Starting /dee2/code/volunteer_pipeline.sh SRR11668421 current disk space = 1551827365888 free memory = 1602183272 SRR11668421 SRAfilesize ba1680828ed3606c70bbce01cb7fead6 SRR11668421.sra SRR11668421.sra file validated SRR11668421 is paired end SRR11668421 is conventional basespace SRR11668421 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668421_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1995 37.0 37.0 37.0 37.0 37.0 2 35.75325 37.0 37.0 37.0 37.0 37.0 3 36.2395 37.0 37.0 37.0 37.0 37.0 4 36.3245 37.0 37.0 37.0 37.0 37.0 5 36.2475 37.0 37.0 37.0 37.0 37.0 6 36.3365 37.0 37.0 37.0 37.0 37.0 7 36.2715 37.0 37.0 37.0 37.0 37.0 8 36.306 37.0 37.0 37.0 37.0 37.0 9 36.3565 37.0 37.0 37.0 37.0 37.0 10-11 36.31925 37.0 37.0 37.0 37.0 37.0 12-13 36.2395 37.0 37.0 37.0 37.0 37.0 14-15 36.30575 37.0 37.0 37.0 37.0 37.0 16-17 36.19525 37.0 37.0 37.0 37.0 37.0 18-19 36.251000000000005 37.0 37.0 37.0 37.0 37.0 20-21 36.25175 37.0 37.0 37.0 37.0 37.0 22-23 36.23825 37.0 37.0 37.0 37.0 37.0 24-25 36.175 37.0 37.0 37.0 37.0 37.0 26-27 36.18375 37.0 37.0 37.0 37.0 37.0 28-29 36.10724999999999 37.0 37.0 37.0 37.0 37.0 30-31 36.21325 37.0 37.0 37.0 37.0 37.0 32-33 36.1135 37.0 37.0 37.0 37.0 37.0 34-35 36.045 37.0 37.0 37.0 37.0 37.0 36-37 36.16875 37.0 37.0 37.0 37.0 37.0 38-39 36.12025 37.0 37.0 37.0 37.0 37.0 40-41 36.09325 37.0 37.0 37.0 37.0 37.0 42-43 36.035250000000005 37.0 37.0 37.0 37.0 37.0 44-45 35.98725 37.0 37.0 37.0 37.0 37.0 46-47 36.065749999999994 37.0 37.0 37.0 37.0 37.0 48-49 36.0185 37.0 37.0 37.0 37.0 37.0 50-51 36.022 37.0 37.0 37.0 37.0 37.0 52-53 36.05200000000001 37.0 37.0 37.0 37.0 37.0 54-55 35.9825 37.0 37.0 37.0 37.0 37.0 56-57 36.07625 37.0 37.0 37.0 37.0 37.0 58-59 35.994 37.0 37.0 37.0 37.0 37.0 60-61 36.007000000000005 37.0 37.0 37.0 37.0 37.0 62-63 36.04275 37.0 37.0 37.0 37.0 37.0 64-65 35.92725 37.0 37.0 37.0 37.0 37.0 66-67 35.98575 37.0 37.0 37.0 37.0 37.0 68-69 35.94925 37.0 37.0 37.0 37.0 37.0 70-71 35.9625 37.0 37.0 37.0 37.0 37.0 72-73 35.99525 37.0 37.0 37.0 37.0 37.0 74-75 35.8375 37.0 37.0 37.0 37.0 37.0 76-77 35.896 37.0 37.0 37.0 37.0 37.0 78-79 35.824749999999995 37.0 37.0 37.0 37.0 37.0 80-81 35.86625 37.0 37.0 37.0 37.0 37.0 82-83 35.82475 37.0 37.0 37.0 37.0 37.0 84-85 35.866 37.0 37.0 37.0 37.0 37.0 86-87 35.95125 37.0 37.0 37.0 37.0 37.0 88-89 35.78575 37.0 37.0 37.0 37.0 37.0 90-91 35.8555 37.0 37.0 37.0 37.0 37.0 92-93 35.869 37.0 37.0 37.0 37.0 37.0 94-95 35.832 37.0 37.0 37.0 37.0 37.0 96-97 35.82925 37.0 37.0 37.0 37.0 37.0 98-99 35.76925 37.0 37.0 37.0 37.0 37.0 100-101 35.692499999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 0.0 22 1.0 23 0.0 24 1.0 25 1.0 26 6.0 27 13.0 28 19.0 29 36.0 30 50.0 31 58.0 32 74.0 33 111.0 34 158.0 35 343.0 36 2440.0 37 686.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.800000000000004 9.875 11.95 45.375 2 30.254857431238964 11.05223315669947 30.582891748675245 28.110017663386323 3 27.650000000000002 17.775 19.85 34.725 4 30.825000000000003 20.0 17.325 31.85 5 31.2 24.55 20.75 23.5 6 25.35 28.075 22.6 23.974999999999998 7 19.6 23.75 34.975 21.675 8 21.875 20.4 29.075 28.65 9 22.925 19.325 32.25 25.5 10-11 24.6625 26.8 23.35 25.1875 12-13 25.525 21.725 24.349999999999998 28.4 14-15 25.8 23.275000000000002 24.8125 26.1125 16-17 25.15 23.95 24.025 26.875 18-19 24.3625 23.849999999999998 24.2625 27.525 20-21 24.75 23.3375 23.875 28.037499999999998 22-23 24.6 24.4125 23.925 27.0625 24-25 25.25 24.099999999999998 23.0875 27.5625 26-27 24.6625 23.5625 24.15 27.625 28-29 25.4875 23.0375 24.2 27.275 30-31 24.625 23.7375 23.7875 27.85 32-33 25.112499999999997 22.8125 24.675 27.400000000000002 34-35 26.0375 23.925 23.325000000000003 26.7125 36-37 25.45 23.2125 23.35 27.987499999999997 38-39 25.387500000000003 23.925 24.55 26.137500000000003 40-41 25.974999999999998 22.675 23.1875 28.1625 42-43 24.6 25.025 22.6375 27.737499999999997 44-45 26.3125 23.4875 23.7625 26.437500000000004 46-47 25.6 23.625 23.9375 26.8375 48-49 25.3 23.3625 24.05 27.287499999999998 50-51 25.9875 23.2125 24.587500000000002 26.2125 52-53 25.937500000000004 23.1625 23.3875 27.5125 54-55 25.35 23.825 23.4875 27.3375 56-57 26.1 23.4375 23.95 26.5125 58-59 25.7875 24.175 23.5875 26.450000000000003 60-61 25.3 23.625 23.175 27.900000000000002 62-63 25.2625 23.150000000000002 24.1625 27.425 64-65 25.25 23.3375 23.599999999999998 27.8125 66-67 26.337500000000002 23.2375 23.724999999999998 26.700000000000003 68-69 25.2875 24.175 22.825 27.712500000000002 70-71 26.05 23.7875 23.925 26.237500000000004 72-73 25.7625 23.925 22.6875 27.625 74-75 26.174999999999997 22.9625 23.3875 27.474999999999998 76-77 26.424999999999997 23.150000000000002 23.2125 27.212500000000002 78-79 25.3125 23.200000000000003 23.0625 28.425 80-81 26.787499999999998 23.4625 22.787499999999998 26.9625 82-83 26.6 23.3 23.925 26.174999999999997 84-85 26.224999999999998 22.912499999999998 22.95 27.9125 86-87 26.724999999999998 22.8375 23.6625 26.775 88-89 27.275 22.225 23.1 27.400000000000002 90-91 26.375 23.2375 22.6125 27.775 92-93 27.425 22.8125 23.5875 26.174999999999997 94-95 27.2625 22.575 23.7 26.4625 96-97 27.0 23.075000000000003 22.925 27.0 98-99 26.7125 23.1875 23.575 26.525 100-101 26.75 23.825 23.1625 26.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.5 23 1.5 24 0.0 25 0.0 26 1.0 27 1.5 28 2.0 29 2.5 30 4.0 31 8.0 32 9.0 33 14.0 34 22.0 35 31.0 36 41.5 37 47.0 38 57.0 39 74.0 40 88.5 41 103.0 42 130.0 43 149.0 44 158.5 45 162.5 46 158.0 47 152.0 48 152.5 49 145.0 50 132.0 51 125.5 52 119.5 53 117.5 54 102.0 55 88.0 56 84.5 57 85.5 58 88.5 59 89.5 60 85.5 61 79.5 62 79.0 63 79.5 64 76.5 65 83.0 66 88.0 67 75.5 68 69.5 69 70.5 70 64.0 71 55.5 72 47.5 73 45.5 74 49.5 75 45.5 76 33.0 77 27.0 78 24.0 79 17.5 80 14.5 81 14.0 82 8.5 83 2.5 84 2.0 85 3.0 86 2.0 87 0.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.9249999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.7 #Duplication Level Percentage of deduplicated Percentage of total 1 93.75667022411953 87.85 2 5.76307363927428 10.8 3 0.48025613660619 1.35 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.0625 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.0875 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.1375 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.1875 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.2375 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.2875 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.5125 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.875 0.0 0.0 0.0 0.0 86-87 1.1375000000000002 0.0 0.0 0.0 0.0 88-89 1.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11668421 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668421_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.738 37.0 37.0 37.0 37.0 37.0 2 35.522 37.0 37.0 37.0 37.0 37.0 3 35.691 37.0 37.0 37.0 37.0 37.0 4 35.8005 37.0 37.0 37.0 37.0 37.0 5 35.932 37.0 37.0 37.0 37.0 37.0 6 35.7065 37.0 37.0 37.0 37.0 37.0 7 35.8875 37.0 37.0 37.0 37.0 37.0 8 36.028 37.0 37.0 37.0 37.0 37.0 9 35.9585 37.0 37.0 37.0 37.0 37.0 10-11 35.971000000000004 37.0 37.0 37.0 37.0 37.0 12-13 35.9945 37.0 37.0 37.0 37.0 37.0 14-15 35.969 37.0 37.0 37.0 37.0 37.0 16-17 35.96125 37.0 37.0 37.0 37.0 37.0 18-19 35.91275 37.0 37.0 37.0 37.0 37.0 20-21 35.90025 37.0 37.0 37.0 37.0 37.0 22-23 35.712374999999994 37.0 37.0 37.0 37.0 37.0 24-25 35.93675 37.0 37.0 37.0 37.0 37.0 26-27 35.89075 37.0 37.0 37.0 37.0 37.0 28-29 35.8975 37.0 37.0 37.0 37.0 37.0 30-31 35.795249999999996 37.0 37.0 37.0 37.0 37.0 32-33 35.79025 37.0 37.0 37.0 37.0 37.0 34-35 35.760999999999996 37.0 37.0 37.0 37.0 37.0 36-37 35.80575 37.0 37.0 37.0 37.0 37.0 38-39 35.833375000000004 37.0 37.0 37.0 37.0 37.0 40-41 35.754999999999995 37.0 37.0 37.0 37.0 37.0 42-43 35.69425 37.0 37.0 37.0 37.0 37.0 44-45 35.596000000000004 37.0 37.0 37.0 37.0 37.0 46-47 35.718999999999994 37.0 37.0 37.0 37.0 37.0 48-49 35.65025 37.0 37.0 37.0 37.0 37.0 50-51 35.699 37.0 37.0 37.0 37.0 37.0 52-53 35.687250000000006 37.0 37.0 37.0 37.0 37.0 54-55 35.60525 37.0 37.0 37.0 37.0 37.0 56-57 35.714875000000006 37.0 37.0 37.0 37.0 37.0 58-59 35.667 37.0 37.0 37.0 37.0 37.0 60-61 35.7065 37.0 37.0 37.0 37.0 37.0 62-63 35.565 37.0 37.0 37.0 37.0 37.0 64-65 35.48025 37.0 37.0 37.0 37.0 37.0 66-67 35.715375 37.0 37.0 37.0 37.0 37.0 68-69 35.763374999999996 37.0 37.0 37.0 37.0 37.0 70-71 35.659 37.0 37.0 37.0 37.0 37.0 72-73 35.6355 37.0 37.0 37.0 37.0 37.0 74-75 35.69125 37.0 37.0 37.0 37.0 37.0 76-77 35.70275 37.0 37.0 37.0 37.0 37.0 78-79 35.5575 37.0 37.0 37.0 37.0 37.0 80-81 35.527 37.0 37.0 37.0 37.0 37.0 82-83 35.5625 37.0 37.0 37.0 37.0 37.0 84-85 35.511250000000004 37.0 37.0 37.0 37.0 37.0 86-87 35.60025 37.0 37.0 37.0 37.0 37.0 88-89 35.55875 37.0 37.0 37.0 37.0 37.0 90-91 35.5095 37.0 37.0 37.0 37.0 37.0 92-93 35.48675 37.0 37.0 37.0 37.0 37.0 94-95 35.483999999999995 37.0 37.0 37.0 37.0 37.0 96-97 35.5115 37.0 37.0 37.0 37.0 37.0 98-99 35.3585 37.0 37.0 37.0 37.0 37.0 100-101 35.157250000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 1.0 18 1.0 19 3.0 20 1.0 21 3.0 22 4.0 23 9.0 24 6.0 25 10.0 26 15.0 27 21.0 28 27.0 29 32.0 30 45.0 31 64.0 32 82.0 33 123.0 34 215.0 35 568.0 36 2340.0 37 428.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.25 15.7 12.825000000000001 39.225 2 30.599999999999998 24.525 24.625 20.25 3 25.2 26.650000000000002 22.0 26.150000000000002 4 27.825 29.799999999999997 17.25 25.124999999999996 5 29.75 31.724999999999998 17.599999999999998 20.925 6 23.674999999999997 35.025 17.875 23.425 7 22.275 17.875 33.324999999999996 26.525 8 25.324999999999996 20.474999999999998 23.45 30.75 9 25.074999999999996 21.375 24.825 28.725 10-11 27.3125 26.7125 18.7375 27.237499999999997 12-13 26.937499999999996 21.837500000000002 22.35 28.875 14-15 26.8125 24.587500000000002 22.8625 25.7375 16-17 27.9125 22.7125 22.2625 27.1125 18-19 27.462500000000002 23.549999999999997 21.462500000000002 27.525 20-21 26.525 24.7375 21.375 27.3625 22-23 27.065883235404424 22.802850356294538 22.602825353169145 27.528441055131893 24-25 27.806951737934483 23.843460865216304 21.605401350337583 26.744186046511626 26-27 27.05 23.75 21.7 27.500000000000004 28-29 27.224999999999998 23.375 22.3125 27.0875 30-31 26.85 23.6625 23.6875 25.8 32-33 27.294323580895224 23.74343585896474 21.567891972993248 27.394348587146787 34-35 27.575 22.412499999999998 22.6375 27.375 36-37 27.019254813703427 23.168292073018254 22.518129532383096 27.294323580895224 38-39 26.972614730523947 24.08403151181693 22.04576716268601 26.897586594973117 40-41 27.487499999999997 23.4625 22.3375 26.7125 42-43 27.981995498874717 23.58089522380595 21.955488872218055 26.481620405101275 44-45 27.188594297148573 24.349674837418707 21.735867933966986 26.725862931465734 46-47 28.064032016008007 22.848924462231114 21.87343671835918 27.213606803401703 48-49 28.05152576288144 23.074037018509255 22.26113056528264 26.613306653326664 50-51 26.650825412706354 23.911955977988995 22.36118059029515 27.07603801900951 52-53 27.87090317738304 22.929697272954716 21.74130597948461 27.45809357017763 54-55 27.01350675337669 23.54927463731866 22.07353676838419 27.363681840920464 56-57 25.659622358384393 23.94647992997374 23.49631111666875 26.897586594973117 58-59 26.981745436359088 23.74343585896474 22.05551387846962 27.219304826206553 60-61 27.719429857464366 22.680670167541887 22.718179544886222 26.881720430107524 62-63 29.16979244811203 23.85596399099775 21.50537634408602 25.468867216804203 64-65 27.019254813703427 22.83070767691923 22.58064516129032 27.569392348087025 66-67 27.565945743217902 23.72796599574947 22.477809726215778 26.22827853481685 68-69 27.590948868608578 23.0278784848106 22.42780347543443 26.95336917114639 70-71 26.994248562140534 22.73068267066767 21.85546386596649 28.419604901225306 72-73 28.212500000000002 23.025000000000002 21.6125 27.150000000000002 74-75 26.8375 24.0625 22.15 26.950000000000003 76-77 27.625 22.3 22.3875 27.6875 78-79 27.1 22.775000000000002 22.912499999999998 27.212500000000002 80-81 28.025 23.0625 22.5125 26.400000000000002 82-83 28.799999999999997 22.900000000000002 22.3 26.0 84-85 27.9125 23.3875 22.3875 26.3125 86-87 27.762500000000003 23.2375 22.2625 26.737499999999997 88-89 28.5875 22.475 22.4625 26.474999999999998 90-91 27.462500000000002 23.625 22.037499999999998 26.875 92-93 28.237499999999997 24.275 21.45 26.0375 94-95 28.199999999999996 23.175 21.9 26.724999999999998 96-97 28.299999999999997 23.95 21.45 26.3 98-99 28.1375 24.4125 20.7625 26.687499999999996 100-101 29.549999999999997 22.675 22.4625 25.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 1.0 24 0.0 25 0.5 26 1.0 27 0.5 28 1.0 29 4.0 30 5.5 31 8.5 32 10.5 33 9.5 34 16.0 35 26.5 36 36.5 37 46.5 38 49.0 39 54.5 40 79.0 41 106.0 42 123.0 43 133.0 44 134.0 45 148.5 46 147.0 47 139.5 48 145.5 49 139.0 50 126.0 51 112.5 52 109.5 53 100.5 54 99.0 55 103.0 56 93.5 57 90.5 58 95.0 59 103.0 60 93.5 61 82.5 62 87.0 63 83.5 64 90.5 65 93.5 66 86.0 67 93.5 68 86.5 69 78.0 70 72.5 71 58.0 72 62.5 73 64.5 74 50.0 75 46.5 76 43.0 77 24.5 78 14.0 79 13.0 80 15.5 81 14.5 82 11.0 83 7.5 84 5.5 85 5.0 86 2.5 87 1.0 88 1.0 89 1.0 90 0.5 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 1.0 99 2.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0125 24-25 0.025 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.025 34-35 0.0 36-37 0.025 38-39 0.0375 40-41 0.0 42-43 0.025 44-45 0.05 46-47 0.05 48-49 0.05 50-51 0.05 52-53 0.075 54-55 0.05 56-57 0.0375 58-59 0.025 60-61 0.025 62-63 0.025 64-65 0.025 66-67 0.0125 68-69 0.0125 70-71 0.025 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.825 #Duplication Level Percentage of deduplicated Percentage of total 1 93.87156941113776 88.075 2 5.702104982680522 10.7 3 0.3996802557953637 1.125 4 0.02664535038635758 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.0625 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.0875 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.32499999999999996 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.4875 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.7125 0.0 0.0 0.0 0.0 84-85 0.8500000000000001 0.0 0.0 0.0 0.0 86-87 1.1124999999999998 0.0 0.0 0.0 0.0 88-89 1.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435584 spots for SRR11668421.sra Written 2435584 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra Read 2435580 spots for SRR11668421.sra Written 2435580 spots for SRR11668421.sra SRR ids: ['SRR11668421.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6ebw2ojl SRR11668421.sra spots: 48711604 blocks: [[1, 2435580], [2435581, 4871160], [4871161, 7306740], [7306741, 9742320], [9742321, 12177900], [12177901, 14613480], [14613481, 17049060], [17049061, 19484640], [19484641, 21920220], [21920221, 24355800], [24355801, 26791380], [26791381, 29226960], [29226961, 31662540], [31662541, 34098120], [34098121, 36533700], [36533701, 38969280], [38969281, 41404860], [41404861, 43840440], [43840441, 46276020], [46276021, 48711604]] SRR11668421 file size 11775641 SRR11668421 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11668421 SRR11668421_1.fastq SRR11668421_2.fastq Input file: SRR11668421_1.fastq Paired file: SRR11668421_2.fastq trimmed: SRR11668421-trimmed-pair1.fastq, SRR11668421-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:24:15 2024 >> started Fri Dec 6 10:25:19 2024 >> done (63.312s) 48711604 read pairs processed; of these: 9772 ( 0.02%) short read pairs filtered out after trimming by size control 88567 ( 0.18%) empty read pairs filtered out after trimming by size control 48613265 (99.80%) read pairs available; of these: 1953669 ( 4.02%) trimmed read pairs available after processing 46659596 (95.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 309 0.00% 19 242 0.00% 20 254 0.00% 21 244 0.00% 22 219 0.00% 23 210 0.00% 24 194 0.00% 25 166 0.00% 26 172 0.00% 27 204 0.00% 28 196 0.00% 29 279 0.00% 30 231 0.00% 31 346 0.00% 32 367 0.00% 33 295 0.00% 34 295 0.00% 35 336 0.00% 36 367 0.00% 37 367 0.00% 38 426 0.00% 39 461 0.00% 40 566 0.00% 41 551 0.00% 42 609 0.00% 43 620 0.00% 44 665 0.00% 45 725 0.00% 46 732 0.00% 47 936 0.00% 48 998 0.00% 49 1177 0.00% 50 1324 0.00% 51 1496 0.00% 52 1634 0.00% 53 1776 0.00% 54 1806 0.00% 55 2078 0.00% 56 2276 0.00% 57 2467 0.01% 58 2862 0.01% 59 3367 0.01% 60 3666 0.01% 61 4245 0.01% 62 4674 0.01% 63 5240 0.01% 64 5790 0.01% 65 6347 0.01% 66 6983 0.01% 67 8206 0.02% 68 8485 0.02% 69 9509 0.02% 70 10832 0.02% 71 12075 0.02% 72 13528 0.03% 73 15600 0.03% 74 17151 0.04% 75 18791 0.04% 76 20997 0.04% 77 23055 0.05% 78 25148 0.05% 79 27822 0.06% 80 30144 0.06% 81 33553 0.07% 82 37198 0.08% 83 41573 0.09% 84 45822 0.09% 85 50425 0.10% 86 54871 0.11% 87 59043 0.12% 88 63879 0.13% 89 68461 0.14% 90 73176 0.15% 91 79480 0.16% 92 85817 0.18% 93 92640 0.19% 94 101826 0.21% 95 108077 0.22% 96 114722 0.24% 97 123118 0.25% 98 129464 0.27% 99 133827 0.28% 100 143564 0.30% 101 46659596 95.98% 48613265 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=25 prefix-density=0.33 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=142.95 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=19.2 sequence=GGCGGCGGCGGCC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=5.79 fanout-score-rank=16 prefix-density=0.41 prefix-fanout=4.3 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.13 sequence-density-rank=25 fanout-score=256.27 fanout-score-rank=1 prefix-density=1.55 prefix-fanout=21.9 sequence=GCCGCCGCCGCG SRR11668421 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:25:55 Started mapping on | Dec 06 10:25:55 Finished on | Dec 06 10:28:18 Mapping speed, Million of reads per hour | 1223.83 Number of input reads | 48613265 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 46399103 Uniquely mapped reads % | 95.45% Average mapped length | 200.42 Number of splices: Total | 26518535 Number of splices: Annotated (sjdb) | 25092569 Number of splices: GT/AG | 26165820 Number of splices: GC/AG | 294515 Number of splices: AT/AC | 14236 Number of splices: Non-canonical | 43964 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1334365 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 52925 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.14% % of reads unmapped: other | 0.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 879797 879797 879797 N_multimapping 1334365 1334365 1334365 N_noFeature 1208414 45203931 1699207 N_ambiguous 888923 6368 195614 UnstrandedReadsAssigned:44301766 PositiveStrandReadsAssigned:1188804 NegativeStrandReadsAssigned:44504282 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11668421 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11668421-trimmed-pair1.fastq SRR11668421-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 48,613,265 reads, 45,612,213 reads pseudoaligned [quant] estimated average fragment length: 210.264 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52973 SRR11668421.ke.tsv 35125 SRR11668421.se.tsv 88098 total ==> SRR11668421.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 726.963 0 0 PNS24247 1044 834.736 64.6316 2.40445 PNS24249 1928 1718.74 462.056 8.34843 PNS24246 1044 834.736 64.6316 2.40445 PNS24248 1044 834.736 64.6316 2.40445 PNS24244 1471 1261.74 64.0493 1.5764 PNS24243 293 120.57 0 0 KQK14069 1603 1393.74 3413.04 76.0467 KQK14071 474 273.653 291.456 33.0744 ==> SRR11668421.se.tsv <== BRADI_1g14170v3 4352 BRADI_1g53295v3 30 BRADI_1g59795v3 405 BRADI_1g07683v3 0 BRADI_1g00485v3 95 BRADI_1g20270v3 5473 BRADI_1g74790v3 289 BRADI_1g09890v3 42 BRADI_1g77505v3 658 BRADI_1g48960v3 0 SRR11668421 completed mapping pipeline successfully