Starting /dee2/code/volunteer_pipeline.sh SRR11398704 current disk space = 1543222149120 free memory = 1600290236 SRR11398704 SRAfilesize 7a504ae78adf2da2481dc0b839d3cd00 SRR11398704.sra SRR11398704.sra file validated SRR11398704 is single end SRR11398704 is conventional basespace SRR11398704 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11398704_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.24825 34.0 33.0 34.0 32.0 34.0 2 33.18775 34.0 33.0 34.0 33.0 34.0 3 33.18075 34.0 33.0 34.0 32.0 34.0 4 33.26425 34.0 33.0 34.0 33.0 34.0 5 33.2375 34.0 33.0 34.0 33.0 34.0 6 37.004 38.0 38.0 38.0 36.0 38.0 7 37.21475 38.0 38.0 38.0 36.0 38.0 8 37.28925 38.0 38.0 38.0 37.0 38.0 9 37.41775 38.0 38.0 38.0 37.0 38.0 10 37.397 38.0 38.0 38.0 37.0 38.0 11 37.3475 38.0 38.0 38.0 37.0 38.0 12 37.42625 38.0 38.0 38.0 37.0 38.0 13 37.37575 38.0 38.0 38.0 37.0 38.0 14 37.42675 38.0 38.0 38.0 37.0 38.0 15 37.20525 38.0 38.0 38.0 37.0 38.0 16 37.27525 38.0 38.0 38.0 37.0 38.0 17 37.35325 38.0 38.0 38.0 37.0 38.0 18 37.413 38.0 38.0 38.0 37.0 38.0 19 37.39775 38.0 38.0 38.0 37.0 38.0 20 37.38225 38.0 38.0 38.0 37.0 38.0 21 37.412 38.0 38.0 38.0 37.0 38.0 22 37.40175 38.0 38.0 38.0 37.0 38.0 23 37.39825 38.0 38.0 38.0 37.0 38.0 24 37.34225 38.0 38.0 38.0 37.0 38.0 25 37.379 38.0 38.0 38.0 37.0 38.0 26 37.399 38.0 38.0 38.0 37.0 38.0 27 37.37875 38.0 38.0 38.0 37.0 38.0 28 37.31275 38.0 38.0 38.0 37.0 38.0 29 37.359 38.0 38.0 38.0 37.0 38.0 30 37.29575 38.0 38.0 38.0 37.0 38.0 31 37.33325 38.0 38.0 38.0 37.0 38.0 32 37.3665 38.0 38.0 38.0 37.0 38.0 33 37.387 38.0 38.0 38.0 37.0 38.0 34 37.33425 38.0 38.0 38.0 37.0 38.0 35 37.33325 38.0 38.0 38.0 37.0 38.0 36 37.28 38.0 38.0 38.0 37.0 38.0 37 37.254 38.0 38.0 38.0 37.0 38.0 38 37.28775 38.0 38.0 38.0 37.0 38.0 39 37.3825 38.0 38.0 38.0 37.0 38.0 40 37.391 38.0 38.0 38.0 37.0 38.0 41 37.39 38.0 38.0 38.0 37.0 38.0 42 37.36275 38.0 38.0 38.0 37.0 38.0 43 37.353 38.0 38.0 38.0 37.0 38.0 44 37.36725 38.0 38.0 38.0 37.0 38.0 45 37.30175 38.0 38.0 38.0 37.0 38.0 46 37.23475 38.0 38.0 38.0 37.0 38.0 47 37.332 38.0 38.0 38.0 37.0 38.0 48 37.33825 38.0 38.0 38.0 37.0 38.0 49 37.2945 38.0 38.0 38.0 37.0 38.0 50 37.28175 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1116 1 0.0 1116 2 0.0 1116 3 0.0 1116 4 0.0 1116 5 0.0 1116 6 0.0 1116 7 0.0 1116 8 0.0 1116 9 0.0 1116 10 0.0 1116 11 0.0 1116 12 0.0 1116 13 0.0 1116 14 0.0 1116 15 0.0 1116 16 0.0 1116 17 0.0 1116 18 0.0 1116 19 0.0 1116 20 0.0 1116 21 0.0 1116 22 0.0 1116 23 0.0 1116 24 0.0 1116 25 0.0 1116 26 0.0 1116 27 0.0 1116 28 0.0 1116 29 0.0 1116 30 0.0 1116 31 0.0 1116 32 0.0 1116 33 0.0 1116 34 0.0 1116 35 0.0 1116 36 0.0 1116 37 0.0 1116 38 0.0 1116 39 0.0 1116 40 0.0 1116 41 0.0 1116 42 0.0 1116 43 0.0 1116 44 0.0 1116 45 0.0 1116 46 0.0 1116 47 0.0 1116 48 0.0 1116 49 0.0 1116 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 3.0 26 7.0 27 7.0 28 13.0 29 26.0 30 29.0 31 36.0 32 43.0 33 65.0 34 97.0 35 131.0 36 340.0 37 3200.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.699999999999996 10.75 6.4 35.15 2 22.00200702458605 11.138986452584044 37.35574510787757 29.50326141495233 3 20.75 17.849999999999998 25.575 35.825 4 26.35 24.275 23.075000000000003 26.3 5 26.55 28.125 24.725 20.599999999999998 6 22.400000000000002 30.525000000000002 23.825 23.25 7 17.4 24.525 39.375 18.7 8 20.275000000000002 22.975 29.675 27.075 9 20.150000000000002 21.825 31.75 26.275 10 22.375 33.025 25.5 19.1 11 26.424999999999997 25.825 21.3 26.450000000000003 12 24.474999999999998 22.775000000000002 26.025 26.724999999999998 13 23.45 25.575 25.624999999999996 25.35 14 22.7 25.674999999999997 28.000000000000004 23.625 15 23.1 25.474999999999998 25.324999999999996 26.1 16 24.3 24.0 25.15 26.55 17 23.799999999999997 25.0 26.25 24.95 18 24.925 24.474999999999998 24.725 25.874999999999996 19 23.625 26.8 25.05 24.525 20 22.85 25.474999999999998 26.650000000000002 25.025 21 23.175 25.25 26.224999999999998 25.35 22 23.075000000000003 26.674999999999997 23.7 26.55 23 22.375 25.15 27.325 25.15 24 22.825 24.474999999999998 26.3 26.400000000000002 25 24.425 25.974999999999998 23.1 26.5 26 23.200000000000003 25.6 26.25 24.95 27 23.525 24.85 24.925 26.700000000000003 28 25.55 24.775 24.45 25.224999999999998 29 24.8 25.474999999999998 24.975 24.75 30 22.975 26.075 25.35 25.6 31 24.8062015503876 25.831457864466117 24.55613903475869 24.8062015503876 32 24.075 25.650000000000002 24.675 25.6 33 21.875 25.25 25.775 27.1 34 24.9 26.450000000000003 23.075000000000003 25.575 35 23.599999999999998 24.95 25.525 25.924999999999997 36 22.95 25.374999999999996 26.450000000000003 25.224999999999998 37 24.75 25.15 24.7 25.4 38 24.0 25.825 24.7 25.474999999999998 39 22.725 25.474999999999998 25.674999999999997 26.125 40 24.0 25.224999999999998 25.25 25.525 41 24.2 26.950000000000003 25.624999999999996 23.225 42 23.849999999999998 24.825 24.825 26.5 43 24.3 24.575 25.5 25.624999999999996 44 23.9 25.324999999999996 25.525 25.25 45 25.074999999999996 24.2 24.4 26.325 46 23.275000000000002 25.55 25.6 25.575 47 22.8 25.324999999999996 26.35 25.525 48 23.575 24.425 25.025 26.974999999999998 49 23.875 24.875 25.224999999999998 26.025 50 23.75 24.6 26.325 25.324999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 3.0 20 4.0 21 4.0 22 4.0 23 5.0 24 6.0 25 7.0 26 8.0 27 15.0 28 22.0 29 27.5 30 33.0 31 41.0 32 49.0 33 78.0 34 107.0 35 119.0 36 131.0 37 177.0 38 223.0 39 227.5 40 232.0 41 263.0 42 294.0 43 291.5 44 289.0 45 303.5 46 318.0 47 302.5 48 287.0 49 294.0 50 301.0 51 310.5 52 320.0 53 275.0 54 230.0 55 220.0 56 210.0 57 200.5 58 191.0 59 173.5 60 156.0 61 141.0 62 126.0 63 122.0 64 118.0 65 100.5 66 83.0 67 79.0 68 75.0 69 66.0 70 57.0 71 52.0 72 47.0 73 40.5 74 34.0 75 27.0 76 20.0 77 18.0 78 16.0 79 9.5 80 3.0 81 3.0 82 3.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.025 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.4273504273504274 0.8500000000000001 3 0.025138260432378077 0.075 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930134 spots for SRR11398704.sra Written 930134 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra Read 930129 spots for SRR11398704.sra Written 930129 spots for SRR11398704.sra SRR ids: ['SRR11398704.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iwhp2zqr SRR11398704.sra spots: 18602585 blocks: [[1, 930129], [930130, 1860258], [1860259, 2790387], [2790388, 3720516], [3720517, 4650645], [4650646, 5580774], [5580775, 6510903], [6510904, 7441032], [7441033, 8371161], [8371162, 9301290], [9301291, 10231419], [10231420, 11161548], [11161549, 12091677], [12091678, 13021806], [13021807, 13951935], [13951936, 14882064], [14882065, 15812193], [15812194, 16742322], [16742323, 17672451], [17672452, 18602585]] SRR11398704 file size 3177284 SRR11398704 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11398704 SRR11398704_1.fastq Input file: SRR11398704_1.fastq trimmed: SRR11398704-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:55:21 2024 >> started Sat Dec 7 13:55:36 2024 >> done (14.258s) 18602585 reads processed; of these: 235 ( 0.00%) short reads filtered out after trimming by size control 30753 ( 0.17%) empty reads filtered out after trimming by size control 18571597 (99.83%) reads available; of these: 4518 ( 0.02%) trimmed reads available after processing 18567079 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 128 0.00% 32 0 0.00% 33 4 0.00% 34 15 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 1 0.00% 43 0 0.00% 44 305 0.00% 45 178 0.00% 46 440 0.00% 47 2563 0.01% 48 122 0.00% 49 759 0.00% 50 18567079 99.98% 18571597 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=31 prefix-density=0.00 prefix-fanout=1.0 sequence=TTTTTTTTTTGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=20 fanout-score=192.00 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=21.6 sequence=TCTTCTTCTTGTC Started job on | Dec 07 13:55:46 Started mapping on | Dec 07 13:55:46 Finished on | Dec 07 13:56:05 Mapping speed, Million of reads per hour | 3518.83 Number of input reads | 18571597 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 17118813 Uniquely mapped reads % | 92.18% Average mapped length | 49.82 Number of splices: Total | 2563953 Number of splices: Annotated (sjdb) | 2478978 Number of splices: GT/AG | 2527662 Number of splices: GC/AG | 31815 Number of splices: AT/AC | 1677 Number of splices: Non-canonical | 2799 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 518763 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 676559 % of reads mapped to too many loci | 3.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.34% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 934021 934021 934021 N_multimapping 518763 518763 518763 N_noFeature 641657 16759280 752276 N_ambiguous 265453 1144 17554 UnstrandedReadsAssigned:16211703 PositiveStrandReadsAssigned:358389 NegativeStrandReadsAssigned:16348983 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR11398704 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR11398704-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,571,597 reads, 16,292,720 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52973 SRR11398704.ke.tsv 35125 SRR11398704.se.tsv 88098 total ==> SRR11398704.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.0034565 0.000414114 PNS24247 1044 945 54.639 5.79803 PNS24249 1928 1829 84.9046 4.65507 PNS24246 1044 945 54.639 5.79803 PNS24248 1044 945 54.639 5.79803 PNS24244 1471 1372 162.175 11.8533 PNS24243 293 194 0 0 KQK14069 1603 1504 154.878 10.3265 KQK14071 474 375 21.6198 5.78134 ==> SRR11398704.se.tsv <== BRADI_1g14170v3 215 BRADI_1g53295v3 96 BRADI_1g59795v3 287 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 1338 BRADI_1g74790v3 449 BRADI_1g09890v3 0 BRADI_1g77505v3 157 BRADI_1g48960v3 1 SRR11398704 completed mapping pipeline successfully