Starting /dee2/code/volunteer_pipeline.sh SRR11668422 current disk space = 1551827365888 free memory = 1602168232 SRR11668422 SRAfilesize 5308fb2cb6087e2fb068e9e820100f8d SRR11668422.sra SRR11668422.sra file validated SRR11668422 is paired end SRR11668422 is conventional basespace SRR11668422 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668422_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.174 37.0 37.0 37.0 37.0 37.0 2 35.993 37.0 37.0 37.0 37.0 37.0 3 36.303 37.0 37.0 37.0 37.0 37.0 4 36.20275 37.0 37.0 37.0 37.0 37.0 5 36.2995 37.0 37.0 37.0 37.0 37.0 6 36.203 37.0 37.0 37.0 37.0 37.0 7 36.107 37.0 37.0 37.0 37.0 37.0 8 36.2555 37.0 37.0 37.0 37.0 37.0 9 36.205 37.0 37.0 37.0 37.0 37.0 10-11 36.184250000000006 37.0 37.0 37.0 37.0 37.0 12-13 36.1955 37.0 37.0 37.0 37.0 37.0 14-15 36.23375 37.0 37.0 37.0 37.0 37.0 16-17 36.18 37.0 37.0 37.0 37.0 37.0 18-19 36.19725 37.0 37.0 37.0 37.0 37.0 20-21 36.20525 37.0 37.0 37.0 37.0 37.0 22-23 36.0975 37.0 37.0 37.0 37.0 37.0 24-25 36.11425 37.0 37.0 37.0 37.0 37.0 26-27 36.1375 37.0 37.0 37.0 37.0 37.0 28-29 36.0995 37.0 37.0 37.0 37.0 37.0 30-31 36.1325 37.0 37.0 37.0 37.0 37.0 32-33 36.0385 37.0 37.0 37.0 37.0 37.0 34-35 35.988749999999996 37.0 37.0 37.0 37.0 37.0 36-37 35.959 37.0 37.0 37.0 37.0 37.0 38-39 35.94125 37.0 37.0 37.0 37.0 37.0 40-41 36.050250000000005 37.0 37.0 37.0 37.0 37.0 42-43 36.0025 37.0 37.0 37.0 37.0 37.0 44-45 35.87075 37.0 37.0 37.0 37.0 37.0 46-47 35.9385 37.0 37.0 37.0 37.0 37.0 48-49 35.93925 37.0 37.0 37.0 37.0 37.0 50-51 35.92475 37.0 37.0 37.0 37.0 37.0 52-53 35.899 37.0 37.0 37.0 37.0 37.0 54-55 35.9585 37.0 37.0 37.0 37.0 37.0 56-57 35.914 37.0 37.0 37.0 37.0 37.0 58-59 35.83475 37.0 37.0 37.0 37.0 37.0 60-61 35.89875 37.0 37.0 37.0 37.0 37.0 62-63 35.92125 37.0 37.0 37.0 37.0 37.0 64-65 35.81375 37.0 37.0 37.0 37.0 37.0 66-67 35.852000000000004 37.0 37.0 37.0 37.0 37.0 68-69 35.73175 37.0 37.0 37.0 37.0 37.0 70-71 35.79275 37.0 37.0 37.0 37.0 37.0 72-73 35.883250000000004 37.0 37.0 37.0 37.0 37.0 74-75 36.0275 37.0 37.0 37.0 37.0 37.0 76-77 35.8485 37.0 37.0 37.0 37.0 37.0 78-79 35.88175 37.0 37.0 37.0 37.0 37.0 80-81 35.8185 37.0 37.0 37.0 37.0 37.0 82-83 35.806250000000006 37.0 37.0 37.0 37.0 37.0 84-85 35.827 37.0 37.0 37.0 37.0 37.0 86-87 35.823 37.0 37.0 37.0 37.0 37.0 88-89 35.911249999999995 37.0 37.0 37.0 37.0 37.0 90-91 35.76525 37.0 37.0 37.0 37.0 37.0 92-93 35.72825 37.0 37.0 37.0 37.0 37.0 94-95 35.83925 37.0 37.0 37.0 37.0 37.0 96-97 35.6255 37.0 37.0 37.0 37.0 37.0 98-99 35.71625 37.0 37.0 37.0 37.0 37.0 100-101 35.639250000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 3.0 25 5.0 26 6.0 27 17.0 28 22.0 29 40.0 30 44.0 31 84.0 32 84.0 33 112.0 34 167.0 35 332.0 36 2455.0 37 627.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.15 9.55 13.675 41.625 2 30.916414904330313 11.832829808660625 28.474320241691842 28.77643504531722 3 26.25 17.549999999999997 21.0 35.199999999999996 4 31.607901975493874 21.580395098774694 16.854213553388348 29.957489372343087 5 31.874999999999996 25.025 19.400000000000002 23.7 6 24.625 28.225 22.0 25.15 7 18.9 26.575 33.475 21.05 8 22.6 22.1 26.825 28.475 9 22.15 20.0 30.525000000000002 27.325 10-11 25.5375 27.987499999999997 22.45 24.025 12-13 25.674999999999997 22.5125 23.549999999999997 28.262500000000003 14-15 24.962500000000002 24.4125 24.1375 26.487500000000004 16-17 24.6625 23.775 24.962500000000002 26.6 18-19 24.775 24.675 24.075 26.474999999999998 20-21 26.737499999999997 22.8875 23.3125 27.0625 22-23 25.0625 24.45 22.925 27.5625 24-25 25.112499999999997 24.275 23.5 27.1125 26-27 25.85 23.6125 23.5125 27.025 28-29 24.762500000000003 25.5375 22.912499999999998 26.787499999999998 30-31 25.05 23.45 23.724999999999998 27.775 32-33 25.525 24.7875 23.3 26.387500000000003 34-35 26.150000000000002 23.0625 23.549999999999997 27.237499999999997 36-37 25.974999999999998 24.2875 23.45 26.2875 38-39 24.9875 24.1875 23.05 27.775 40-41 26.075 23.7875 22.7125 27.425 42-43 25.8 23.95 23.962500000000002 26.2875 44-45 26.137500000000003 23.4125 23.425 27.025 46-47 25.7875 23.4125 23.175 27.625 48-49 26.150000000000002 23.9 23.2125 26.737499999999997 50-51 26.424999999999997 23.3625 23.4125 26.8 52-53 25.8625 23.5625 22.725 27.85 54-55 26.075 22.9625 23.5875 27.375 56-57 26.337500000000002 23.0375 23.549999999999997 27.075 58-59 26.075 23.05 22.6875 28.1875 60-61 26.087500000000002 24.337500000000002 23.05 26.525 62-63 26.05 23.6875 22.625 27.6375 64-65 26.974999999999998 22.8875 22.4375 27.700000000000003 66-67 26.137500000000003 23.4625 24.0 26.400000000000002 68-69 26.237500000000004 24.1125 22.7125 26.937499999999996 70-71 27.125 22.675 22.400000000000002 27.800000000000004 72-73 27.150000000000002 23.2125 22.8625 26.775 74-75 26.85 22.5625 22.9625 27.625 76-77 27.250000000000004 22.1375 23.549999999999997 27.0625 78-79 26.5625 23.825 22.975 26.637499999999996 80-81 26.875 23.400000000000002 23.0125 26.7125 82-83 28.4125 23.3 21.25 27.037499999999998 84-85 26.737499999999997 22.287499999999998 23.45 27.525 86-87 26.5 23.525 22.7625 27.212500000000002 88-89 27.787499999999998 22.4375 22.4625 27.3125 90-91 27.05 23.9125 22.8 26.237500000000004 92-93 27.750000000000004 22.6875 22.400000000000002 27.1625 94-95 27.2625 22.275 22.5125 27.950000000000003 96-97 26.687499999999996 23.7 22.75 26.8625 98-99 27.275 22.75 23.2375 26.737499999999997 100-101 27.2625 22.8125 22.25 27.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.5 26 1.5 27 1.0 28 3.5 29 7.5 30 10.0 31 11.0 32 12.5 33 13.0 34 16.0 35 25.5 36 35.5 37 51.0 38 67.0 39 78.5 40 96.5 41 113.0 42 120.5 43 132.0 44 135.0 45 141.0 46 155.5 47 149.0 48 139.0 49 135.5 50 130.5 51 125.5 52 116.0 53 102.5 54 89.5 55 91.5 56 97.5 57 88.5 58 87.5 59 95.0 60 99.5 61 85.5 62 72.5 63 74.5 64 77.5 65 90.0 66 91.0 67 76.0 68 71.0 69 84.5 70 87.5 71 68.0 72 58.5 73 53.0 74 48.5 75 41.0 76 27.5 77 27.5 78 23.0 79 15.0 80 11.0 81 8.0 82 9.0 83 8.0 84 3.0 85 1.0 86 2.0 87 1.0 88 1.0 89 1.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.7000000000000001 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.0485721910862 88.1 2 5.497731518548172 10.299999999999999 3 0.4003202562049639 1.125 4 0.0 0.0 5 0.02668801708033093 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02668801708033093 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTAACCACATCTCGTAT 14 0.35000000000000003 TruSeq Adapter, Index 19 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTAACCACATCGCGTAT 5 0.125 TruSeq Adapter, Index 19 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.1375 0.0 0.0 0.0 0.0 58-59 0.16249999999999998 0.0 0.0 0.0 0.0 60-61 0.1875 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.21250000000000002 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.4125 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.5874999999999999 0.0 0.0 0.0 0.0 80-81 0.8 0.0 0.0 0.0 0.0 82-83 0.95 0.0 0.0 0.0 0.0 84-85 1.1625 0.0 0.0 0.0 0.0 86-87 1.2625 0.0 0.0 0.0 0.0 88-89 1.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11668422 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668422_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.03 37.0 37.0 37.0 37.0 37.0 2 35.7555 37.0 37.0 37.0 37.0 37.0 3 35.9965 37.0 37.0 37.0 37.0 37.0 4 36.0465 37.0 37.0 37.0 37.0 37.0 5 36.0685 37.0 37.0 37.0 37.0 37.0 6 35.9405 37.0 37.0 37.0 37.0 37.0 7 35.9535 37.0 37.0 37.0 37.0 37.0 8 35.953 37.0 37.0 37.0 37.0 37.0 9 36.1245 37.0 37.0 37.0 37.0 37.0 10-11 36.110749999999996 37.0 37.0 37.0 37.0 37.0 12-13 36.08625 37.0 37.0 37.0 37.0 37.0 14-15 36.039500000000004 37.0 37.0 37.0 37.0 37.0 16-17 36.0465 37.0 37.0 37.0 37.0 37.0 18-19 36.1 37.0 37.0 37.0 37.0 37.0 20-21 35.975750000000005 37.0 37.0 37.0 37.0 37.0 22-23 35.872 37.0 37.0 37.0 37.0 37.0 24-25 36.013999999999996 37.0 37.0 37.0 37.0 37.0 26-27 35.87025 37.0 37.0 37.0 37.0 37.0 28-29 35.9495 37.0 37.0 37.0 37.0 37.0 30-31 35.8525 37.0 37.0 37.0 37.0 37.0 32-33 35.8915 37.0 37.0 37.0 37.0 37.0 34-35 35.90025 37.0 37.0 37.0 37.0 37.0 36-37 35.79425 37.0 37.0 37.0 37.0 37.0 38-39 35.919 37.0 37.0 37.0 37.0 37.0 40-41 35.8795 37.0 37.0 37.0 37.0 37.0 42-43 35.88575 37.0 37.0 37.0 37.0 37.0 44-45 35.76375 37.0 37.0 37.0 37.0 37.0 46-47 35.84325 37.0 37.0 37.0 37.0 37.0 48-49 35.73725 37.0 37.0 37.0 37.0 37.0 50-51 35.868625 37.0 37.0 37.0 37.0 37.0 52-53 35.897625 37.0 37.0 37.0 37.0 37.0 54-55 35.802 37.0 37.0 37.0 37.0 37.0 56-57 35.841125 37.0 37.0 37.0 37.0 37.0 58-59 35.7185 37.0 37.0 37.0 37.0 37.0 60-61 35.81725 37.0 37.0 37.0 37.0 37.0 62-63 35.81375 37.0 37.0 37.0 37.0 37.0 64-65 35.689750000000004 37.0 37.0 37.0 37.0 37.0 66-67 35.86725 37.0 37.0 37.0 37.0 37.0 68-69 35.912125 37.0 37.0 37.0 37.0 37.0 70-71 35.64375 37.0 37.0 37.0 37.0 37.0 72-73 35.74625 37.0 37.0 37.0 37.0 37.0 74-75 35.7875 37.0 37.0 37.0 37.0 37.0 76-77 35.794250000000005 37.0 37.0 37.0 37.0 37.0 78-79 35.715 37.0 37.0 37.0 37.0 37.0 80-81 35.6355 37.0 37.0 37.0 37.0 37.0 82-83 35.813500000000005 37.0 37.0 37.0 37.0 37.0 84-85 35.6335 37.0 37.0 37.0 37.0 37.0 86-87 35.7145 37.0 37.0 37.0 37.0 37.0 88-89 35.8795 37.0 37.0 37.0 37.0 37.0 90-91 35.777249999999995 37.0 37.0 37.0 37.0 37.0 92-93 35.707499999999996 37.0 37.0 37.0 37.0 37.0 94-95 35.668 37.0 37.0 37.0 37.0 37.0 96-97 35.658 37.0 37.0 37.0 37.0 37.0 98-99 35.67100000000001 37.0 37.0 37.0 37.0 37.0 100-101 35.41475 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 2.0 16 4.0 17 0.0 18 2.0 19 1.0 20 1.0 21 4.0 22 4.0 23 9.0 24 7.0 25 17.0 26 13.0 27 18.0 28 25.0 29 21.0 30 34.0 31 52.0 32 71.0 33 115.0 34 157.0 35 411.0 36 2442.0 37 588.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.625 16.225 11.675 38.475 2 30.049999999999997 22.7 24.675 22.575 3 26.85 24.75 24.05 24.349999999999998 4 30.075000000000003 28.575 17.375 23.974999999999998 5 30.225 29.95 17.825 22.0 6 24.275 33.650000000000006 18.775 23.3 7 24.2 16.825000000000003 32.4 26.575 8 25.124999999999996 19.825 22.2 32.85 9 25.924999999999997 20.474999999999998 24.725 28.875 10-11 27.8375 26.6 19.112499999999997 26.450000000000003 12-13 28.225 19.900000000000002 22.925 28.95 14-15 27.375 23.175 22.675 26.775 16-17 28.1375 22.787499999999998 21.025 28.050000000000004 18-19 27.8625 22.1875 22.3375 27.6125 20-21 28.15 23.825 22.162499999999998 25.8625 22-23 27.481870467616904 22.83070767691923 22.118029507376843 27.569392348087025 24-25 26.86921730432608 22.605651412853213 22.193048262065513 28.33208302075519 26-27 28.475 23.35 21.7875 26.387500000000003 28-29 27.474999999999998 22.9375 20.8875 28.7 30-31 26.9125 23.1375 22.625 27.325 32-33 27.28182045511378 22.95573893473368 23.618404601150285 26.144036009002253 34-35 27.725 21.725 22.3125 28.237499999999997 36-37 27.956989247311824 23.23080770192548 21.59289822455614 27.219304826206553 38-39 27.131782945736433 24.168542135533883 21.75543885971493 26.944236059014752 40-41 27.625 23.599999999999998 21.7875 26.987499999999997 42-43 28.057014253563388 23.3183295823956 21.180295073768445 27.44436109027257 44-45 27.47623811905953 23.13656828414207 21.98599299649825 27.40120060030015 46-47 27.66383191595798 23.261630815407706 21.735867933966986 27.33866933466733 48-49 27.63881940970485 22.761380690345174 22.886443221610804 26.713356678339167 50-51 27.222708515693384 23.88395648368138 21.29548580717769 27.597849193447544 52-53 28.710766537451544 23.40877829185945 20.4451669376016 27.435288233087405 54-55 28.226613306653327 23.311655827913956 21.585792896448226 26.87593796898449 56-57 27.64786795048143 22.821057896711267 22.308365637113916 27.222708515693384 58-59 28.107026756689173 22.53063265816454 21.517879469867466 27.84446111527882 60-61 28.157039259814955 23.118279569892472 21.91797949487372 26.806701675418854 62-63 28.644661165291325 22.893223305826456 21.73043260815204 26.731682920730183 64-65 27.694423605901473 22.943235808952238 21.255313828457115 28.107026756689173 66-67 27.725 22.0125 22.375 27.8875 68-69 28.053506688336043 23.177897237154642 21.61520190023753 27.15339417427178 70-71 28.394598649662417 23.15578894723681 21.392848212053014 27.056764191047762 72-73 28.0625 23.4125 21.925 26.6 74-75 27.187499999999996 23.65 22.075 27.0875 76-77 27.4125 22.6875 22.0125 27.8875 78-79 27.575 23.525 22.15 26.75 80-81 27.8875 23.35 21.875 26.887499999999996 82-83 28.95 22.4625 21.8125 26.775 84-85 27.625 23.0125 22.6125 26.75 86-87 28.762500000000003 22.875 21.912499999999998 26.450000000000003 88-89 28.3125 22.3875 21.825 27.474999999999998 90-91 28.825 22.3 21.6 27.275 92-93 28.125 22.8 22.475 26.6 94-95 27.537499999999998 22.400000000000002 23.4125 26.650000000000002 96-97 29.15 22.55 21.762500000000003 26.5375 98-99 27.275 23.1875 22.4875 27.05 100-101 28.3625 23.2625 22.05 26.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.0 23 1.5 24 1.0 25 0.5 26 0.5 27 1.5 28 3.5 29 4.0 30 4.0 31 8.5 32 10.0 33 10.0 34 16.5 35 26.0 36 35.0 37 36.5 38 50.0 39 66.0 40 73.0 41 93.0 42 108.0 43 115.0 44 122.5 45 139.0 46 143.0 47 137.5 48 137.5 49 134.5 50 130.0 51 112.5 52 102.0 53 95.0 54 89.5 55 92.0 56 86.5 57 82.0 58 97.5 59 103.5 60 93.0 61 90.5 62 102.0 63 103.5 64 93.5 65 93.0 66 89.5 67 100.5 68 105.0 69 88.5 70 84.5 71 79.0 72 65.5 73 61.5 74 64.5 75 49.0 76 30.0 77 31.5 78 28.0 79 16.5 80 12.0 81 10.5 82 7.5 83 3.5 84 2.0 85 2.0 86 1.0 87 0.5 88 0.5 89 0.5 90 0.5 91 1.0 92 1.0 93 0.5 94 0.0 95 1.0 96 2.0 97 1.0 98 1.5 99 3.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.025 24-25 0.025 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.025 34-35 0.0 36-37 0.025 38-39 0.025 40-41 0.0 42-43 0.025 44-45 0.05 46-47 0.05 48-49 0.05 50-51 0.0375 52-53 0.0375 54-55 0.05 56-57 0.0375 58-59 0.025 60-61 0.025 62-63 0.025 64-65 0.025 66-67 0.0 68-69 0.0125 70-71 0.025 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.394261424017 88.825 2 5.074388947927736 9.55 3 0.45164718384697133 1.275 4 0.053134962805526036 0.2 5 0.0 0.0 6 0.026567481402763018 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.1375 0.0 0.0 0.0 0.0 58-59 0.16249999999999998 0.0 0.0 0.0 0.0 60-61 0.1875 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.21250000000000002 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.4125 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.5874999999999999 0.0 0.0 0.0 0.0 80-81 0.8 0.0 0.0 0.0 0.0 82-83 0.95 0.0 0.0 0.0 0.0 84-85 1.1625 0.0 0.0 0.0 0.0 86-87 1.2625 0.0 0.0 0.0 0.0 88-89 1.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGTGG 15 6.142176E-4 95.0 9 >>END_MODULE Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376628 spots for SRR11668422.sra Written 2376628 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra Read 2376611 spots for SRR11668422.sra Written 2376611 spots for SRR11668422.sra SRR ids: ['SRR11668422.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ynqw54iu SRR11668422.sra spots: 47532237 blocks: [[1, 2376611], [2376612, 4753222], [4753223, 7129833], [7129834, 9506444], [9506445, 11883055], [11883056, 14259666], [14259667, 16636277], [16636278, 19012888], [19012889, 21389499], [21389500, 23766110], [23766111, 26142721], [26142722, 28519332], [28519333, 30895943], [30895944, 33272554], [33272555, 35649165], [35649166, 38025776], [38025777, 40402387], [40402388, 42778998], [42778999, 45155609], [45155610, 47532237]] SRR11668422 file size 11490013 SRR11668422 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11668422 SRR11668422_1.fastq SRR11668422_2.fastq Input file: SRR11668422_1.fastq Paired file: SRR11668422_2.fastq trimmed: SRR11668422-trimmed-pair1.fastq, SRR11668422-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:24:16 2024 >> started Fri Dec 6 10:25:22 2024 >> done (65.201s) 47532237 read pairs processed; of these: 8148 ( 0.02%) short read pairs filtered out after trimming by size control 319507 ( 0.67%) empty read pairs filtered out after trimming by size control 47204582 (99.31%) read pairs available; of these: 1782591 ( 3.78%) trimmed read pairs available after processing 45421991 (96.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 223 0.00% 19 152 0.00% 20 195 0.00% 21 185 0.00% 22 150 0.00% 23 145 0.00% 24 180 0.00% 25 191 0.00% 26 189 0.00% 27 219 0.00% 28 255 0.00% 29 299 0.00% 30 274 0.00% 31 382 0.00% 32 442 0.00% 33 345 0.00% 34 461 0.00% 35 440 0.00% 36 599 0.00% 37 520 0.00% 38 580 0.00% 39 703 0.00% 40 793 0.00% 41 842 0.00% 42 972 0.00% 43 1009 0.00% 44 1014 0.00% 45 1038 0.00% 46 1100 0.00% 47 1348 0.00% 48 1461 0.00% 49 1754 0.00% 50 1936 0.00% 51 2086 0.00% 52 2284 0.00% 53 2445 0.01% 54 2464 0.01% 55 2669 0.01% 56 2906 0.01% 57 3188 0.01% 58 3677 0.01% 59 4139 0.01% 60 4760 0.01% 61 5202 0.01% 62 5633 0.01% 63 6046 0.01% 64 6608 0.01% 65 7187 0.02% 66 7724 0.02% 67 9101 0.02% 68 9316 0.02% 69 10217 0.02% 70 11326 0.02% 71 12606 0.03% 72 14003 0.03% 73 15792 0.03% 74 17269 0.04% 75 18724 0.04% 76 20695 0.04% 77 22174 0.05% 78 23816 0.05% 79 26107 0.06% 80 28297 0.06% 81 31127 0.07% 82 35081 0.07% 83 38197 0.08% 84 41880 0.09% 85 46049 0.10% 86 49934 0.11% 87 53066 0.11% 88 57317 0.12% 89 60817 0.13% 90 65244 0.14% 91 70321 0.15% 92 75486 0.16% 93 81887 0.17% 94 89037 0.19% 95 95672 0.20% 96 100986 0.21% 97 107367 0.23% 98 113020 0.24% 99 117377 0.25% 100 123869 0.26% 101 45421991 96.22% 47204582 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=21 prefix-density=0.37 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=26 fanout-score=13.29 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=3.1 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGG criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=5.41 fanout-score-rank=10 prefix-density=0.48 prefix-fanout=4.1 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTA criterion=fanout-score sequence-density=0.16 sequence-density-rank=23 fanout-score=219.79 fanout-score-rank=1 prefix-density=1.44 prefix-fanout=24.0 sequence=CCGCCGCCGCCTCC SRR11668422 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:26:07 Started mapping on | Dec 06 10:26:07 Finished on | Dec 06 10:28:29 Mapping speed, Million of reads per hour | 1196.74 Number of input reads | 47204582 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 45083985 Uniquely mapped reads % | 95.51% Average mapped length | 200.42 Number of splices: Total | 26176338 Number of splices: Annotated (sjdb) | 24799321 Number of splices: GT/AG | 25821292 Number of splices: GC/AG | 295700 Number of splices: AT/AC | 13690 Number of splices: Non-canonical | 45656 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.13 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1175305 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 70077 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.15% % of reads unmapped: other | 0.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 945292 945292 945292 N_multimapping 1175305 1175305 1175305 N_noFeature 1064894 43955745 1476525 N_ambiguous 905080 6014 197643 UnstrandedReadsAssigned:43114011 PositiveStrandReadsAssigned:1122226 NegativeStrandReadsAssigned:43409817 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11668422 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11668422-trimmed-pair1.fastq SRR11668422-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 47,204,582 reads, 44,374,557 reads pseudoaligned [quant] estimated average fragment length: 210.523 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52973 SRR11668422.ke.tsv 35125 SRR11668422.se.tsv 88098 total ==> SRR11668422.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 726.795 0 0 PNS24247 1044 834.477 62.4181 2.31026 PNS24249 1928 1718.48 541.566 9.73358 PNS24246 1044 834.477 62.4181 2.31026 PNS24248 1044 834.477 62.4181 2.31026 PNS24244 1471 1261.48 51.1796 1.25309 PNS24243 293 117.623 0 0 KQK14069 1603 1393.48 5735.77 127.133 KQK14071 474 272.437 446.463 50.6157 ==> SRR11668422.se.tsv <== BRADI_1g14170v3 6642 BRADI_1g53295v3 46 BRADI_1g59795v3 812 BRADI_1g07683v3 0 BRADI_1g00485v3 118 BRADI_1g20270v3 7275 BRADI_1g74790v3 223 BRADI_1g09890v3 43 BRADI_1g77505v3 502 BRADI_1g48960v3 0 SRR11668422 completed mapping pipeline successfully