Starting /dee2/code/volunteer_pipeline.sh SRR11398705 current disk space = 1543214854144 free memory = 1598639636 SRR11398705 SRAfilesize 85509b0c9e99fcbadc03dbe0e6df10e3 SRR11398705.sra SRR11398705.sra file validated SRR11398705 is single end SRR11398705 is conventional basespace SRR11398705 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11398705_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.25575 34.0 33.0 34.0 33.0 34.0 2 33.12075 34.0 33.0 34.0 32.0 34.0 3 33.202 34.0 33.0 34.0 32.0 34.0 4 33.29525 34.0 33.0 34.0 32.0 34.0 5 33.25775 34.0 33.0 34.0 32.0 34.0 6 37.065 38.0 38.0 38.0 36.0 38.0 7 37.3145 38.0 38.0 38.0 37.0 38.0 8 37.33075 38.0 38.0 38.0 37.0 38.0 9 37.4245 38.0 38.0 38.0 37.0 38.0 10 37.36175 38.0 38.0 38.0 37.0 38.0 11 37.361 38.0 38.0 38.0 37.0 38.0 12 37.39575 38.0 38.0 38.0 37.0 38.0 13 37.41 38.0 38.0 38.0 37.0 38.0 14 37.4025 38.0 38.0 38.0 37.0 38.0 15 37.301 38.0 38.0 38.0 37.0 38.0 16 37.40475 38.0 38.0 38.0 37.0 38.0 17 37.44875 38.0 38.0 38.0 37.0 38.0 18 37.48 38.0 38.0 38.0 38.0 38.0 19 37.43075 38.0 38.0 38.0 38.0 38.0 20 37.4585 38.0 38.0 38.0 37.0 38.0 21 37.39925 38.0 38.0 38.0 37.0 38.0 22 37.43925 38.0 38.0 38.0 37.0 38.0 23 37.423 38.0 38.0 38.0 37.0 38.0 24 37.42525 38.0 38.0 38.0 37.0 38.0 25 37.46675 38.0 38.0 38.0 37.0 38.0 26 37.36275 38.0 38.0 38.0 37.0 38.0 27 37.362 38.0 38.0 38.0 37.0 38.0 28 37.25325 38.0 38.0 38.0 37.0 38.0 29 37.359 38.0 38.0 38.0 37.0 38.0 30 37.34975 38.0 38.0 38.0 37.0 38.0 31 37.39025 38.0 38.0 38.0 37.0 38.0 32 37.39075 38.0 38.0 38.0 37.0 38.0 33 37.2925 38.0 38.0 38.0 37.0 38.0 34 37.25475 38.0 38.0 38.0 37.0 38.0 35 37.349 38.0 38.0 38.0 37.0 38.0 36 37.318 38.0 38.0 38.0 37.0 38.0 37 37.32625 38.0 38.0 38.0 37.0 38.0 38 37.327 38.0 38.0 38.0 37.0 38.0 39 37.34875 38.0 38.0 38.0 37.0 38.0 40 37.412 38.0 38.0 38.0 37.0 38.0 41 37.369 38.0 38.0 38.0 37.0 38.0 42 37.36325 38.0 38.0 38.0 37.0 38.0 43 37.344 38.0 38.0 38.0 37.0 38.0 44 37.29525 38.0 38.0 38.0 37.0 38.0 45 37.282 38.0 38.0 38.0 37.0 38.0 46 37.26425 38.0 38.0 38.0 37.0 38.0 47 37.34 38.0 38.0 38.0 37.0 38.0 48 37.4105 38.0 38.0 38.0 37.0 38.0 49 37.346 38.0 38.0 38.0 37.0 38.0 50 37.35425 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1116 1 0.0 1116 2 0.0 1116 3 0.0 1116 4 0.0 1116 5 0.0 1116 6 0.0 1116 7 0.0 1116 8 0.0 1116 9 0.0 1116 10 0.0 1116 11 0.0 1116 12 0.0 1116 13 0.0 1116 14 0.0 1116 15 0.0 1116 16 0.0 1116 17 0.0 1116 18 0.0 1116 19 0.0 1116 20 0.0 1116 21 0.0 1116 22 0.0 1116 23 0.0 1116 24 0.0 1116 25 0.0 1116 26 0.0 1116 27 0.0 1116 28 0.0 1116 29 0.0 1116 30 0.0 1116 31 0.0 1116 32 0.0 1116 33 0.0 1116 34 0.0 1116 35 0.0 1116 36 0.0 1116 37 0.0 1116 38 0.0 1116 39 0.0 1116 40 0.0 1116 41 0.0 1116 42 0.0 1116 43 0.0 1116 44 0.0 1116 45 0.0 1116 46 0.0 1116 47 0.0 1116 48 0.0 1116 49 0.0 1116 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 3.0 26 4.0 27 9.0 28 12.0 29 17.0 30 24.0 31 38.0 32 50.0 33 78.0 34 84.0 35 127.0 36 350.0 37 3202.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.400000000000006 10.525 7.775 35.3 2 22.895199798944457 11.686353355114349 36.51671274189495 28.901734104046245 3 21.5 17.575 25.275 35.65 4 26.6 23.25 22.900000000000002 27.250000000000004 5 26.825 29.725 23.325000000000003 20.125 6 21.4 31.724999999999998 24.55 22.325 7 18.224999999999998 23.925 38.2 19.650000000000002 8 18.175 23.150000000000002 31.225 27.450000000000003 9 19.375 22.25 32.025 26.35 10 21.325 34.275 24.375 20.025000000000002 11 27.075 25.275 22.525000000000002 25.124999999999996 12 24.349999999999998 21.175 26.25 28.225 13 23.65 25.8 26.775 23.775 14 23.0 25.275 25.35 26.375 15 21.95 24.875 26.674999999999997 26.5 16 24.075 25.5 25.124999999999996 25.3 17 23.375 26.450000000000003 25.05 25.124999999999996 18 24.45 25.3 24.925 25.324999999999996 19 24.425 26.6 24.55 24.425 20 22.45 25.924999999999997 25.575 26.05 21 24.05 24.224999999999998 24.925 26.8 22 24.425 25.674999999999997 25.6 24.3 23 23.5 24.675 27.450000000000003 24.375 24 22.525000000000002 25.5 24.975 27.0 25 24.15 25.1 24.2 26.55 26 23.599999999999998 26.224999999999998 25.6 24.575 27 23.525 24.05 26.3 26.125 28 23.674999999999997 25.95 25.025 25.35 29 23.525 25.8 25.45 25.224999999999998 30 22.6 24.95 25.474999999999998 26.974999999999998 31 25.324999999999996 25.4 24.2 25.074999999999996 32 24.85 25.8 24.5 24.85 33 22.825 25.924999999999997 26.125 25.124999999999996 34 24.925 24.725 23.875 26.474999999999998 35 23.275000000000002 25.650000000000002 25.15 25.924999999999997 36 23.0 25.7 25.5 25.8 37 24.975 25.650000000000002 24.175 25.2 38 22.8 25.8 25.424999999999997 25.974999999999998 39 23.225 25.324999999999996 25.650000000000002 25.8 40 24.15 25.674999999999997 23.3 26.875 41 23.799999999999997 26.450000000000003 24.8 24.95 42 23.025000000000002 25.0 25.2 26.775 43 23.35 25.55 25.7 25.4 44 22.875 26.275 25.474999999999998 25.374999999999996 45 23.225 25.5 24.825 26.450000000000003 46 25.474999999999998 25.6 24.4 24.525 47 24.05 25.424999999999997 25.174999999999997 25.35 48 23.075000000000003 25.8 25.0 26.125 49 25.025 25.6 24.575 24.8 50 23.95 25.45 25.05 25.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 2.0 20 3.0 21 2.0 22 1.0 23 6.0 24 11.0 25 10.5 26 10.0 27 16.0 28 22.0 29 25.5 30 29.0 31 46.5 32 64.0 33 75.5 34 87.0 35 120.0 36 153.0 37 163.5 38 174.0 39 222.5 40 271.0 41 269.5 42 268.0 43 295.5 44 323.0 45 310.0 46 297.0 47 328.0 48 359.0 49 341.5 50 324.0 51 298.0 52 272.0 53 242.0 54 212.0 55 207.5 56 203.0 57 184.5 58 166.0 59 161.5 60 157.0 61 153.0 62 149.0 63 117.5 64 86.0 65 88.0 66 90.0 67 81.0 68 72.0 69 65.0 70 58.0 71 52.0 72 46.0 73 41.0 74 36.0 75 30.0 76 24.0 77 19.5 78 15.0 79 11.5 80 8.0 81 7.5 82 7.0 83 4.5 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888457 spots for SRR11398705.sra Written 888457 spots for SRR11398705.sra Read 888475 spots for SRR11398705.sra Written 888475 spots for SRR11398705.sra SRR ids: ['SRR11398705.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w6wxm8up SRR11398705.sra spots: 17769158 blocks: [[1, 888457], [888458, 1776914], [1776915, 2665371], [2665372, 3553828], [3553829, 4442285], [4442286, 5330742], [5330743, 6219199], [6219200, 7107656], [7107657, 7996113], [7996114, 8884570], [8884571, 9773027], [9773028, 10661484], [10661485, 11549941], [11549942, 12438398], [12438399, 13326855], [13326856, 14215312], [14215313, 15103769], [15103770, 15992226], [15992227, 16880683], [16880684, 17769158]] SRR11398705 file size 3034455 SRR11398705 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11398705 SRR11398705_1.fastq Input file: SRR11398705_1.fastq trimmed: SRR11398705-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:55:17 2024 >> started Sat Dec 7 13:55:28 2024 >> done (10.257s) 17769158 reads processed; of these: 243 ( 0.00%) short reads filtered out after trimming by size control 8404 ( 0.05%) empty reads filtered out after trimming by size control 17760511 (99.95%) reads available; of these: 4329 ( 0.02%) trimmed reads available after processing 17756182 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 145 0.00% 32 0 0.00% 33 6 0.00% 34 17 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 3 0.00% 43 0 0.00% 44 352 0.00% 45 199 0.00% 46 410 0.00% 47 2377 0.01% 48 119 0.00% 49 690 0.00% 50 17756182 99.98% 17760511 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=26 prefix-density=0.07 prefix-fanout=2.3 sequence=AGAGGCAGCCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=19 fanout-score=377.55 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=26.6 sequence=CTTCTTCTTGAT Started job on | Dec 07 13:55:45 Started mapping on | Dec 07 13:55:45 Finished on | Dec 07 13:56:03 Mapping speed, Million of reads per hour | 3552.10 Number of input reads | 17760511 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 16747028 Uniquely mapped reads % | 94.29% Average mapped length | 49.83 Number of splices: Total | 2588737 Number of splices: Annotated (sjdb) | 2503201 Number of splices: GT/AG | 2552372 Number of splices: GC/AG | 31933 Number of splices: AT/AC | 1762 Number of splices: Non-canonical | 2670 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 482885 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 273607 % of reads mapped to too many loci | 1.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.42% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 530598 530598 530598 N_multimapping 482885 482885 482885 N_noFeature 622730 16404071 725373 N_ambiguous 257040 1197 17964 UnstrandedReadsAssigned:15867258 PositiveStrandReadsAssigned:341760 NegativeStrandReadsAssigned:16003691 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR11398705 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR11398705-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,760,511 reads, 15,934,322 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52973 SRR11398705.ke.tsv 35125 SRR11398705.se.tsv 88098 total ==> SRR11398705.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 100.335 12.4316 PNS24247 1044 945 25.1174 2.7564 PNS24249 1928 1829 92.225 5.22919 PNS24246 1044 945 25.1174 2.7564 PNS24248 1044 945 25.1174 2.7564 PNS24244 1471 1372 106.088 8.0188 PNS24243 293 194 0 0 KQK14069 1603 1504 524.219 36.1463 KQK14071 474 375 137.857 38.1237 ==> SRR11398705.se.tsv <== BRADI_1g14170v3 1062 BRADI_1g53295v3 98 BRADI_1g59795v3 310 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 1217 BRADI_1g74790v3 396 BRADI_1g09890v3 0 BRADI_1g77505v3 146 BRADI_1g48960v3 0 SRR11398705 completed mapping pipeline successfully