Starting /dee2/code/volunteer_pipeline.sh SRR11398533 current disk space = 1542997823488 free memory = 1595979468 SRR11398533 SRAfilesize 2c1cf88d139d7a05259f86ff4f6280b2 SRR11398533.sra SRR11398533.sra file validated SRR11398533 is single end SRR11398533 is conventional basespace SRR11398533 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11398533_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.234 34.0 33.0 34.0 32.0 34.0 2 33.0385 34.0 33.0 34.0 32.0 34.0 3 33.10075 34.0 33.0 34.0 32.0 34.0 4 33.21575 34.0 33.0 34.0 32.0 34.0 5 33.1995 34.0 33.0 34.0 32.0 34.0 6 36.886 38.0 38.0 38.0 35.0 38.0 7 37.20675 38.0 38.0 38.0 36.0 38.0 8 37.23475 38.0 38.0 38.0 37.0 38.0 9 37.3635 38.0 38.0 38.0 37.0 38.0 10 37.36875 38.0 38.0 38.0 37.0 38.0 11 37.2905 38.0 38.0 38.0 37.0 38.0 12 37.34475 38.0 38.0 38.0 37.0 38.0 13 37.33025 38.0 38.0 38.0 37.0 38.0 14 37.379 38.0 38.0 38.0 37.0 38.0 15 37.197 38.0 38.0 38.0 37.0 38.0 16 37.31125 38.0 38.0 38.0 37.0 38.0 17 37.3815 38.0 38.0 38.0 37.0 38.0 18 37.376 38.0 38.0 38.0 37.0 38.0 19 37.37975 38.0 38.0 38.0 37.0 38.0 20 37.333 38.0 38.0 38.0 37.0 38.0 21 37.32575 38.0 38.0 38.0 37.0 38.0 22 37.304 38.0 38.0 38.0 37.0 38.0 23 37.31975 38.0 38.0 38.0 37.0 38.0 24 37.30625 38.0 38.0 38.0 37.0 38.0 25 37.353 38.0 38.0 38.0 37.0 38.0 26 37.26375 38.0 38.0 38.0 37.0 38.0 27 37.29325 38.0 38.0 38.0 37.0 38.0 28 37.23675 38.0 38.0 38.0 37.0 38.0 29 37.3265 38.0 38.0 38.0 37.0 38.0 30 37.32 38.0 38.0 38.0 37.0 38.0 31 37.29225 38.0 38.0 38.0 37.0 38.0 32 37.34125 38.0 38.0 38.0 37.0 38.0 33 37.36725 38.0 38.0 38.0 37.0 38.0 34 37.29 38.0 38.0 38.0 37.0 38.0 35 37.3485 38.0 38.0 38.0 37.0 38.0 36 37.3265 38.0 38.0 38.0 37.0 38.0 37 37.226 38.0 38.0 38.0 37.0 38.0 38 37.2605 38.0 38.0 38.0 37.0 38.0 39 37.303 38.0 38.0 38.0 37.0 38.0 40 37.349 38.0 38.0 38.0 37.0 38.0 41 37.3305 38.0 38.0 38.0 37.0 38.0 42 37.3295 38.0 38.0 38.0 37.0 38.0 43 37.34475 38.0 38.0 38.0 37.0 38.0 44 37.36525 38.0 38.0 38.0 37.0 38.0 45 37.29075 38.0 38.0 38.0 37.0 38.0 46 37.17625 38.0 38.0 38.0 36.0 38.0 47 37.27925 38.0 38.0 38.0 37.0 38.0 48 37.3475 38.0 38.0 38.0 37.0 38.0 49 37.2165 38.0 38.0 38.0 37.0 38.0 50 37.258 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1116 1 0.0 1116 2 0.0 1116 3 0.0 1116 4 0.0 1116 5 0.0 1116 6 0.0 1116 7 0.0 1116 8 0.0 1116 9 0.0 1116 10 0.0 1116 11 0.0 1116 12 0.0 1116 13 0.0 1116 14 0.0 1116 15 0.0 1116 16 0.0 1116 17 0.0 1116 18 0.0 1116 19 0.0 1116 20 0.0 1116 21 0.0 1116 22 0.0 1116 23 0.0 1116 24 0.0 1116 25 0.0 1116 26 0.0 1116 27 0.0 1116 28 0.0 1116 29 0.0 1116 30 0.0 1116 31 0.0 1116 32 0.0 1116 33 0.0 1116 34 0.0 1116 35 0.0 1116 36 0.0 1116 37 0.0 1116 38 0.0 1116 39 0.0 1116 40 0.0 1116 41 0.0 1116 42 0.0 1116 43 0.0 1116 44 0.0 1116 45 0.0 1116 46 0.0 1116 47 0.0 1116 48 0.0 1116 49 0.0 1116 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 2.0 25 3.0 26 10.0 27 5.0 28 17.0 29 21.0 30 33.0 31 47.0 32 44.0 33 68.0 34 100.0 35 147.0 36 330.0 37 3170.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.625 9.6 7.324999999999999 38.45 2 22.993981945837515 13.966900702106319 34.027081243731196 29.012036108324974 3 21.325 16.575 25.174999999999997 36.925000000000004 4 26.575 22.5 21.75 29.175 5 26.025 29.975 23.225 20.775 6 21.75 30.45 25.374999999999996 22.425 7 17.974999999999998 24.45 37.875 19.7 8 18.975 22.85 30.3 27.875 9 20.25 22.525000000000002 34.0 23.225 10 22.5 33.725 23.95 19.825 11 25.650000000000002 25.025 22.675 26.650000000000002 12 22.375 22.95 26.825 27.85 13 22.425 25.6 27.0 24.975 14 22.125 26.974999999999998 26.450000000000003 24.45 15 22.725 25.525 26.200000000000003 25.55 16 24.275 26.025 24.5 25.2 17 22.95 26.625 24.775 25.650000000000002 18 21.85 25.424999999999997 25.8 26.924999999999997 19 23.25 24.975 25.624999999999996 26.150000000000002 20 22.775000000000002 26.950000000000003 25.3 24.975 21 23.325000000000003 26.724999999999998 25.124999999999996 24.825 22 22.8 27.35 24.875 24.975 23 22.075 26.0 27.200000000000003 24.725 24 22.85 26.400000000000002 25.424999999999997 25.324999999999996 25 23.925 26.224999999999998 24.05 25.8 26 23.7 27.025 24.175 25.1 27 23.375 25.15 25.424999999999997 26.05 28 24.75 25.85 24.75 24.65 29 22.525000000000002 26.724999999999998 25.424999999999997 25.324999999999996 30 21.575 25.75 26.400000000000002 26.275 31 24.075 26.625 23.974999999999998 25.324999999999996 32 24.275 25.624999999999996 25.825 24.275 33 22.85 24.325 26.1 26.724999999999998 34 24.15 24.825 24.725 26.3 35 23.275000000000002 26.724999999999998 25.35 24.65 36 22.400000000000002 26.474999999999998 25.424999999999997 25.7 37 23.775 25.974999999999998 24.175 26.075 38 22.425 26.825 24.3 26.450000000000003 39 23.375 25.174999999999997 24.85 26.6 40 22.275 26.650000000000002 25.474999999999998 25.6 41 23.549999999999997 25.05 24.575 26.825 42 23.75 25.3 25.15 25.8 43 23.599999999999998 25.324999999999996 25.1 25.974999999999998 44 22.675 26.950000000000003 25.7 24.675 45 21.95 26.025 26.325 25.7 46 24.25 26.325 23.5 25.924999999999997 47 23.9 25.324999999999996 25.224999999999998 25.55 48 23.474999999999998 25.25 25.8 25.474999999999998 49 24.55 26.224999999999998 24.825 24.4 50 23.674999999999997 25.95 24.55 25.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 3.0 23 2.0 24 1.0 25 3.5 26 6.0 27 11.5 28 17.0 29 28.0 30 39.0 31 51.0 32 63.0 33 72.0 34 81.0 35 112.0 36 143.0 37 165.5 38 188.0 39 210.5 40 233.0 41 273.0 42 313.0 43 340.5 44 368.0 45 353.5 46 339.0 47 331.0 48 323.0 49 331.0 50 339.0 51 304.0 52 269.0 53 252.5 54 236.0 55 209.0 56 182.0 57 183.0 58 184.0 59 166.0 60 148.0 61 135.5 62 123.0 63 113.0 64 103.0 65 97.0 66 91.0 67 74.5 68 58.0 69 52.5 70 47.0 71 44.0 72 41.0 73 33.5 74 26.0 75 23.0 76 20.0 77 14.5 78 9.0 79 5.5 80 2.0 81 2.0 82 2.0 83 2.0 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887355 spots for SRR11398533.sra Written 887355 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra Read 887340 spots for SRR11398533.sra Written 887340 spots for SRR11398533.sra SRR ids: ['SRR11398533.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jwxziudv SRR11398533.sra spots: 17746815 blocks: [[1, 887340], [887341, 1774680], [1774681, 2662020], [2662021, 3549360], [3549361, 4436700], [4436701, 5324040], [5324041, 6211380], [6211381, 7098720], [7098721, 7986060], [7986061, 8873400], [8873401, 9760740], [9760741, 10648080], [10648081, 11535420], [11535421, 12422760], [12422761, 13310100], [13310101, 14197440], [14197441, 15084780], [15084781, 15972120], [15972121, 16859460], [16859461, 17746815]] SRR11398533 file size 3030624 SRR11398533 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11398533 SRR11398533_1.fastq Input file: SRR11398533_1.fastq trimmed: SRR11398533-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:51:01 2024 >> started Sat Dec 7 13:51:11 2024 >> done (10.330s) 17746815 reads processed; of these: 154 ( 0.00%) short reads filtered out after trimming by size control 12035 ( 0.07%) empty reads filtered out after trimming by size control 17734626 (99.93%) reads available; of these: 4335 ( 0.02%) trimmed reads available after processing 17730291 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 136 0.00% 32 0 0.00% 33 4 0.00% 34 11 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 320 0.00% 45 174 0.00% 46 446 0.00% 47 2450 0.01% 48 111 0.00% 49 679 0.00% 50 17730291 99.98% 17734626 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=20 prefix-density=0.08 prefix-fanout=2.6 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=4 fanout-score=230.45 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=25.7 sequence=CTTCTTCTTGTC Started job on | Dec 07 13:51:24 Started mapping on | Dec 07 13:51:24 Finished on | Dec 07 13:51:42 Mapping speed, Million of reads per hour | 3546.93 Number of input reads | 17734626 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 16557685 Uniquely mapped reads % | 93.36% Average mapped length | 49.83 Number of splices: Total | 2517010 Number of splices: Annotated (sjdb) | 2433761 Number of splices: GT/AG | 2481553 Number of splices: GC/AG | 31289 Number of splices: AT/AC | 1717 Number of splices: Non-canonical | 2451 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.57 Insertion rate per base | 0.00% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 470688 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 458588 % of reads mapped to too many loci | 2.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.35% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 706253 706253 706253 N_multimapping 470688 470688 470688 N_noFeature 614721 16210773 709840 N_ambiguous 268236 1148 17537 UnstrandedReadsAssigned:15674728 PositiveStrandReadsAssigned:345764 NegativeStrandReadsAssigned:15830308 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR11398533 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR11398533-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,734,626 reads, 15,757,967 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR11398533.ke.tsv 35125 SRR11398533.se.tsv 88098 total ==> SRR11398533.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 94.6376 11.6726 PNS24247 1044 945 13.3631 1.45984 PNS24249 1928 1829 58.8946 3.32423 PNS24246 1044 945 13.3631 1.45984 PNS24248 1044 945 13.3631 1.45984 PNS24244 1471 1372 206.378 15.5288 PNS24243 293 194 0 0 KQK14069 1603 1504 173.191 11.8879 KQK14071 474 375 9.33716 2.57047 ==> SRR11398533.se.tsv <== BRADI_1g14170v3 190 BRADI_1g53295v3 89 BRADI_1g59795v3 294 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 1511 BRADI_1g74790v3 459 BRADI_1g09890v3 0 BRADI_1g77505v3 156 BRADI_1g48960v3 1 SRR11398533 completed mapping pipeline successfully