Starting /dee2/code/volunteer_pipeline.sh SRR11398706 current disk space = 1543227949056 free memory = 1593494304 SRR11398706 SRAfilesize f04d6918644d31cb2c48d89ca39a47a1 SRR11398706.sra SRR11398706.sra file validated SRR11398706 is single end SRR11398706 is conventional basespace SRR11398706 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11398706_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.19825 34.0 33.0 34.0 32.0 34.0 2 33.1375 34.0 33.0 34.0 32.0 34.0 3 33.09025 34.0 33.0 34.0 32.0 34.0 4 33.1805 34.0 33.0 34.0 32.0 34.0 5 33.10275 34.0 33.0 34.0 32.0 34.0 6 36.74775 38.0 38.0 38.0 35.0 38.0 7 37.11175 38.0 38.0 38.0 36.0 38.0 8 37.226 38.0 38.0 38.0 36.0 38.0 9 37.23275 38.0 38.0 38.0 37.0 38.0 10 37.236 38.0 38.0 38.0 37.0 38.0 11 37.29425 38.0 38.0 38.0 37.0 38.0 12 37.315 38.0 38.0 38.0 37.0 38.0 13 37.25125 38.0 38.0 38.0 37.0 38.0 14 37.24375 38.0 38.0 38.0 37.0 38.0 15 37.05675 38.0 38.0 38.0 36.0 38.0 16 37.1635 38.0 38.0 38.0 37.0 38.0 17 37.29525 38.0 38.0 38.0 37.0 38.0 18 37.32325 38.0 38.0 38.0 37.0 38.0 19 37.2975 38.0 38.0 38.0 37.0 38.0 20 37.28025 38.0 38.0 38.0 37.0 38.0 21 37.3225 38.0 38.0 38.0 37.0 38.0 22 37.2315 38.0 38.0 38.0 37.0 38.0 23 37.308 38.0 38.0 38.0 37.0 38.0 24 37.296 38.0 38.0 38.0 37.0 38.0 25 37.2945 38.0 38.0 38.0 37.0 38.0 26 37.29925 38.0 38.0 38.0 37.0 38.0 27 37.24975 38.0 38.0 38.0 37.0 38.0 28 37.14525 38.0 38.0 38.0 37.0 38.0 29 37.28275 38.0 38.0 38.0 37.0 38.0 30 37.22775 38.0 38.0 38.0 37.0 38.0 31 37.2535 38.0 38.0 38.0 37.0 38.0 32 37.22175 38.0 38.0 38.0 37.0 38.0 33 37.3235 38.0 38.0 38.0 37.0 38.0 34 37.2295 38.0 38.0 38.0 37.0 38.0 35 37.29225 38.0 38.0 38.0 37.0 38.0 36 37.2705 38.0 38.0 38.0 37.0 38.0 37 37.2205 38.0 38.0 38.0 37.0 38.0 38 37.21275 38.0 38.0 38.0 37.0 38.0 39 37.19 38.0 38.0 38.0 37.0 38.0 40 37.19175 38.0 38.0 38.0 37.0 38.0 41 37.197 38.0 38.0 38.0 37.0 38.0 42 37.2465 38.0 38.0 38.0 37.0 38.0 43 37.28325 38.0 38.0 38.0 37.0 38.0 44 37.31825 38.0 38.0 38.0 37.0 38.0 45 37.2235 38.0 38.0 38.0 37.0 38.0 46 37.086 38.0 38.0 38.0 36.0 38.0 47 37.2035 38.0 38.0 38.0 37.0 38.0 48 37.27875 38.0 38.0 38.0 37.0 38.0 49 37.26275 38.0 38.0 38.0 37.0 38.0 50 37.2265 38.0 38.0 38.0 37.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1116 1 0.0 1116 2 0.0 1116 3 0.0 1116 4 0.0 1116 5 0.0 1116 6 0.0 1116 7 0.0 1116 8 0.0 1116 9 0.0 1116 10 0.0 1116 11 0.0 1116 12 0.0 1116 13 0.0 1116 14 0.0 1116 15 0.0 1116 16 0.0 1116 17 0.0 1116 18 0.0 1116 19 0.0 1116 20 0.0 1116 21 0.0 1116 22 0.0 1116 23 0.0 1116 24 0.0 1116 25 0.0 1116 26 0.0 1116 27 0.0 1116 28 0.0 1116 29 0.0 1116 30 0.0 1116 31 0.0 1116 32 0.0 1116 33 0.0 1116 34 0.0 1116 35 0.0 1116 36 0.0 1116 37 0.0 1116 38 0.0 1116 39 0.0 1116 40 0.0 1116 41 0.0 1116 42 0.0 1116 43 0.0 1116 44 0.0 1116 45 0.0 1116 46 0.0 1116 47 0.0 1116 48 0.0 1116 49 0.0 1116 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 4.0 25 3.0 26 12.0 27 8.0 28 19.0 29 35.0 30 24.0 31 42.0 32 58.0 33 79.0 34 101.0 35 151.0 36 354.0 37 3109.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.125 11.55 10.825 35.5 2 24.092161282243925 11.670423240671173 34.109691960931634 30.12772351615327 3 21.930482620655166 18.02950737684421 23.93098274568642 36.1090272568142 4 29.675 21.8 22.5 26.025 5 25.874999999999996 29.95 23.825 20.349999999999998 6 20.075000000000003 31.874999999999996 25.55 22.5 7 19.175 23.75 35.875 21.2 8 20.7 21.6 31.75 25.95 9 19.625 24.025 31.324999999999996 25.025 10 22.375 32.35 23.799999999999997 21.475 11 25.474999999999998 25.624999999999996 21.875 27.025 12 23.9 23.325000000000003 26.200000000000003 26.575 13 23.400000000000002 23.974999999999998 25.724999999999998 26.900000000000002 14 24.325 25.15 26.35 24.175 15 23.5 24.65 25.224999999999998 26.625 16 24.425 24.8 24.925 25.85 17 23.799999999999997 25.724999999999998 26.474999999999998 24.0 18 22.875 25.224999999999998 25.75 26.150000000000002 19 23.5 24.675 27.0 24.825 20 25.124999999999996 24.725 24.725 25.424999999999997 21 22.75 24.25 26.875 26.125 22 22.900000000000002 25.424999999999997 25.374999999999996 26.3 23 23.150000000000002 24.9 25.775 26.174999999999997 24 24.025 25.1 25.074999999999996 25.8 25 24.425 25.124999999999996 24.425 26.025 26 22.675 25.45 25.275 26.6 27 23.275000000000002 24.7 25.624999999999996 26.400000000000002 28 23.5 26.05 24.65 25.8 29 23.65 25.374999999999996 25.55 25.424999999999997 30 23.0 23.625 25.75 27.625 31 22.7 25.0 25.624999999999996 26.674999999999997 32 22.975 26.200000000000003 24.349999999999998 26.474999999999998 33 22.525000000000002 24.275 25.900000000000002 27.3 34 24.15 25.05 25.35 25.45 35 23.625 25.0 25.900000000000002 25.474999999999998 36 23.575 25.2 25.3 25.924999999999997 37 22.55 25.4 26.25 25.8 38 23.325000000000003 25.474999999999998 25.85 25.35 39 23.025000000000002 26.075 24.325 26.575 40 23.425 25.224999999999998 24.6 26.75 41 22.25 26.05 25.224999999999998 26.474999999999998 42 23.9 26.1 25.275 24.725 43 24.55 23.7 24.7 27.05 44 23.875 26.325 24.375 25.424999999999997 45 22.975 24.825 26.85 25.35 46 23.3 24.85 26.150000000000002 25.7 47 23.674999999999997 25.825 25.874999999999996 24.625 48 24.349999999999998 24.8 24.2 26.650000000000002 49 23.225 26.1 24.4 26.275 50 23.325000000000003 25.525 24.474999999999998 26.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 1.0 21 2.0 22 3.0 23 4.0 24 5.0 25 6.0 26 7.0 27 14.0 28 21.0 29 26.5 30 32.0 31 43.5 32 55.0 33 69.0 34 83.0 35 109.5 36 136.0 37 157.5 38 179.0 39 206.5 40 234.0 41 257.5 42 281.0 43 291.0 44 301.0 45 322.0 46 343.0 47 329.5 48 316.0 49 332.5 50 349.0 51 315.5 52 282.0 53 269.0 54 256.0 55 232.0 56 208.0 57 190.5 58 173.0 59 166.0 60 159.0 61 139.5 62 120.0 63 116.0 64 112.0 65 97.5 66 83.0 67 81.0 68 79.0 69 80.5 70 82.0 71 63.0 72 44.0 73 33.5 74 23.0 75 19.0 76 15.0 77 11.0 78 7.0 79 7.5 80 8.0 81 4.0 82 0.0 83 1.0 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69643308879333 98.52499999999999 2 0.22767518340500886 0.44999999999999996 3 0.025297242600556536 0.075 4 0.0 0.0 5 0.025297242600556536 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025297242600556536 0.8250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC 33 0.8250000000000001 TruSeq Adapter, Index 7 (100% over 50bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 5 0.125 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877948 spots for SRR11398706.sra Written 877948 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra Read 877943 spots for SRR11398706.sra Written 877943 spots for SRR11398706.sra SRR ids: ['SRR11398706.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r52k9u48 SRR11398706.sra spots: 17558865 blocks: [[1, 877943], [877944, 1755886], [1755887, 2633829], [2633830, 3511772], [3511773, 4389715], [4389716, 5267658], [5267659, 6145601], [6145602, 7023544], [7023545, 7901487], [7901488, 8779430], [8779431, 9657373], [9657374, 10535316], [10535317, 11413259], [11413260, 12291202], [12291203, 13169145], [13169146, 14047088], [14047089, 14925031], [14925032, 15802974], [15802975, 16680917], [16680918, 17558865]] SRR11398706 file size 2998413 SRR11398706 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11398706 SRR11398706_1.fastq Input file: SRR11398706_1.fastq trimmed: SRR11398706-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:58:51 2024 >> started Sat Dec 7 13:59:02 2024 >> done (10.669s) 17558865 reads processed; of these: 206 ( 0.00%) short reads filtered out after trimming by size control 10522 ( 0.06%) empty reads filtered out after trimming by size control 17548137 (99.94%) reads available; of these: 4302 ( 0.02%) trimmed reads available after processing 17543835 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 115 0.00% 32 0 0.00% 33 4 0.00% 34 10 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 309 0.00% 45 191 0.00% 46 391 0.00% 47 2444 0.01% 48 115 0.00% 49 722 0.00% 50 17543835 99.98% 17548137 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=19 prefix-density=0.07 prefix-fanout=2.7 sequence=AGAGGCAGCCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=18 fanout-score=186.25 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=20.4 sequence=TCTTCTTCTTGTC Started job on | Dec 07 13:59:13 Started mapping on | Dec 07 13:59:14 Finished on | Dec 07 13:59:37 Mapping speed, Million of reads per hour | 2746.66 Number of input reads | 17548137 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 16267501 Uniquely mapped reads % | 92.70% Average mapped length | 49.84 Number of splices: Total | 2531048 Number of splices: Annotated (sjdb) | 2448916 Number of splices: GT/AG | 2495630 Number of splices: GC/AG | 31324 Number of splices: AT/AC | 1728 Number of splices: Non-canonical | 2366 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.57 Insertion rate per base | 0.00% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 479804 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 348680 % of reads mapped to too many loci | 1.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.55% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 800832 800832 800832 N_multimapping 479804 479804 479804 N_noFeature 580182 15943535 680455 N_ambiguous 238954 1191 16161 UnstrandedReadsAssigned:15448365 PositiveStrandReadsAssigned:322775 NegativeStrandReadsAssigned:15570885 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR11398706 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR11398706-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,548,137 reads, 15,471,692 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52973 SRR11398706.ke.tsv 35125 SRR11398706.se.tsv 88098 total ==> SRR11398706.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 39.5851 5.03302 PNS24247 1044 945 36.3576 4.09435 PNS24249 1928 1829 79.988 4.65407 PNS24246 1044 945 36.3576 4.09435 PNS24248 1044 945 36.3576 4.09435 PNS24244 1471 1372 118.354 9.18019 PNS24243 293 194 0 0 KQK14069 1603 1504 39.9646 2.82781 KQK14071 474 375 7.03543 1.99656 ==> SRR11398706.se.tsv <== BRADI_1g14170v3 47 BRADI_1g53295v3 68 BRADI_1g59795v3 253 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 1290 BRADI_1g74790v3 470 BRADI_1g09890v3 1 BRADI_1g77505v3 154 BRADI_1g48960v3 0 SRR11398706 completed mapping pipeline successfully