Starting /dee2/code/volunteer_pipeline.sh SRR11398535 current disk space = 1543213191168 free memory = 1600912528 SRR11398535 SRAfilesize a82fe6fed19e389b776ccdaff92d46cb SRR11398535.sra SRR11398535.sra file validated SRR11398535 is single end SRR11398535 is conventional basespace SRR11398535 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11398535_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1775 34.0 33.0 34.0 32.0 34.0 2 33.08425 34.0 33.0 34.0 32.0 34.0 3 33.12925 34.0 33.0 34.0 32.0 34.0 4 33.22175 34.0 33.0 34.0 32.0 34.0 5 33.25275 34.0 33.0 34.0 32.0 34.0 6 37.03525 38.0 38.0 38.0 36.0 38.0 7 37.3325 38.0 38.0 38.0 37.0 38.0 8 37.26575 38.0 38.0 38.0 37.0 38.0 9 37.3665 38.0 38.0 38.0 37.0 38.0 10 37.4005 38.0 38.0 38.0 37.0 38.0 11 37.3955 38.0 38.0 38.0 37.0 38.0 12 37.39625 38.0 38.0 38.0 37.0 38.0 13 37.4355 38.0 38.0 38.0 37.0 38.0 14 37.43925 38.0 38.0 38.0 37.0 38.0 15 37.28325 38.0 38.0 38.0 37.0 38.0 16 37.3795 38.0 38.0 38.0 37.0 38.0 17 37.4305 38.0 38.0 38.0 37.0 38.0 18 37.41525 38.0 38.0 38.0 37.0 38.0 19 37.3115 38.0 38.0 38.0 37.0 38.0 20 37.38075 38.0 38.0 38.0 37.0 38.0 21 37.40875 38.0 38.0 38.0 37.0 38.0 22 37.33475 38.0 38.0 38.0 37.0 38.0 23 37.359 38.0 38.0 38.0 37.0 38.0 24 37.47375 38.0 38.0 38.0 37.0 38.0 25 37.40725 38.0 38.0 38.0 37.0 38.0 26 37.33125 38.0 38.0 38.0 37.0 38.0 27 37.3495 38.0 38.0 38.0 37.0 38.0 28 37.2705 38.0 38.0 38.0 37.0 38.0 29 37.36775 38.0 38.0 38.0 37.0 38.0 30 37.36825 38.0 38.0 38.0 37.0 38.0 31 37.33825 38.0 38.0 38.0 37.0 38.0 32 37.38275 38.0 38.0 38.0 37.0 38.0 33 37.38225 38.0 38.0 38.0 37.0 38.0 34 37.22775 38.0 38.0 38.0 37.0 38.0 35 37.34275 38.0 38.0 38.0 37.0 38.0 36 37.289 38.0 38.0 38.0 37.0 38.0 37 37.28075 38.0 38.0 38.0 37.0 38.0 38 37.2745 38.0 38.0 38.0 37.0 38.0 39 37.3175 38.0 38.0 38.0 37.0 38.0 40 37.3675 38.0 38.0 38.0 37.0 38.0 41 37.38175 38.0 38.0 38.0 37.0 38.0 42 37.3575 38.0 38.0 38.0 37.0 38.0 43 37.34275 38.0 38.0 38.0 37.0 38.0 44 37.3685 38.0 38.0 38.0 37.0 38.0 45 37.3295 38.0 38.0 38.0 37.0 38.0 46 37.19425 38.0 38.0 38.0 37.0 38.0 47 37.365 38.0 38.0 38.0 37.0 38.0 48 37.41875 38.0 38.0 38.0 37.0 38.0 49 37.30725 38.0 38.0 38.0 37.0 38.0 50 37.318 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1116 1 0.0 1116 2 0.0 1116 3 0.0 1116 4 0.0 1116 5 0.0 1116 6 0.0 1116 7 0.0 1116 8 0.0 1116 9 0.0 1116 10 0.0 1116 11 0.0 1116 12 0.0 1116 13 0.0 1116 14 0.0 1116 15 0.0 1116 16 0.0 1116 17 0.0 1116 18 0.0 1116 19 0.0 1116 20 0.0 1116 21 0.0 1116 22 0.0 1116 23 0.0 1116 24 0.0 1116 25 0.0 1116 26 0.0 1116 27 0.0 1116 28 0.0 1116 29 0.0 1116 30 0.0 1116 31 0.0 1116 32 0.0 1116 33 0.0 1116 34 0.0 1116 35 0.0 1116 36 0.0 1116 37 0.0 1116 38 0.0 1116 39 0.0 1116 40 0.0 1116 41 0.0 1116 42 0.0 1116 43 0.0 1116 44 0.0 1116 45 0.0 1116 46 0.0 1116 47 0.0 1116 48 0.0 1116 49 0.0 1116 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 0.0 24 0.0 25 1.0 26 3.0 27 6.0 28 17.0 29 16.0 30 28.0 31 35.0 32 51.0 33 75.0 34 86.0 35 173.0 36 339.0 37 3167.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.5 9.825000000000001 6.575 41.099999999999994 2 21.54155159427567 12.327391413507407 37.032387647501885 29.098669344715038 3 21.025 16.825000000000003 23.75 38.4 4 26.424999999999997 24.375 21.875 27.325 5 26.3 29.525000000000002 23.549999999999997 20.625 6 20.7 31.075000000000003 24.75 23.474999999999998 7 18.05 24.725 38.2 19.025 8 19.3 22.400000000000002 31.424999999999997 26.875 9 19.225 21.95 34.55 24.275 10 21.475 34.275 25.775 18.475 11 25.275 26.900000000000002 21.15 26.674999999999997 12 22.225 24.05 27.325 26.400000000000002 13 22.1 25.874999999999996 27.700000000000003 24.325 14 22.175 25.35 28.000000000000004 24.474999999999998 15 22.425 24.625 27.6 25.35 16 24.175 24.275 24.8 26.75 17 22.275 27.0 26.625 24.099999999999998 18 22.275 24.775 26.375 26.575 19 23.7 26.575 24.55 25.174999999999997 20 22.075 27.075 26.85 24.0 21 22.75 25.624999999999996 26.424999999999997 25.2 22 22.55 26.900000000000002 25.85 24.7 23 22.125 26.224999999999998 26.950000000000003 24.7 24 22.7 25.0 26.35 25.95 25 23.45 25.4 25.275 25.874999999999996 26 23.35 25.15 25.95 25.55 27 22.375 25.45 26.424999999999997 25.75 28 21.95 25.650000000000002 26.6 25.8 29 22.3 26.1 26.3 25.3 30 23.200000000000003 24.45 26.400000000000002 25.95 31 23.075000000000003 25.724999999999998 25.05 26.150000000000002 32 22.025 25.674999999999997 27.400000000000002 24.9 33 21.85 24.525 27.1 26.525 34 23.3 26.85 25.6 24.25 35 21.725 28.175 26.075 24.025 36 22.15 24.7 26.775 26.375 37 23.0 26.85 25.0 25.15 38 24.525 26.375 24.525 24.575 39 21.7 26.650000000000002 26.224999999999998 25.424999999999997 40 23.575 25.1 26.224999999999998 25.1 41 23.175 25.424999999999997 26.325 25.074999999999996 42 20.825 26.200000000000003 27.075 25.900000000000002 43 23.05 25.1 25.974999999999998 25.874999999999996 44 22.6 26.224999999999998 25.650000000000002 25.525 45 22.35 25.324999999999996 26.974999999999998 25.35 46 23.65 25.900000000000002 25.224999999999998 25.224999999999998 47 22.025 26.8 26.224999999999998 24.95 48 21.925 26.400000000000002 26.450000000000003 25.224999999999998 49 23.275000000000002 25.85 25.650000000000002 25.224999999999998 50 22.675 25.650000000000002 26.724999999999998 24.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.5 22 1.0 23 2.5 24 4.0 25 9.5 26 15.0 27 16.0 28 17.0 29 26.5 30 36.0 31 51.5 32 67.0 33 79.0 34 91.0 35 112.0 36 133.0 37 164.5 38 196.0 39 223.5 40 251.0 41 285.0 42 319.0 43 339.5 44 360.0 45 355.5 46 351.0 47 346.5 48 342.0 49 347.0 50 352.0 51 326.0 52 300.0 53 270.0 54 240.0 55 215.5 56 191.0 57 187.0 58 183.0 59 155.5 60 128.0 61 120.5 62 113.0 63 104.0 64 95.0 65 87.0 66 79.0 67 69.0 68 59.0 69 46.0 70 33.0 71 27.0 72 21.0 73 14.5 74 8.0 75 6.0 76 4.0 77 2.0 78 0.0 79 2.5 80 5.0 81 3.5 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72403411941796 99.375 2 0.2508780732563974 0.5 3 0.0 0.0 4 0.0 0.0 5 0.025087807325639738 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCC 5 0.125 TruSeq Adapter, Index 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881740 spots for SRR11398535.sra Written 881740 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra Read 881729 spots for SRR11398535.sra Written 881729 spots for SRR11398535.sra SRR ids: ['SRR11398535.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bq7v2f2t SRR11398535.sra spots: 17634591 blocks: [[1, 881729], [881730, 1763458], [1763459, 2645187], [2645188, 3526916], [3526917, 4408645], [4408646, 5290374], [5290375, 6172103], [6172104, 7053832], [7053833, 7935561], [7935562, 8817290], [8817291, 9699019], [9699020, 10580748], [10580749, 11462477], [11462478, 12344206], [12344207, 13225935], [13225936, 14107664], [14107665, 14989393], [14989394, 15871122], [15871123, 16752851], [16752852, 17634591]] SRR11398535 file size 3011392 SRR11398535 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11398535 SRR11398535_1.fastq Input file: SRR11398535_1.fastq trimmed: SRR11398535-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:55:04 2024 >> started Sat Dec 7 13:55:14 2024 >> done (10.549s) 17634591 reads processed; of these: 250 ( 0.00%) short reads filtered out after trimming by size control 6589 ( 0.04%) empty reads filtered out after trimming by size control 17627752 (99.96%) reads available; of these: 4206 ( 0.02%) trimmed reads available after processing 17623546 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 151 0.00% 32 0 0.00% 33 7 0.00% 34 14 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 301 0.00% 45 158 0.00% 46 410 0.00% 47 2349 0.01% 48 95 0.00% 49 716 0.00% 50 17623546 99.98% 17627752 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=5.96 fanout-score-rank=17 prefix-density=0.07 prefix-fanout=4.5 sequence=CTTGATGACACCAACAGCAACTGTTTGTCTCATGTCACGCACAGCAAAACGACCAAGAGGAGGGTACATGGCGAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACGATACCAGCATCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=10 fanout-score=369.25 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=29.2 sequence=CTTCTTCTTGAT Started job on | Dec 07 13:55:23 Started mapping on | Dec 07 13:55:24 Finished on | Dec 07 13:55:39 Mapping speed, Million of reads per hour | 4230.66 Number of input reads | 17627752 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 16768226 Uniquely mapped reads % | 95.12% Average mapped length | 49.83 Number of splices: Total | 2703549 Number of splices: Annotated (sjdb) | 2620569 Number of splices: GT/AG | 2666033 Number of splices: GC/AG | 33172 Number of splices: AT/AC | 2025 Number of splices: Non-canonical | 2319 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 490484 % of reads mapped to multiple loci | 2.78% Number of reads mapped to too many loci | 147673 % of reads mapped to too many loci | 0.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.24% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 369042 369042 369042 N_multimapping 490484 490484 490484 N_noFeature 619008 16451467 702862 N_ambiguous 248599 1277 16580 UnstrandedReadsAssigned:15900619 PositiveStrandReadsAssigned:315482 NegativeStrandReadsAssigned:16048784 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR11398535 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR11398535-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,627,752 reads, 16,020,498 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52973 SRR11398535.ke.tsv 35125 SRR11398535.se.tsv 88098 total ==> SRR11398535.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 10.7949 1.35131 PNS24247 1044 945 59.416 6.58772 PNS24249 1928 1829 19.2528 1.10292 PNS24246 1044 945 59.416 6.58772 PNS24248 1044 945 59.416 6.58772 PNS24244 1471 1372 228.704 17.4656 PNS24243 293 194 0 0 KQK14069 1603 1504 35.3524 2.46283 KQK14071 474 375 8.83421 2.46831 ==> SRR11398535.se.tsv <== BRADI_1g14170v3 55 BRADI_1g53295v3 72 BRADI_1g59795v3 271 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 2077 BRADI_1g74790v3 357 BRADI_1g09890v3 0 BRADI_1g77505v3 179 BRADI_1g48960v3 0 SRR11398535 completed mapping pipeline successfully