Starting /dee2/code/volunteer_pipeline.sh SRR11668420 current disk space = 1551841546240 free memory = 1602188972 SRR11668420 SRAfilesize 5fa22de517d9353f5baf7dc854032f3f SRR11668420.sra SRR11668420.sra file validated SRR11668420 is paired end SRR11668420 is conventional basespace SRR11668420 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668420_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.168 37.0 37.0 37.0 37.0 37.0 2 35.8275 37.0 37.0 37.0 37.0 37.0 3 36.335 37.0 37.0 37.0 37.0 37.0 4 36.29525 37.0 37.0 37.0 37.0 37.0 5 36.325 37.0 37.0 37.0 37.0 37.0 6 36.2725 37.0 37.0 37.0 37.0 37.0 7 36.1385 37.0 37.0 37.0 37.0 37.0 8 36.272 37.0 37.0 37.0 37.0 37.0 9 36.2225 37.0 37.0 37.0 37.0 37.0 10-11 36.214749999999995 37.0 37.0 37.0 37.0 37.0 12-13 36.268 37.0 37.0 37.0 37.0 37.0 14-15 36.26625 37.0 37.0 37.0 37.0 37.0 16-17 36.190250000000006 37.0 37.0 37.0 37.0 37.0 18-19 36.206500000000005 37.0 37.0 37.0 37.0 37.0 20-21 36.20125 37.0 37.0 37.0 37.0 37.0 22-23 36.2475 37.0 37.0 37.0 37.0 37.0 24-25 36.144999999999996 37.0 37.0 37.0 37.0 37.0 26-27 36.08825 37.0 37.0 37.0 37.0 37.0 28-29 36.0775 37.0 37.0 37.0 37.0 37.0 30-31 36.07225 37.0 37.0 37.0 37.0 37.0 32-33 36.120999999999995 37.0 37.0 37.0 37.0 37.0 34-35 36.03175 37.0 37.0 37.0 37.0 37.0 36-37 35.92975 37.0 37.0 37.0 37.0 37.0 38-39 36.06725 37.0 37.0 37.0 37.0 37.0 40-41 36.004000000000005 37.0 37.0 37.0 37.0 37.0 42-43 35.998000000000005 37.0 37.0 37.0 37.0 37.0 44-45 35.93125 37.0 37.0 37.0 37.0 37.0 46-47 36.02875 37.0 37.0 37.0 37.0 37.0 48-49 35.99325 37.0 37.0 37.0 37.0 37.0 50-51 35.9975 37.0 37.0 37.0 37.0 37.0 52-53 35.85125 37.0 37.0 37.0 37.0 37.0 54-55 35.90275 37.0 37.0 37.0 37.0 37.0 56-57 35.85825 37.0 37.0 37.0 37.0 37.0 58-59 35.8935 37.0 37.0 37.0 37.0 37.0 60-61 35.959500000000006 37.0 37.0 37.0 37.0 37.0 62-63 35.9055 37.0 37.0 37.0 37.0 37.0 64-65 35.837999999999994 37.0 37.0 37.0 37.0 37.0 66-67 35.887249999999995 37.0 37.0 37.0 37.0 37.0 68-69 35.735749999999996 37.0 37.0 37.0 37.0 37.0 70-71 35.884 37.0 37.0 37.0 37.0 37.0 72-73 35.88125 37.0 37.0 37.0 37.0 37.0 74-75 35.845 37.0 37.0 37.0 37.0 37.0 76-77 35.89975 37.0 37.0 37.0 37.0 37.0 78-79 35.8605 37.0 37.0 37.0 37.0 37.0 80-81 35.81975 37.0 37.0 37.0 37.0 37.0 82-83 35.860749999999996 37.0 37.0 37.0 37.0 37.0 84-85 35.79275 37.0 37.0 37.0 37.0 37.0 86-87 35.8405 37.0 37.0 37.0 37.0 37.0 88-89 35.815 37.0 37.0 37.0 37.0 37.0 90-91 35.777 37.0 37.0 37.0 37.0 37.0 92-93 35.78075 37.0 37.0 37.0 37.0 37.0 94-95 35.748 37.0 37.0 37.0 37.0 37.0 96-97 35.67625 37.0 37.0 37.0 37.0 37.0 98-99 35.695499999999996 37.0 37.0 37.0 37.0 37.0 100-101 35.620000000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 2.0 25 6.0 26 15.0 27 9.0 28 21.0 29 34.0 30 52.0 31 66.0 32 90.0 33 101.0 34 169.0 35 351.0 36 2481.0 37 599.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.55 9.375 13.05 43.025000000000006 2 30.91046277665996 11.19215291750503 29.652917505030178 28.24446680080483 3 28.225 18.375 18.725 34.675 4 33.80845211302826 19.02975743935984 17.65441360340085 29.507376844211052 5 32.074999999999996 24.625 19.85 23.45 6 24.025 27.675 22.575 25.724999999999998 7 19.775000000000002 26.25 33.074999999999996 20.9 8 20.95 21.925 29.375 27.750000000000004 9 23.575 20.625 29.125 26.674999999999997 10-11 24.7 27.200000000000003 22.95 25.15 12-13 25.662499999999998 22.112499999999997 24.8 27.425 14-15 25.362499999999997 23.7375 23.75 27.150000000000002 16-17 25.2625 24.075 23.925 26.737499999999997 18-19 25.324999999999996 24.349999999999998 24.2 26.125 20-21 24.587500000000002 24.4375 24.337500000000002 26.637499999999996 22-23 25.662499999999998 23.962500000000002 23.8875 26.487500000000004 24-25 24.825 23.2625 25.137500000000003 26.775 26-27 24.6875 23.474999999999998 24.025 27.8125 28-29 25.1 23.95 24.1375 26.8125 30-31 25.2 23.8125 23.875 27.1125 32-33 24.45 23.6375 24.1125 27.800000000000004 34-35 25.3125 24.0 23.875 26.8125 36-37 25.912499999999998 23.875 22.975 27.237499999999997 38-39 25.6125 23.6375 22.7625 27.987499999999997 40-41 24.6875 23.7625 23.8375 27.712500000000002 42-43 25.912499999999998 24.1875 23.0125 26.887499999999996 44-45 25.837500000000002 23.6625 23.0125 27.487499999999997 46-47 25.087500000000002 23.7 24.474999999999998 26.737499999999997 48-49 24.6625 23.075000000000003 23.5875 28.675 50-51 25.8 23.8375 23.525 26.8375 52-53 26.1625 23.0625 23.549999999999997 27.224999999999998 54-55 25.124999999999996 23.6875 23.7125 27.474999999999998 56-57 25.35 23.95 22.975 27.725 58-59 25.9625 22.825 24.7 26.5125 60-61 25.674999999999997 24.325 21.975 28.025 62-63 25.7875 22.9625 23.3625 27.8875 64-65 25.525 23.849999999999998 23.8375 26.787499999999998 66-67 26.224999999999998 23.0625 23.65 27.0625 68-69 25.687500000000004 23.0 23.3875 27.925 70-71 26.2875 23.325000000000003 23.65 26.737499999999997 72-73 26.187500000000004 23.225 24.2375 26.35 74-75 25.6125 24.05 23.4625 26.875 76-77 26.3125 22.8 23.5875 27.3 78-79 25.4625 24.0 22.5625 27.975 80-81 26.8625 22.162499999999998 23.325000000000003 27.650000000000002 82-83 26.8 23.175 22.7125 27.3125 84-85 26.85 23.3375 22.8125 27.0 86-87 27.075 22.7625 23.1125 27.05 88-89 26.0 24.0125 23.3875 26.6 90-91 26.5375 23.3375 22.5 27.625 92-93 26.724999999999998 23.375 22.625 27.275 94-95 27.224999999999998 24.025 22.425 26.325 96-97 26.25 23.8375 22.725 27.187499999999996 98-99 26.737499999999997 23.925 22.775000000000002 26.5625 100-101 27.275 24.2 22.662499999999998 25.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 1.0 25 0.0 26 1.5 27 2.0 28 1.5 29 3.5 30 5.0 31 9.0 32 13.0 33 15.5 34 21.0 35 24.0 36 30.5 37 49.0 38 66.0 39 72.0 40 90.5 41 106.0 42 120.5 43 144.0 44 152.0 45 154.0 46 152.0 47 145.5 48 158.5 49 165.5 50 145.5 51 126.5 52 118.0 53 115.0 54 108.5 55 93.0 56 79.5 57 85.5 58 98.0 59 97.0 60 82.0 61 76.0 62 77.5 63 73.0 64 79.0 65 78.0 66 75.5 67 82.0 68 78.5 69 71.0 70 64.0 71 63.5 72 56.0 73 47.5 74 45.5 75 45.5 76 37.0 77 24.5 78 19.0 79 15.0 80 12.0 81 7.5 82 6.5 83 4.5 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.6 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 94.18326693227091 88.64999999999999 2 5.391766268260293 10.15 3 0.4249667994687915 1.2 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.3375 0.0 0.0 0.0 0.0 72-73 0.4125 0.0 0.0 0.0 0.0 74-75 0.4375 0.0 0.0 0.0 0.0 76-77 0.45 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.7 0.0 0.0 0.0 0.0 82-83 0.8125 0.0 0.0 0.0 0.0 84-85 0.875 0.0 0.0 0.0 0.0 86-87 1.125 0.0 0.0 0.0 0.0 88-89 1.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11668420 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668420_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9265 37.0 37.0 37.0 37.0 37.0 2 35.7675 37.0 37.0 37.0 37.0 37.0 3 35.947 37.0 37.0 37.0 37.0 37.0 4 36.0955 37.0 37.0 37.0 37.0 37.0 5 35.9985 37.0 37.0 37.0 37.0 37.0 6 35.868 37.0 37.0 37.0 37.0 37.0 7 36.023 37.0 37.0 37.0 37.0 37.0 8 36.043 37.0 37.0 37.0 37.0 37.0 9 36.0575 37.0 37.0 37.0 37.0 37.0 10-11 36.072500000000005 37.0 37.0 37.0 37.0 37.0 12-13 36.064 37.0 37.0 37.0 37.0 37.0 14-15 36.097 37.0 37.0 37.0 37.0 37.0 16-17 36.0535 37.0 37.0 37.0 37.0 37.0 18-19 36.06425 37.0 37.0 37.0 37.0 37.0 20-21 35.9855 37.0 37.0 37.0 37.0 37.0 22-23 35.835125000000005 37.0 37.0 37.0 37.0 37.0 24-25 35.997625 37.0 37.0 37.0 37.0 37.0 26-27 35.973 37.0 37.0 37.0 37.0 37.0 28-29 36.028999999999996 37.0 37.0 37.0 37.0 37.0 30-31 35.877250000000004 37.0 37.0 37.0 37.0 37.0 32-33 35.949875 37.0 37.0 37.0 37.0 37.0 34-35 35.88525 37.0 37.0 37.0 37.0 37.0 36-37 35.871125 37.0 37.0 37.0 37.0 37.0 38-39 35.944874999999996 37.0 37.0 37.0 37.0 37.0 40-41 35.90575 37.0 37.0 37.0 37.0 37.0 42-43 35.846125 37.0 37.0 37.0 37.0 37.0 44-45 35.805 37.0 37.0 37.0 37.0 37.0 46-47 35.78425 37.0 37.0 37.0 37.0 37.0 48-49 35.80575 37.0 37.0 37.0 37.0 37.0 50-51 35.89375 37.0 37.0 37.0 37.0 37.0 52-53 35.7505 37.0 37.0 37.0 37.0 37.0 54-55 35.7875 37.0 37.0 37.0 37.0 37.0 56-57 35.871 37.0 37.0 37.0 37.0 37.0 58-59 35.787125 37.0 37.0 37.0 37.0 37.0 60-61 35.885625000000005 37.0 37.0 37.0 37.0 37.0 62-63 35.809625 37.0 37.0 37.0 37.0 37.0 64-65 35.689875 37.0 37.0 37.0 37.0 37.0 66-67 35.732375000000005 37.0 37.0 37.0 37.0 37.0 68-69 35.757625 37.0 37.0 37.0 37.0 37.0 70-71 35.696375 37.0 37.0 37.0 37.0 37.0 72-73 35.691 37.0 37.0 37.0 37.0 37.0 74-75 35.70925 37.0 37.0 37.0 37.0 37.0 76-77 35.843 37.0 37.0 37.0 37.0 37.0 78-79 35.74575 37.0 37.0 37.0 37.0 37.0 80-81 35.695499999999996 37.0 37.0 37.0 37.0 37.0 82-83 35.69125 37.0 37.0 37.0 37.0 37.0 84-85 35.61 37.0 37.0 37.0 37.0 37.0 86-87 35.6445 37.0 37.0 37.0 37.0 37.0 88-89 35.666250000000005 37.0 37.0 37.0 37.0 37.0 90-91 35.64675 37.0 37.0 37.0 37.0 37.0 92-93 35.585750000000004 37.0 37.0 37.0 37.0 37.0 94-95 35.596000000000004 37.0 37.0 37.0 37.0 37.0 96-97 35.645250000000004 37.0 37.0 37.0 37.0 37.0 98-99 35.59675 37.0 37.0 37.0 37.0 37.0 100-101 35.4475 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 2.0 16 3.0 17 2.0 18 1.0 19 1.0 20 3.0 21 3.0 22 4.0 23 8.0 24 7.0 25 12.0 26 10.0 27 14.0 28 19.0 29 27.0 30 39.0 31 57.0 32 55.0 33 113.0 34 181.0 35 531.0 36 2358.0 37 548.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.4 15.950000000000001 11.825 39.825 2 31.324999999999996 23.125 24.65 20.9 3 26.55 27.250000000000004 21.725 24.474999999999998 4 29.349999999999998 30.3 16.125 24.224999999999998 5 30.575000000000003 31.674999999999997 16.950000000000003 20.8 6 23.9 34.449999999999996 18.325 23.325000000000003 7 22.875 17.150000000000002 33.324999999999996 26.650000000000002 8 25.25 20.775 23.849999999999998 30.125 9 26.450000000000003 20.424999999999997 23.775 29.349999999999998 10-11 27.5125 27.187499999999996 19.575 25.724999999999998 12-13 28.050000000000004 20.5125 22.9875 28.449999999999996 14-15 26.137500000000003 22.7 23.5875 27.575 16-17 27.875 23.5 21.1375 27.487499999999997 18-19 27.787499999999998 23.7875 21.837500000000002 26.5875 20-21 27.712500000000002 22.95 22.525000000000002 26.8125 22-23 27.753469183647955 22.852856607075882 22.602825353169145 26.790848856107015 24-25 26.815851981497683 23.44043005375672 22.565320665083135 27.17839729966246 26-27 26.6625 23.825 22.2625 27.250000000000004 28-29 27.537499999999998 22.7125 22.225 27.525 30-31 26.424999999999997 23.7875 22.05 27.737499999999997 32-33 27.903487935992 23.80297537192149 21.77772221527691 26.515814476809602 34-35 27.950000000000003 23.2625 22.4625 26.325 36-37 26.653331666458307 23.015376922115262 22.802850356294538 27.528441055131893 38-39 28.173064899337252 23.258722020757787 21.93322495935976 26.634988120545206 40-41 27.650000000000002 23.5375 22.225 26.5875 42-43 27.51593949243655 22.86535816977122 22.477809726215778 27.140892611576444 44-45 26.506626656664167 24.343585896474117 22.343085771442862 26.806701675418854 46-47 27.94448612153038 22.95573893473368 22.255563890972745 26.84421105276319 48-49 26.731682920730183 23.218304576144035 22.893223305826456 27.156789197299325 50-51 26.775887943971988 23.861930965482742 21.87343671835918 27.48874437218609 52-53 27.56378189094547 23.024012006003 22.28614307153577 27.126063031515756 54-55 27.656914228557138 23.080770192548137 21.767941985496375 27.494373593398347 56-57 26.9567391847962 23.1807951987997 22.73068267066767 27.131782945736433 58-59 28.091011376422053 22.82785348168521 22.190273784223027 26.89086135766971 60-61 26.978372296537067 23.577947243405426 21.29016127015877 28.153519189898734 62-63 27.953494186773348 22.90286285785723 22.365295661957745 26.778347293411674 64-65 28.041005125640705 23.827978497312163 21.77772221527691 26.35329416177022 66-67 27.3284160520065 22.877859732466558 23.002875359419928 26.790848856107015 68-69 27.86598324790599 23.07788473559195 23.202900362545318 25.853231653956744 70-71 27.29091136392049 22.86535816977122 22.96537067133392 26.878359794974372 72-73 26.9125 22.55 22.8625 27.675 74-75 27.737499999999997 23.0 22.725 26.5375 76-77 27.4125 22.537499999999998 23.4375 26.6125 78-79 28.037499999999998 23.4125 22.75 25.8 80-81 27.474999999999998 23.674999999999997 21.875 26.974999999999998 82-83 28.299999999999997 22.9375 22.2125 26.55 84-85 27.125 23.0125 21.987499999999997 27.875 86-87 28.275 22.675 22.8625 26.187500000000004 88-89 27.6375 22.625 23.1125 26.625 90-91 27.6375 23.200000000000003 22.3375 26.825 92-93 28.1 22.8375 22.2625 26.8 94-95 27.575 23.4625 21.9625 27.0 96-97 28.375 22.9625 21.4875 27.175 98-99 28.249999999999996 23.25 22.5125 25.9875 100-101 28.95 22.175 22.55 26.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 1.0 27 3.0 28 5.5 29 4.5 30 8.0 31 9.5 32 9.5 33 13.5 34 18.0 35 25.0 36 31.5 37 44.0 38 64.5 39 69.5 40 81.5 41 106.0 42 109.5 43 121.0 44 140.5 45 141.5 46 148.0 47 144.5 48 133.0 49 125.5 50 123.0 51 116.5 52 98.5 53 98.5 54 97.0 55 98.0 56 96.5 57 93.0 58 80.5 59 73.0 60 86.0 61 89.0 62 93.0 63 94.0 64 93.5 65 97.0 66 97.0 67 94.5 68 97.5 69 94.5 70 79.5 71 66.5 72 62.0 73 62.5 74 57.0 75 47.0 76 33.0 77 28.0 78 26.5 79 18.0 80 12.0 81 9.0 82 8.5 83 5.0 84 1.5 85 0.5 86 0.5 87 0.5 88 0.5 89 0.5 90 0.5 91 1.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.5 97 1.5 98 2.0 99 1.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0125 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0125 34-35 0.0 36-37 0.0125 38-39 0.0375 40-41 0.0 42-43 0.0125 44-45 0.025 46-47 0.025 48-49 0.025 50-51 0.05 52-53 0.05 54-55 0.025 56-57 0.025 58-59 0.0125 60-61 0.0125 62-63 0.0125 64-65 0.0125 66-67 0.0125 68-69 0.0125 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.075 #Duplication Level Percentage of deduplicated Percentage of total 1 94.12702630879618 88.55 2 5.447781025777306 10.25 3 0.42519266542652134 1.2 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.3375 0.0 0.0 0.0 0.0 72-73 0.4125 0.0 0.0 0.0 0.0 74-75 0.4375 0.0 0.0 0.0 0.0 76-77 0.45 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.7 0.0 0.0 0.0 0.0 82-83 0.8125 0.0 0.0 0.0 0.0 84-85 0.875 0.0 0.0 0.0 0.0 86-87 1.1125 0.0 0.0 0.0 0.0 88-89 1.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451453 spots for SRR11668420.sra Written 2451453 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra Read 2451436 spots for SRR11668420.sra Written 2451436 spots for SRR11668420.sra SRR ids: ['SRR11668420.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dfhpi962 SRR11668420.sra spots: 49028737 blocks: [[1, 2451436], [2451437, 4902872], [4902873, 7354308], [7354309, 9805744], [9805745, 12257180], [12257181, 14708616], [14708617, 17160052], [17160053, 19611488], [19611489, 22062924], [22062925, 24514360], [24514361, 26965796], [26965797, 29417232], [29417233, 31868668], [31868669, 34320104], [34320105, 36771540], [36771541, 39222976], [39222977, 41674412], [41674413, 44125848], [44125849, 46577284], [46577285, 49028737]] SRR11668420 file size 11852446 SRR11668420 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11668420 SRR11668420_1.fastq SRR11668420_2.fastq Input file: SRR11668420_1.fastq Paired file: SRR11668420_2.fastq trimmed: SRR11668420-trimmed-pair1.fastq, SRR11668420-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:22:24 2024 >> started Fri Dec 6 10:23:12 2024 >> done (47.655s) 49028737 read pairs processed; of these: 7129 ( 0.01%) short read pairs filtered out after trimming by size control 176652 ( 0.36%) empty read pairs filtered out after trimming by size control 48844956 (99.63%) read pairs available; of these: 1935380 ( 3.96%) trimmed read pairs available after processing 46909576 (96.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 221 0.00% 19 191 0.00% 20 147 0.00% 21 149 0.00% 22 164 0.00% 23 129 0.00% 24 123 0.00% 25 141 0.00% 26 165 0.00% 27 183 0.00% 28 214 0.00% 29 307 0.00% 30 248 0.00% 31 289 0.00% 32 382 0.00% 33 334 0.00% 34 339 0.00% 35 331 0.00% 36 536 0.00% 37 444 0.00% 38 460 0.00% 39 555 0.00% 40 638 0.00% 41 650 0.00% 42 685 0.00% 43 806 0.00% 44 785 0.00% 45 839 0.00% 46 955 0.00% 47 1077 0.00% 48 1258 0.00% 49 1374 0.00% 50 1607 0.00% 51 1743 0.00% 52 1968 0.00% 53 2112 0.00% 54 2182 0.00% 55 2335 0.00% 56 2662 0.01% 57 2924 0.01% 58 3448 0.01% 59 3809 0.01% 60 4258 0.01% 61 4741 0.01% 62 5419 0.01% 63 5808 0.01% 64 6505 0.01% 65 6920 0.01% 66 7576 0.02% 67 8686 0.02% 68 9302 0.02% 69 10461 0.02% 70 11465 0.02% 71 12769 0.03% 72 14487 0.03% 73 16057 0.03% 74 17946 0.04% 75 19572 0.04% 76 21531 0.04% 77 23016 0.05% 78 25147 0.05% 79 27895 0.06% 80 30643 0.06% 81 33600 0.07% 82 37278 0.08% 83 41537 0.09% 84 45060 0.09% 85 49928 0.10% 86 54001 0.11% 87 57514 0.12% 88 62383 0.13% 89 66852 0.14% 90 71075 0.15% 91 77225 0.16% 92 83948 0.17% 93 90395 0.19% 94 98732 0.20% 95 105320 0.22% 96 112360 0.23% 97 120227 0.25% 98 125255 0.26% 99 131395 0.27% 100 141182 0.29% 101 46909576 96.04% 48844956 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=24 prefix-density=0.25 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=29 fanout-score=256.52 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=27.4 sequence=CGGCGGCGGCGA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=7.11 fanout-score-rank=18 prefix-density=0.35 prefix-fanout=5.0 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.12 sequence-density-rank=25 fanout-score=328.43 fanout-score-rank=1 prefix-density=1.69 prefix-fanout=22.6 sequence=CGCCGCCGCCGTC SRR11668420 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:24:03 Started mapping on | Dec 06 10:24:03 Finished on | Dec 06 10:26:33 Mapping speed, Million of reads per hour | 1172.28 Number of input reads | 48844956 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 46514227 Uniquely mapped reads % | 95.23% Average mapped length | 200.40 Number of splices: Total | 26983323 Number of splices: Annotated (sjdb) | 25527909 Number of splices: GT/AG | 26623836 Number of splices: GC/AG | 298708 Number of splices: AT/AC | 15899 Number of splices: Non-canonical | 44880 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.11 Insertion rate per base | 0.01% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1305677 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 76969 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.17% % of reads unmapped: other | 0.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1025052 1025052 1025052 N_multimapping 1305677 1305677 1305677 N_noFeature 1277389 45339609 1762816 N_ambiguous 865196 6478 187609 UnstrandedReadsAssigned:44371642 PositiveStrandReadsAssigned:1168140 NegativeStrandReadsAssigned:44563802 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11668420 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11668420-trimmed-pair1.fastq SRR11668420-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 48,844,956 reads, 45,561,072 reads pseudoaligned [quant] estimated average fragment length: 209.929 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52973 SRR11668420.ke.tsv 35125 SRR11668420.se.tsv 88098 total ==> SRR11668420.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 727.287 0 0 PNS24247 1044 835.071 66.6469 2.48573 PNS24249 1928 1719.07 498.91 9.0391 PNS24246 1044 835.071 66.6469 2.48573 PNS24248 1044 835.071 66.6469 2.48573 PNS24244 1471 1262.07 91.1492 2.2494 PNS24243 293 120.036 0 0 KQK14069 1603 1394.07 2897.75 64.7401 KQK14071 474 273.798 237.043 26.9646 ==> SRR11668420.se.tsv <== BRADI_1g14170v3 3552 BRADI_1g53295v3 17 BRADI_1g59795v3 410 BRADI_1g07683v3 0 BRADI_1g00485v3 92 BRADI_1g20270v3 6908 BRADI_1g74790v3 248 BRADI_1g09890v3 35 BRADI_1g77505v3 675 BRADI_1g48960v3 0 SRR11668420 completed mapping pipeline successfully