Starting /dee2/code/volunteer_pipeline.sh SRR11398534 current disk space = 1543105056768 free memory = 1596872056 SRR11398534 SRAfilesize 0a2776cf44c04e57351d3e21b75ab481 SRR11398534.sra SRR11398534.sra file validated SRR11398534 is single end SRR11398534 is conventional basespace SRR11398534 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11398534_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18075 34.0 33.0 34.0 32.0 34.0 2 33.18675 34.0 33.0 34.0 32.0 34.0 3 33.13675 34.0 33.0 34.0 32.0 34.0 4 33.259 34.0 33.0 34.0 33.0 34.0 5 33.222 34.0 33.0 34.0 32.0 34.0 6 36.94725 38.0 38.0 38.0 36.0 38.0 7 37.22525 38.0 38.0 38.0 37.0 38.0 8 37.26425 38.0 38.0 38.0 37.0 38.0 9 37.25625 38.0 38.0 38.0 37.0 38.0 10 37.37725 38.0 38.0 38.0 37.0 38.0 11 37.284 38.0 38.0 38.0 37.0 38.0 12 37.28175 38.0 38.0 38.0 37.0 38.0 13 37.31325 38.0 38.0 38.0 37.0 38.0 14 37.35125 38.0 38.0 38.0 37.0 38.0 15 37.182 38.0 38.0 38.0 37.0 38.0 16 37.27075 38.0 38.0 38.0 37.0 38.0 17 37.3885 38.0 38.0 38.0 37.0 38.0 18 37.327 38.0 38.0 38.0 37.0 38.0 19 37.3405 38.0 38.0 38.0 37.0 38.0 20 37.32375 38.0 38.0 38.0 37.0 38.0 21 37.3475 38.0 38.0 38.0 37.0 38.0 22 37.39825 38.0 38.0 38.0 37.0 38.0 23 37.385 38.0 38.0 38.0 37.0 38.0 24 37.37725 38.0 38.0 38.0 37.0 38.0 25 37.4045 38.0 38.0 38.0 37.0 38.0 26 37.37775 38.0 38.0 38.0 37.0 38.0 27 37.3285 38.0 38.0 38.0 37.0 38.0 28 37.257 38.0 38.0 38.0 37.0 38.0 29 37.26075 38.0 38.0 38.0 37.0 38.0 30 37.3275 38.0 38.0 38.0 37.0 38.0 31 37.373 38.0 38.0 38.0 37.0 38.0 32 37.30125 38.0 38.0 38.0 37.0 38.0 33 37.377 38.0 38.0 38.0 37.0 38.0 34 37.26425 38.0 38.0 38.0 37.0 38.0 35 37.34125 38.0 38.0 38.0 37.0 38.0 36 37.32975 38.0 38.0 38.0 37.0 38.0 37 37.279 38.0 38.0 38.0 37.0 38.0 38 37.303 38.0 38.0 38.0 37.0 38.0 39 37.3085 38.0 38.0 38.0 37.0 38.0 40 37.35925 38.0 38.0 38.0 37.0 38.0 41 37.367 38.0 38.0 38.0 37.0 38.0 42 37.2905 38.0 38.0 38.0 37.0 38.0 43 37.2685 38.0 38.0 38.0 37.0 38.0 44 37.27525 38.0 38.0 38.0 37.0 38.0 45 37.29975 38.0 38.0 38.0 37.0 38.0 46 37.1365 38.0 38.0 38.0 37.0 38.0 47 37.24975 38.0 38.0 38.0 37.0 38.0 48 37.32825 38.0 38.0 38.0 37.0 38.0 49 37.25 38.0 38.0 38.0 37.0 38.0 50 37.312 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1116 1 0.0 1116 2 0.0 1116 3 0.0 1116 4 0.0 1116 5 0.0 1116 6 0.0 1116 7 0.0 1116 8 0.0 1116 9 0.0 1116 10 0.0 1116 11 0.0 1116 12 0.0 1116 13 0.0 1116 14 0.0 1116 15 0.0 1116 16 0.0 1116 17 0.0 1116 18 0.0 1116 19 0.0 1116 20 0.0 1116 21 0.0 1116 22 0.0 1116 23 0.0 1116 24 0.0 1116 25 0.0 1116 26 0.0 1116 27 0.0 1116 28 0.0 1116 29 0.0 1116 30 0.0 1116 31 0.0 1116 32 0.0 1116 33 0.0 1116 34 0.0 1116 35 0.0 1116 36 0.0 1116 37 0.0 1116 38 0.0 1116 39 0.0 1116 40 0.0 1116 41 0.0 1116 42 0.0 1116 43 0.0 1116 44 0.0 1116 45 0.0 1116 46 0.0 1116 47 0.0 1116 48 0.0 1116 49 0.0 1116 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 7.0 27 11.0 28 14.0 29 32.0 30 32.0 31 33.0 32 59.0 33 62.0 34 93.0 35 146.0 36 315.0 37 3191.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.775 10.4 8.075000000000001 38.75 2 22.982456140350877 12.230576441102757 35.6140350877193 29.172932330827066 3 22.20555138784696 16.829207301825456 23.830957739434858 37.13428357089272 4 27.950000000000003 22.95 21.5 27.6 5 26.700000000000003 30.125 22.875 20.3 6 20.375 32.25 24.8 22.575 7 17.474999999999998 23.724999999999998 38.775 20.025000000000002 8 18.75 23.05 31.900000000000002 26.3 9 19.85 21.85 32.95 25.35 10 21.4 33.5 24.975 20.125 11 24.875 26.25 22.175 26.700000000000003 12 23.3 22.825 25.874999999999996 28.000000000000004 13 22.725 24.6 26.900000000000002 25.775 14 21.5 24.45 29.25 24.8 15 22.85 24.925 26.075 26.150000000000002 16 23.925 23.849999999999998 25.775 26.450000000000003 17 21.825 25.874999999999996 25.474999999999998 26.825 18 22.95 26.35 25.8 24.9 19 22.75 25.3 25.3 26.650000000000002 20 23.400000000000002 25.85 25.2 25.55 21 24.125 26.450000000000003 23.875 25.55 22 23.075000000000003 25.474999999999998 26.25 25.2 23 23.724999999999998 24.375 26.450000000000003 25.45 24 21.675 26.525 25.8 26.0 25 22.45 26.075 25.85 25.624999999999996 26 23.724999999999998 25.35 25.6 25.324999999999996 27 23.799999999999997 24.825 24.925 26.450000000000003 28 22.6 25.55 25.25 26.6 29 22.825 25.724999999999998 25.575 25.874999999999996 30 22.375 25.424999999999997 25.974999999999998 26.224999999999998 31 23.125 25.874999999999996 24.5 26.5 32 22.625 26.275 24.925 26.174999999999997 33 22.7 25.3 25.45 26.55 34 23.875 25.35 25.05 25.724999999999998 35 22.5 24.85 26.924999999999997 25.724999999999998 36 22.05 25.5 25.674999999999997 26.775 37 24.15 25.025 24.2 26.625 38 24.15 25.75 25.6 24.5 39 23.175 25.624999999999996 25.0 26.200000000000003 40 23.35 24.224999999999998 25.3 27.125 41 23.200000000000003 25.650000000000002 25.424999999999997 25.724999999999998 42 23.05 25.95 24.325 26.674999999999997 43 23.575 25.75 23.849999999999998 26.825 44 24.2 25.124999999999996 25.275 25.4 45 22.225 26.275 25.05 26.450000000000003 46 23.225 26.5 25.45 24.825 47 23.525 25.05 25.525 25.900000000000002 48 23.425 25.124999999999996 25.074999999999996 26.375 49 23.150000000000002 25.974999999999998 25.275 25.6 50 22.6 26.05 26.0 25.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 2.0 23 2.5 24 3.0 25 7.5 26 12.0 27 15.0 28 18.0 29 30.5 30 43.0 31 51.5 32 60.0 33 63.0 34 66.0 35 97.5 36 129.0 37 155.5 38 182.0 39 209.0 40 236.0 41 267.5 42 299.0 43 314.5 44 330.0 45 333.5 46 337.0 47 337.0 48 337.0 49 332.5 50 328.0 51 324.5 52 321.0 53 274.0 54 227.0 55 224.0 56 221.0 57 190.5 58 160.0 59 164.0 60 168.0 61 144.5 62 121.0 63 113.5 64 106.0 65 100.5 66 95.0 67 77.5 68 60.0 69 52.0 70 44.0 71 44.0 72 44.0 73 35.0 74 26.0 75 19.5 76 13.0 77 10.0 78 7.0 79 4.5 80 2.0 81 1.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06376518218623 97.875 2 0.7591093117408907 1.5 3 0.10121457489878542 0.3 4 0.05060728744939271 0.2 5 0.025303643724696356 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCC 5 0.125 TruSeq Adapter, Index 2 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920057 spots for SRR11398534.sra Written 920057 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra Read 920040 spots for SRR11398534.sra Written 920040 spots for SRR11398534.sra SRR ids: ['SRR11398534.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_knwax74t SRR11398534.sra spots: 18400817 blocks: [[1, 920040], [920041, 1840080], [1840081, 2760120], [2760121, 3680160], [3680161, 4600200], [4600201, 5520240], [5520241, 6440280], [6440281, 7360320], [7360321, 8280360], [8280361, 9200400], [9200401, 10120440], [10120441, 11040480], [11040481, 11960520], [11960521, 12880560], [12880561, 13800600], [13800601, 14720640], [14720641, 15640680], [15640681, 16560720], [16560721, 17480760], [17480761, 18400817]] SRR11398534 file size 3142707 SRR11398534 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11398534 SRR11398534_1.fastq Input file: SRR11398534_1.fastq trimmed: SRR11398534-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:51:36 2024 >> started Sat Dec 7 13:51:50 2024 >> done (14.003s) 18400817 reads processed; of these: 254 ( 0.00%) short reads filtered out after trimming by size control 10585 ( 0.06%) empty reads filtered out after trimming by size control 18389978 (99.94%) reads available; of these: 4494 ( 0.02%) trimmed reads available after processing 18385484 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 161 0.00% 32 0 0.00% 33 2 0.00% 34 12 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 307 0.00% 45 195 0.00% 46 436 0.00% 47 2546 0.01% 48 137 0.00% 49 692 0.00% 50 18385484 99.98% 18389978 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=17 prefix-density=0.07 prefix-fanout=2.7 sequence=AGAGGCAGCCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=17 fanout-score=277.53 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=23.5 sequence=CTTCTTCTTGAT Started job on | Dec 07 13:52:02 Started mapping on | Dec 07 13:52:02 Finished on | Dec 07 13:52:20 Mapping speed, Million of reads per hour | 3678.00 Number of input reads | 18389978 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 16519976 Uniquely mapped reads % | 89.83% Average mapped length | 49.83 Number of splices: Total | 2499466 Number of splices: Annotated (sjdb) | 2417497 Number of splices: GT/AG | 2464959 Number of splices: GC/AG | 30410 Number of splices: AT/AC | 1682 Number of splices: Non-canonical | 2415 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 494565 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 1097263 % of reads mapped to too many loci | 5.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.44% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1375437 1375437 1375437 N_multimapping 494565 494565 494565 N_noFeature 657902 16173397 757975 N_ambiguous 263290 1197 18007 UnstrandedReadsAssigned:15598784 PositiveStrandReadsAssigned:345382 NegativeStrandReadsAssigned:15743994 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR11398534 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR11398534-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,389,978 reads, 15,658,697 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52973 SRR11398534.ke.tsv 35125 SRR11398534.se.tsv 88098 total ==> SRR11398534.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 50.8137 6.41115 PNS24247 1044 945 46.0698 5.14832 PNS24249 1928 1829 47.0708 2.71781 PNS24246 1044 945 46.0698 5.14832 PNS24248 1044 945 46.0698 5.14832 PNS24244 1471 1372 147.906 11.3844 PNS24243 293 194 0 0 KQK14069 1603 1504 64.3713 4.51986 KQK14071 474 375 10.4606 2.94582 ==> SRR11398534.se.tsv <== BRADI_1g14170v3 92 BRADI_1g53295v3 108 BRADI_1g59795v3 238 BRADI_1g07683v3 0 BRADI_1g00485v3 26 BRADI_1g20270v3 1436 BRADI_1g74790v3 488 BRADI_1g09890v3 1 BRADI_1g77505v3 187 BRADI_1g48960v3 0 SRR11398534 completed mapping pipeline successfully