0.0 0.025 0.0 35 0.0 0.0 0.0 0.025 0.0 36 0.0 0.0 0.0 0.025 0.0 37 0.0 0.0 0.0 0.025 0.0 38 0.0 0.0 0.0 0.025 0.0 39 0.0 0.0 0.0 0.025 0.0 40 0.0 0.0 0.0 0.025 0.0 41 0.0 0.0 0.0 0.025 0.0 42 0.0 0.0 0.0 0.025 0.0 43 0.0 0.0 0.0 0.025 0.0 44 0.0 0.0 0.0 0.025 0.0 45 0.0 0.0 0.0 0.025 0.0 46 0.0 0.0 0.0 0.025 0.0 47 0.0 0.0 0.0 0.025 0.0 48 0.0 0.0 0.0 0.025 0.0 49 0.0 0.0 0.0 0.025 0.0 50 0.0 0.0 0.0 0.025 0.0 51 0.0 0.0 0.0 0.025 0.0 52 0.0 0.0 0.0 0.025 0.0 53 0.0 0.0 0.0 0.025 0.0 54 0.0 0.0 0.0 0.025 0.0 55 0.0 0.0 0.0 0.025 0.0 56 0.0 0.0 0.0 0.025 0.0 57 0.0 0.0 0.0 0.025 0.0 58 0.0 0.0 0.0 0.025 0.0 59 0.0 0.0 0.0 0.025 0.0 60 0.0 0.0 0.0 0.025 0.0 61 0.0 0.0 0.0 0.025 0.0 62 0.0 0.0 0.0 0.025 0.0 63 0.0 0.0 0.0 0.025 0.0 64 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389899 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389899_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.217 32.0 32.0 32.0 32.0 32.0 2 30.95275 32.0 32.0 32.0 32.0 32.0 3 30.96325 32.0 32.0 32.0 32.0 32.0 4 31.04875 32.0 32.0 32.0 32.0 32.0 5 30.9815 32.0 32.0 32.0 32.0 32.0 6 34.34725 36.0 36.0 36.0 32.0 36.0 7 34.51075 36.0 36.0 36.0 32.0 36.0 8 34.31875 36.0 36.0 36.0 32.0 36.0 9 34.33525 36.0 36.0 36.0 32.0 36.0 10-11 34.21725 36.0 36.0 36.0 32.0 36.0 12-13 34.1665 36.0 36.0 36.0 32.0 36.0 14-15 34.19125 36.0 36.0 36.0 32.0 36.0 16-17 34.188874999999996 36.0 36.0 36.0 32.0 36.0 18-19 34.22025 36.0 36.0 36.0 32.0 36.0 20-21 33.948875 36.0 36.0 36.0 32.0 36.0 22-23 34.157375 36.0 36.0 36.0 32.0 36.0 24-25 34.084125 36.0 36.0 36.0 32.0 36.0 26-27 33.980374999999995 36.0 36.0 36.0 32.0 36.0 28-29 33.945875 36.0 36.0 36.0 32.0 36.0 30-31 33.936875 36.0 36.0 36.0 32.0 36.0 32-33 33.997 36.0 36.0 36.0 32.0 36.0 34-35 33.966375 36.0 36.0 36.0 32.0 36.0 36-37 33.93656156156156 36.0 36.0 36.0 32.0 36.0 38-39 33.80568068068068 36.0 36.0 36.0 32.0 36.0 40-41 33.77152152152152 36.0 36.0 36.0 32.0 36.0 42-43 33.88976476476476 36.0 36.0 36.0 32.0 36.0 44-45 33.65077577577578 36.0 36.0 36.0 27.0 36.0 46-47 33.509509509509506 36.0 36.0 36.0 27.0 36.0 48-49 33.48448448448448 36.0 36.0 36.0 27.0 36.0 50-51 33.46795994993742 36.0 36.0 36.0 27.0 36.0 52-53 33.297622027534416 36.0 36.0 36.0 27.0 36.0 54-55 33.2549436795995 36.0 34.0 36.0 24.0 36.0 56-57 33.351603657050035 36.0 36.0 36.0 27.0 36.0 58-59 33.04732098147221 36.0 32.0 36.0 24.0 36.0 60-61 33.056617649273 36.0 32.0 36.0 24.0 36.0 62-63 33.03156312625251 36.0 32.0 36.0 21.0 36.0 64-65 33.00563627254509 36.0 32.0 36.0 21.0 36.0 66-67 33.029833039124995 36.0 32.0 36.0 24.0 36.0 68-69 32.64160401002506 36.0 32.0 36.0 24.0 36.0 70-71 32.588246065233605 36.0 32.0 36.0 24.0 36.0 72-73 32.51402408105107 36.0 32.0 36.0 21.0 36.0 74-75 32.514837398373984 36.0 32.0 36.0 21.0 36.0 76 31.061599423631122 32.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 2.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 3.0 17 2.0 18 1.0 19 5.0 20 4.0 21 3.0 22 9.0 23 12.0 24 12.0 25 27.0 26 35.0 27 54.0 28 78.0 29 113.0 30 175.0 31 211.0 32 347.0 33 569.0 34 1179.0 35 1153.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.931931931931935 18.693693693693696 11.21121121121121 38.16316316316316 2 29.208416833667332 23.09619238476954 29.383767535070138 18.311623246492985 3 25.875875875875877 26.05105105105105 19.66966966966967 28.403403403403406 4 30.430430430430434 30.705705705705704 17.09209209209209 21.77177177177177 5 31.256256256256254 32.707707707707705 17.14214214214214 18.893893893893893 6 23.44844844844845 33.45845845845846 21.371371371371374 21.72172172172172 7 24.14914914914915 15.89089089089089 32.68268268268268 27.27727727727728 8 25.400400400400404 20.795795795795797 24.34934934934935 29.454454454454453 9 22.822822822822822 21.746746746746748 26.926926926926924 28.503503503503502 10-11 27.537864563775187 27.47527850794843 18.98860933783953 25.99824759043685 12-13 27.635862759829706 21.312296518908088 22.877535687453044 28.174305033809166 14-15 27.323978952643447 23.891255324480078 22.92658481583563 25.85818090704084 16-17 27.608668420393336 23.512463985970186 22.36001503194288 26.518852561693603 18-19 26.67501565435191 22.943018159048215 23.080776455854725 27.301189730745147 20-21 27.389014296463504 23.350890393779782 22.88688236769501 26.373212942061702 22-23 27.44803405960431 24.73077886301027 21.650388179313797 26.170798898071624 24-25 26.631592133283227 23.9634222723287 23.149192033070275 26.2557935613178 26-27 27.220343229362392 24.376800701490666 22.410121508204934 25.992734560941997 28-29 27.698472326571498 24.02955171550213 22.138742799899823 26.13323315802655 30-31 26.703406813627257 24.298597194388776 22.908316633266534 26.089679358717433 32-33 26.884547958928124 24.75582268970699 23.140495867768596 25.219133483596295 34-35 26.79689456548961 23.841723015276735 23.077886301026798 26.283496118206862 36-37 27.473077886301027 23.6038066616579 22.163786626596544 26.759328825444527 38-39 27.17023675310034 23.9634222723287 22.861079794563448 26.005261180007516 40-41 27.535687453042822 23.26571500125219 22.539444027047335 26.659153518657654 42-43 27.22604884157796 23.656856606136508 22.93049467752035 26.186599874765186 44-45 26.525498057887482 24.357849893497054 23.718832226538026 25.397819822077434 46-47 27.69635475385194 23.6126769384943 22.472754603532508 26.218213704121258 48-49 27.364991855657184 22.653802781606313 23.004636010524997 26.976569352211506 50-51 26.573865061449712 23.08753448708302 23.551542513167796 26.787057938299476 52-53 26.951509835860165 24.09472497180804 22.165142212755292 26.788622979576495 54-55 27.304609218436877 23.72244488977956 22.983466933867735 25.98947895791583 56-57 28.14731304021045 23.261931604659903 22.77339346110485 25.817361894024803 58-59 27.280701754385966 23.62155388471178 22.969924812030076 26.127819548872182 60-61 26.832936458202784 23.524251159293144 23.411455069557586 26.231357312946486 62-63 26.82376535472549 24.091250940085235 23.000752068187516 26.084231637001754 64-65 26.993480441323968 24.21013039117352 22.12888665997994 26.667502507522567 66-67 27.21003134796238 24.26332288401254 22.33228840125392 26.194357366771158 68-69 27.2886882367695 24.078254326561325 22.56082267368949 26.072234762979683 70-71 28.003012426258316 23.72285678423497 22.17898832684825 26.095142462658465 72-73 27.2612748803225 24.263038548752835 22.7387251196775 25.736961451247165 74-75 28.13916288989603 20.767795254598774 23.487070114636097 27.6059717408691 76 29.64298593580959 0.0 32.92463036422647 37.43238369996394 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.5 21 1.5 22 1.5 23 2.5 24 4.5 25 5.5 26 6.5 27 8.0 28 6.5 29 8.0 30 11.5 31 13.0 32 20.0 33 26.0 34 38.0 35 57.0 36 62.5 37 65.0 38 83.5 39 106.0 40 125.0 41 148.0 42 166.5 43 175.5 44 178.5 45 169.5 46 154.5 47 154.0 48 162.0 49 172.5 50 178.5 51 163.0 52 144.0 53 132.5 54 127.0 55 132.5 56 131.5 57 133.0 58 133.5 59 130.0 60 132.0 61 123.5 62 113.5 63 114.0 64 117.5 65 120.0 66 107.5 67 100.5 68 103.5 69 88.0 70 77.5 71 74.0 72 65.5 73 65.5 74 62.5 75 54.0 76 45.5 77 30.0 78 22.0 79 24.5 80 20.5 81 11.5 82 9.0 83 7.0 84 3.5 85 2.5 86 2.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.2 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.1 9 0.1 10-11 0.13749999999999998 12-13 0.17500000000000002 14-15 0.22499999999999998 16-17 0.21250000000000002 18-19 0.1875 20-21 0.325 22-23 0.17500000000000002 24-25 0.21250000000000002 26-27 0.21250000000000002 28-29 0.17500000000000002 30-31 0.2 32-33 0.17500000000000002 34-35 0.17500000000000002 36-37 0.07507507507507508 38-39 0.11261261261261261 40-41 0.07507507507507508 42-43 0.08758758758758758 44-45 0.13763763763763764 46-47 0.11261261261261261 48-49 0.13763763763763764 50-51 0.2002503128911139 52-53 0.11264080100125157 54-55 0.0750938673341677 56-57 0.07510326699211416 58-59 0.10015022533800699 60-61 0.07514088916718849 62-63 0.07515030060120241 64-65 0.1002004008016032 66-67 0.07517854905400326 68-69 0.07518796992481204 70-71 0.07525398218989088 72-73 0.0755287009063444 74-75 0.07991475759190196 76 0.10806916426512969 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 4.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 0.0 59 1.0 60 1.0 61 0.0 62 0.0 63 0.0 64 0.0 65 1.0 66 1.0 67 0.0 68 0.0 69 1.0 70 5.0 71 4.0 72 16.0 73 64.0 74 292.0 75 832.0 76 2776.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29417695991933 98.475 2 0.604991177211999 1.2 3 0.07562389715149988 0.22499999999999998 4 0.025207965717166627 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696118 spots for SRR11389899.sra Written 696118 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra Read 696109 spots for SRR11389899.sra Written 696109 spots for SRR11389899.sra SRR ids: ['SRR11389899.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m20vadub SRR11389899.sra spots: 13922189 blocks: [[1, 696109], [696110, 1392218], [1392219, 2088327], [2088328, 2784436], [2784437, 3480545], [3480546, 4176654], [4176655, 4872763], [4872764, 5568872], [5568873, 6264981], [6264982, 6961090], [6961091, 7657199], [7657200, 8353308], [8353309, 9049417], [9049418, 9745526], [9745527, 10441635], [10441636, 11137744], [11137745, 11833853], [11833854, 12529962], [12529963, 13226071], [13226072, 13922189]] SRR11389899 file size 2644536 SRR11389899 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389899 SRR11389899_1.fastq SRR11389899_2.fastq Input file: SRR11389899_1.fastq Paired file: SRR11389899_2.fastq trimmed: SRR11389899-trimmed-pair1.fastq, SRR11389899-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:31:28 2024 >> started Sat Dec 7 09:32:33 2024 >> done (65.304s) 13922189 read pairs processed; of these: 871 ( 0.01%) short read pairs filtered out after trimming by size control 9134 ( 0.07%) empty read pairs filtered out after trimming by size control 13912184 (99.93%) read pairs available; of these: 4002 ( 0.03%) trimmed read pairs available after processing 13908182 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 4 0.00% 21 7 0.00% 22 10 0.00% 23 7 0.00% 24 15 0.00% 25 10 0.00% 26 10 0.00% 27 18 0.00% 28 9 0.00% 29 15 0.00% 30 21 0.00% 31 9 0.00% 32 21 0.00% 33 12 0.00% 34 15 0.00% 35 128 0.00% 36 121 0.00% 37 135 0.00% 38 167 0.00% 39 153 0.00% 40 203 0.00% 41 209 0.00% 42 224 0.00% 43 211 0.00% 44 209 0.00% 45 238 0.00% 46 267 0.00% 47 301 0.00% 48 303 0.00% 49 329 0.00% 50 338 0.00% 51 408 0.00% 52 440 0.00% 53 517 0.00% 54 497 0.00% 55 598 0.00% 56 627 0.00% 57 698 0.01% 58 742 0.01% 59 820 0.01% 60 858 0.01% 61 873 0.01% 62 1012 0.01% 63 1122 0.01% 64 1232 0.01% 65 1293 0.01% 66 1445 0.01% 67 1639 0.01% 68 1611 0.01% 69 1894 0.01% 70 2423 0.02% 71 3699 0.03% 72 12074 0.09% 73 111453 0.80% 74 966212 6.95% 75 6090252 43.78% 76 6704021 48.19% 13912184 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=16 prefix-density=0.26 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=149.03 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=18.5 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=31 prefix-density=0.20 prefix-fanout=2.2 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=176.03 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=20.0 sequence=GCCGCCGCCACCCTGATGCAGCCGGCCAAGATGGG SRR11389899 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:36:00 Started mapping on | Dec 07 09:36:01 Finished on | Dec 07 09:43:25 Mapping speed, Million of reads per hour | 112.80 Number of input reads | 13912184 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 12703977 Uniquely mapped reads % | 91.32% Average mapped length | 150.37 Number of splices: Total | 5872357 Number of splices: Annotated (sjdb) | 5615265 Number of splices: GT/AG | 5790743 Number of splices: GC/AG | 71477 Number of splices: AT/AC | 2139 Number of splices: Non-canonical | 7998 Mismatch rate per base, % | 0.74% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.01% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 600477 % of reads mapped to multiple loci | 4.32% Number of reads mapped to too many loci | 43880 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.01% % of reads unmapped: other | 1.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 607734 607734 607734 N_multimapping 600477 600477 600477 N_noFeature 355534 12377728 443942 N_ambiguous 302266 1434 68841 UnstrandedReadsAssigned:12046177 PositiveStrandReadsAssigned:324815 NegativeStrandReadsAssigned:12191194 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389899 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389899-trimmed-pair1.fastq SRR11389899-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,912,184 reads, 12,663,449 reads pseudoaligned [quant] estimated average fragment length: 201.539 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52973 SRR11389899.ke.tsv 35125 SRR11389899.se.tsv 88098 total ==> SRR11389899.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 735.682 0.000636548 9.32423e-05 PNS24247 1044 843.461 29.8076 3.80833 PNS24249 1928 1727.46 139.084 8.67646 PNS24246 1044 843.461 29.8076 3.80833 PNS24248 1044 843.461 29.8076 3.80833 PNS24244 1471 1270.46 15.4923 1.31409 PNS24243 293 107.37 0 0 KQK14069 1603 1402.46 785.064 60.3235 KQK14071 474 275.69 23.3397 9.1232 ==> SRR11389899.se.tsv <== BRADI_1g14170v3 812 BRADI_1g53295v3 18 BRADI_1g59795v3 190 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 179 BRADI_1g74790v3 177 BRADI_1g09890v3 0 BRADI_1g77505v3 189 BRADI_1g48960v3 0 SRR11389899 completed mapping pipeline successfully