Starting /dee2/code/volunteer_pipeline.sh SRR11668423 current disk space = 1551734112256 free memory = 1593666508 SRR11668423 SRAfilesize d381392d738056f9f2b23aa53f937358 SRR11668423.sra SRR11668423.sra file validated SRR11668423 is paired end SRR11668423 is conventional basespace SRR11668423 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668423_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1135 37.0 37.0 37.0 37.0 37.0 2 35.8715 37.0 37.0 37.0 37.0 37.0 3 36.1605 37.0 37.0 37.0 37.0 37.0 4 36.26225 37.0 37.0 37.0 37.0 37.0 5 36.1955 37.0 37.0 37.0 37.0 37.0 6 36.1995 37.0 37.0 37.0 37.0 37.0 7 36.081 37.0 37.0 37.0 37.0 37.0 8 36.12 37.0 37.0 37.0 37.0 37.0 9 36.1575 37.0 37.0 37.0 37.0 37.0 10-11 36.247 37.0 37.0 37.0 37.0 37.0 12-13 36.184 37.0 37.0 37.0 37.0 37.0 14-15 36.194 37.0 37.0 37.0 37.0 37.0 16-17 36.12575 37.0 37.0 37.0 37.0 37.0 18-19 36.23675 37.0 37.0 37.0 37.0 37.0 20-21 36.1665 37.0 37.0 37.0 37.0 37.0 22-23 36.186 37.0 37.0 37.0 37.0 37.0 24-25 36.086749999999995 37.0 37.0 37.0 37.0 37.0 26-27 36.07125 37.0 37.0 37.0 37.0 37.0 28-29 36.05925 37.0 37.0 37.0 37.0 37.0 30-31 36.08 37.0 37.0 37.0 37.0 37.0 32-33 36.028999999999996 37.0 37.0 37.0 37.0 37.0 34-35 35.96175 37.0 37.0 37.0 37.0 37.0 36-37 35.971000000000004 37.0 37.0 37.0 37.0 37.0 38-39 36.018 37.0 37.0 37.0 37.0 37.0 40-41 35.995000000000005 37.0 37.0 37.0 37.0 37.0 42-43 35.9615 37.0 37.0 37.0 37.0 37.0 44-45 35.821250000000006 37.0 37.0 37.0 37.0 37.0 46-47 35.983000000000004 37.0 37.0 37.0 37.0 37.0 48-49 35.971000000000004 37.0 37.0 37.0 37.0 37.0 50-51 35.857 37.0 37.0 37.0 37.0 37.0 52-53 35.855000000000004 37.0 37.0 37.0 37.0 37.0 54-55 35.908 37.0 37.0 37.0 37.0 37.0 56-57 35.92975 37.0 37.0 37.0 37.0 37.0 58-59 35.822 37.0 37.0 37.0 37.0 37.0 60-61 35.84825 37.0 37.0 37.0 37.0 37.0 62-63 35.866 37.0 37.0 37.0 37.0 37.0 64-65 35.724000000000004 37.0 37.0 37.0 37.0 37.0 66-67 35.81 37.0 37.0 37.0 37.0 37.0 68-69 35.7775 37.0 37.0 37.0 37.0 37.0 70-71 35.727500000000006 37.0 37.0 37.0 37.0 37.0 72-73 35.8485 37.0 37.0 37.0 37.0 37.0 74-75 35.839 37.0 37.0 37.0 37.0 37.0 76-77 35.86175 37.0 37.0 37.0 37.0 37.0 78-79 35.841750000000005 37.0 37.0 37.0 37.0 37.0 80-81 35.764250000000004 37.0 37.0 37.0 37.0 37.0 82-83 35.7325 37.0 37.0 37.0 37.0 37.0 84-85 35.77225 37.0 37.0 37.0 37.0 37.0 86-87 35.77975 37.0 37.0 37.0 37.0 37.0 88-89 35.7615 37.0 37.0 37.0 37.0 37.0 90-91 35.69025 37.0 37.0 37.0 37.0 37.0 92-93 35.74875 37.0 37.0 37.0 37.0 37.0 94-95 35.73350000000001 37.0 37.0 37.0 37.0 37.0 96-97 35.676 37.0 37.0 37.0 37.0 37.0 98-99 35.696749999999994 37.0 37.0 37.0 37.0 37.0 100-101 35.557249999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 5.0 24 2.0 25 3.0 26 14.0 27 14.0 28 21.0 29 49.0 30 57.0 31 76.0 32 78.0 33 111.0 34 183.0 35 315.0 36 2400.0 37 671.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.150000000000006 10.8 12.9 42.15 2 31.19335347432024 12.084592145015106 29.0281973816717 27.69385699899295 3 27.875 16.825000000000003 20.349999999999998 34.949999999999996 4 32.63315828957239 20.130032508127034 17.104276069017253 30.132533133283324 5 32.9 23.95 20.225 22.925 6 25.624999999999996 29.549999999999997 21.725 23.1 7 19.85 26.200000000000003 33.074999999999996 20.875 8 22.650000000000002 21.925 28.000000000000004 27.425 9 23.674999999999997 19.225 31.025000000000002 26.075 10-11 25.1 27.4125 22.775000000000002 24.712500000000002 12-13 26.3625 22.125 24.349999999999998 27.1625 14-15 25.174999999999997 23.3 24.2375 27.287499999999998 16-17 25.9875 23.599999999999998 23.2625 27.150000000000002 18-19 25.2375 23.8375 23.849999999999998 27.075 20-21 25.9875 23.5625 23.974999999999998 26.474999999999998 22-23 26.325 23.599999999999998 22.95 27.125 24-25 26.900000000000002 22.7125 23.0375 27.35 26-27 25.6125 23.75 23.3625 27.275 28-29 26.5875 23.974999999999998 22.7125 26.724999999999998 30-31 25.624999999999996 23.1 24.0 27.275 32-33 25.1 23.1 23.6625 28.1375 34-35 26.275 23.825 23.2875 26.6125 36-37 26.0375 23.724999999999998 23.05 27.187499999999996 38-39 25.924999999999997 23.1875 22.8875 28.000000000000004 40-41 25.624999999999996 23.25 23.6375 27.487499999999997 42-43 26.025 22.8 24.25 26.924999999999997 44-45 25.8625 23.474999999999998 23.875 26.787499999999998 46-47 27.250000000000004 22.25 23.5125 26.987499999999997 48-49 25.8125 22.9625 23.5 27.725 50-51 26.087500000000002 24.2 22.5125 27.200000000000003 52-53 26.275 24.4875 22.8 26.437500000000004 54-55 26.075 22.9875 22.6125 28.325 56-57 25.974999999999998 23.5375 24.2875 26.200000000000003 58-59 26.2125 23.2375 23.075000000000003 27.474999999999998 60-61 26.700000000000003 23.549999999999997 22.4625 27.287499999999998 62-63 26.637499999999996 23.25 22.6125 27.500000000000004 64-65 25.937500000000004 22.925 23.849999999999998 27.287499999999998 66-67 25.937500000000004 23.7625 23.0625 27.237499999999997 68-69 26.924999999999997 23.075000000000003 23.150000000000002 26.85 70-71 26.825 23.175 23.400000000000002 26.6 72-73 26.025 22.9625 23.5 27.5125 74-75 27.0625 22.900000000000002 22.8375 27.200000000000003 76-77 26.737499999999997 23.7625 21.7875 27.712500000000002 78-79 26.5375 23.175 23.45 26.8375 80-81 27.750000000000004 22.7 22.6375 26.9125 82-83 27.55 23.2875 22.3375 26.825 84-85 26.2625 23.9875 23.2125 26.5375 86-87 27.3375 22.7625 22.6125 27.287499999999998 88-89 27.325 23.1625 22.6125 26.900000000000002 90-91 27.375 23.35 21.975 27.3 92-93 27.787499999999998 23.400000000000002 22.1 26.7125 94-95 26.7625 23.5625 21.462500000000002 28.212500000000002 96-97 28.000000000000004 22.6875 23.0125 26.3 98-99 27.2625 24.3875 21.4 26.950000000000003 100-101 27.8125 22.8625 22.05 27.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 1.0 25 2.0 26 2.5 27 3.5 28 5.5 29 6.0 30 6.5 31 6.5 32 8.5 33 14.5 34 23.5 35 27.0 36 27.0 37 38.0 38 55.5 39 72.5 40 87.5 41 114.0 42 128.5 43 135.5 44 147.0 45 139.5 46 140.5 47 153.5 48 151.5 49 135.5 50 112.5 51 114.5 52 119.5 53 103.5 54 96.5 55 99.0 56 96.0 57 95.5 58 93.5 59 86.0 60 85.5 61 91.0 62 86.5 63 78.0 64 84.5 65 102.0 66 106.0 67 87.0 68 84.0 69 75.5 70 68.0 71 68.5 72 57.5 73 48.0 74 48.5 75 41.5 76 31.0 77 27.0 78 19.0 79 14.0 80 11.5 81 9.5 82 5.0 83 6.0 84 6.0 85 1.5 86 0.5 87 1.0 88 1.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.7000000000000001 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.85 #Duplication Level Percentage of deduplicated Percentage of total 1 93.1071620893915 86.45 2 6.381260096930533 11.85 3 0.45772751750134627 1.275 4 0.026925148088314487 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026925148088314487 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGGCTGTATCTCGTAT 13 0.325 TruSeq Adapter, Index 15 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.1375 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.21250000000000002 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.225 0.0 0.0 0.0 0.0 44-45 0.2375 0.0 0.0 0.0 0.0 46-47 0.25 0.0 0.0 0.0 0.0 48-49 0.25 0.0 0.0 0.0 0.0 50-51 0.25 0.0 0.0 0.0 0.0 52-53 0.25 0.0 0.0 0.0 0.0 54-55 0.25 0.0 0.0 0.0 0.0 56-57 0.30000000000000004 0.0 0.0 0.0 0.0 58-59 0.375 0.0 0.0 0.0 0.0 60-61 0.425 0.0 0.0 0.0 0.0 62-63 0.475 0.0 0.0 0.0 0.0 64-65 0.475 0.0 0.0 0.0 0.0 66-67 0.5125 0.0 0.0 0.0 0.0 68-69 0.6375 0.0 0.0 0.0 0.0 70-71 0.7625 0.0 0.0 0.0 0.0 72-73 0.8 0.0 0.0 0.0 0.0 74-75 0.8374999999999999 0.0 0.0 0.0 0.0 76-77 0.85 0.0 0.0 0.0 0.0 78-79 0.9125000000000001 0.0 0.0 0.0 0.0 80-81 1.075 0.0 0.0 0.0 0.0 82-83 1.15 0.0 0.0 0.0 0.0 84-85 1.3250000000000002 0.0 0.0 0.0 0.0 86-87 1.625 0.0 0.0 0.0 0.0 88-89 1.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTCTG 15 0.009957196 47.5 18-19 >>END_MODULE SRR11668423 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668423_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7575 37.0 37.0 37.0 37.0 37.0 2 35.7835 37.0 37.0 37.0 37.0 37.0 3 35.8845 37.0 37.0 37.0 37.0 37.0 4 35.9765 37.0 37.0 37.0 37.0 37.0 5 35.9665 37.0 37.0 37.0 37.0 37.0 6 35.749 37.0 37.0 37.0 37.0 37.0 7 35.8605 37.0 37.0 37.0 37.0 37.0 8 36.0435 37.0 37.0 37.0 37.0 37.0 9 36.058 37.0 37.0 37.0 37.0 37.0 10-11 35.9845 37.0 37.0 37.0 37.0 37.0 12-13 35.90375 37.0 37.0 37.0 37.0 37.0 14-15 35.9015 37.0 37.0 37.0 37.0 37.0 16-17 35.997249999999994 37.0 37.0 37.0 37.0 37.0 18-19 35.8985 37.0 37.0 37.0 37.0 37.0 20-21 35.885 37.0 37.0 37.0 37.0 37.0 22-23 35.784 37.0 37.0 37.0 37.0 37.0 24-25 35.841625 37.0 37.0 37.0 37.0 37.0 26-27 35.81725 37.0 37.0 37.0 37.0 37.0 28-29 35.89175 37.0 37.0 37.0 37.0 37.0 30-31 35.787499999999994 37.0 37.0 37.0 37.0 37.0 32-33 35.826875 37.0 37.0 37.0 37.0 37.0 34-35 35.78725 37.0 37.0 37.0 37.0 37.0 36-37 35.781625 37.0 37.0 37.0 37.0 37.0 38-39 35.771625 37.0 37.0 37.0 37.0 37.0 40-41 35.685500000000005 37.0 37.0 37.0 37.0 37.0 42-43 35.766125 37.0 37.0 37.0 37.0 37.0 44-45 35.614999999999995 37.0 37.0 37.0 37.0 37.0 46-47 35.646 37.0 37.0 37.0 37.0 37.0 48-49 35.70125 37.0 37.0 37.0 37.0 37.0 50-51 35.716125 37.0 37.0 37.0 37.0 37.0 52-53 35.67425 37.0 37.0 37.0 37.0 37.0 54-55 35.635999999999996 37.0 37.0 37.0 37.0 37.0 56-57 35.566374999999994 37.0 37.0 37.0 37.0 37.0 58-59 35.599125 37.0 37.0 37.0 37.0 37.0 60-61 35.604124999999996 37.0 37.0 37.0 37.0 37.0 62-63 35.680125000000004 37.0 37.0 37.0 37.0 37.0 64-65 35.492374999999996 37.0 37.0 37.0 37.0 37.0 66-67 35.655874999999995 37.0 37.0 37.0 37.0 37.0 68-69 35.6595 37.0 37.0 37.0 37.0 37.0 70-71 35.472375 37.0 37.0 37.0 37.0 37.0 72-73 35.53675 37.0 37.0 37.0 37.0 37.0 74-75 35.592 37.0 37.0 37.0 37.0 37.0 76-77 35.601749999999996 37.0 37.0 37.0 37.0 37.0 78-79 35.628 37.0 37.0 37.0 37.0 37.0 80-81 35.43425 37.0 37.0 37.0 37.0 37.0 82-83 35.60625 37.0 37.0 37.0 37.0 37.0 84-85 35.47825 37.0 37.0 37.0 37.0 37.0 86-87 35.61750000000001 37.0 37.0 37.0 37.0 37.0 88-89 35.596000000000004 37.0 37.0 37.0 37.0 37.0 90-91 35.51775 37.0 37.0 37.0 37.0 37.0 92-93 35.431749999999994 37.0 37.0 37.0 37.0 37.0 94-95 35.536 37.0 37.0 37.0 37.0 37.0 96-97 35.433 37.0 37.0 37.0 37.0 37.0 98-99 35.42825 37.0 37.0 37.0 37.0 37.0 100-101 35.2005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 6.0 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 4.0 21 5.0 22 5.0 23 11.0 24 15.0 25 18.0 26 17.0 27 24.0 28 26.0 29 34.0 30 42.0 31 63.0 32 77.0 33 105.0 34 175.0 35 469.0 36 2390.0 37 512.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.075000000000003 17.325 12.5 40.1 2 30.55 23.325000000000003 24.95 21.175 3 27.224999999999998 25.224999999999998 21.575 25.974999999999998 4 29.25 30.025000000000002 16.925 23.799999999999997 5 30.825000000000003 30.15 17.7 21.325 6 25.424999999999997 34.050000000000004 17.299999999999997 23.225 7 24.25 16.475 32.9 26.375 8 25.025 19.725 23.325000000000003 31.924999999999997 9 25.75 22.1 24.125 28.025 10-11 27.4125 26.387500000000003 19.05 27.150000000000002 12-13 26.625 20.837500000000002 22.8625 29.675 14-15 26.8 22.85 23.0875 27.2625 16-17 28.249999999999996 22.5125 21.65 27.5875 18-19 27.500000000000004 22.7 22.775000000000002 27.025 20-21 28.7 23.425 21.587500000000002 26.2875 22-23 27.544386096524132 23.718429607401852 21.21780445111278 27.51937984496124 24-25 26.985119419782418 23.42128298111792 22.095785919719894 27.49781167937977 26-27 27.237499999999997 23.0125 22.8875 26.8625 28-29 27.6 22.6 22.5 27.3 30-31 27.275 22.475 23.1375 27.1125 32-33 27.210203826434913 24.046517444041516 22.233337501563085 26.50994122796049 34-35 27.737499999999997 22.0625 22.6375 27.5625 36-37 27.172689758659494 23.22120795298237 21.683131174190322 27.92297111416781 38-39 27.67979987492183 22.489055659787365 21.6635397123202 28.167604752970604 40-41 28.0875 21.375 22.725 27.8125 42-43 27.435288233087405 24.134050268850817 21.35800925347005 27.072652244591723 44-45 27.633224918689013 23.405053790342755 21.90392794595947 27.057793345008758 46-47 29.00925694270703 23.46760070052539 21.391043282461847 26.13209907430573 48-49 27.995996997748314 23.217413059794847 22.804603452589443 25.9819864898674 50-51 28.67509070436632 22.744901789065434 22.294507694232454 26.285499812335793 52-53 28.14610958218664 22.992244183137352 21.678759069301975 27.18288716537403 54-55 26.782586940205157 23.605203902927197 22.34175631723793 27.270452839629723 56-57 27.80487804878049 23.101938711694807 22.101313320825515 26.991869918699184 58-59 28.448168063023633 22.433412529698636 22.10829060897837 27.01012879829936 60-61 27.810428910841566 23.321245467050144 22.04576716268601 26.822558459422286 62-63 28.898336876328624 22.633487557834187 22.345879704889335 26.12229586094785 64-65 27.560335125672125 23.133675128173063 22.145804676753784 27.160185069401027 66-67 26.903362920365048 22.927865983247905 22.75284410551319 27.415926990873857 68-69 28.882220555138783 22.043010752688172 22.255563890972745 26.819204801200303 70-71 27.410278854570464 23.43378767037639 21.958234337876704 27.19769913717644 72-73 28.1375 21.8125 22.775000000000002 27.275 74-75 27.55 22.662499999999998 22.825 26.9625 76-77 28.625 22.9375 22.162499999999998 26.275 78-79 27.800000000000004 22.5625 22.9375 26.700000000000003 80-81 27.737499999999997 23.4125 21.6625 27.187499999999996 82-83 27.35 22.275 23.175 27.200000000000003 84-85 28.5625 22.4875 22.5125 26.437500000000004 86-87 28.8875 22.625 21.837500000000002 26.650000000000002 88-89 28.762500000000003 23.4875 21.775 25.974999999999998 90-91 28.6625 22.7625 22.3375 26.237500000000004 92-93 28.3125 23.05 22.175 26.4625 94-95 27.05 23.3875 21.625 27.9375 96-97 28.712500000000002 23.549999999999997 22.025 25.7125 98-99 28.7 23.6625 22.0875 25.55 100-101 29.4125 23.0875 21.2875 26.2125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 1.0 26 1.5 27 2.5 28 2.5 29 4.5 30 7.5 31 11.0 32 13.5 33 12.0 34 16.5 35 29.5 36 32.5 37 41.0 38 49.5 39 56.0 40 86.5 41 117.5 42 131.0 43 117.0 44 119.0 45 132.0 46 125.5 47 128.0 48 125.5 49 122.0 50 123.5 51 116.0 52 104.0 53 91.5 54 87.0 55 88.5 56 89.5 57 90.0 58 93.5 59 100.0 60 93.5 61 79.5 62 83.0 63 90.5 64 100.0 65 109.0 66 98.0 67 102.0 68 111.0 69 99.5 70 98.5 71 82.0 72 59.0 73 56.5 74 51.5 75 45.0 76 39.0 77 34.0 78 22.5 79 12.0 80 10.0 81 7.5 82 5.0 83 6.0 84 4.5 85 2.5 86 4.0 87 2.5 88 0.5 89 1.0 90 0.5 91 0.0 92 0.5 93 1.5 94 2.0 95 1.0 96 0.5 97 1.0 98 2.5 99 2.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.025 24-25 0.0375 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0375 34-35 0.0 36-37 0.0375 38-39 0.0625 40-41 0.0 42-43 0.0375 44-45 0.075 46-47 0.075 48-49 0.075 50-51 0.08750000000000001 52-53 0.075 54-55 0.075 56-57 0.0625 58-59 0.0375 60-61 0.0375 62-63 0.0375 64-65 0.0375 66-67 0.0125 68-69 0.025 70-71 0.0375 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.525 #Duplication Level Percentage of deduplicated Percentage of total 1 93.58460304731355 87.52499999999999 2 5.934242181234964 11.1 3 0.45442395081529 1.275 4 0.02673082063619353 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.1375 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.21250000000000002 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.225 0.0 0.0 0.0 0.0 44-45 0.2375 0.0 0.0 0.0 0.0 46-47 0.25 0.0 0.0 0.0 0.0 48-49 0.25 0.0 0.0 0.0 0.0 50-51 0.25 0.0 0.0 0.0 0.0 52-53 0.25 0.0 0.0 0.0 0.0 54-55 0.25 0.0 0.0 0.0 0.0 56-57 0.30000000000000004 0.0 0.0 0.0 0.0 58-59 0.375 0.0 0.0 0.0 0.0 60-61 0.425 0.0 0.0 0.0 0.0 62-63 0.475 0.0 0.0 0.0 0.0 64-65 0.475 0.0 0.0 0.0 0.0 66-67 0.5125 0.0 0.0 0.0 0.0 68-69 0.6125 0.0 0.0 0.0 0.0 70-71 0.7375 0.0 0.0 0.0 0.0 72-73 0.775 0.0 0.0 0.0 0.0 74-75 0.8125 0.0 0.0 0.0 0.0 76-77 0.825 0.0 0.0 0.0 0.0 78-79 0.9125000000000001 0.0 0.0 0.0 0.0 80-81 1.075 0.0 0.0 0.0 0.0 82-83 1.15 0.0 0.0 0.0 0.0 84-85 1.3250000000000002 0.0 0.0 0.0 0.0 86-87 1.6 0.0 0.0 0.0 0.0 88-89 1.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345025 spots for SRR11668423.sra Written 2345025 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra Read 2345024 spots for SRR11668423.sra Written 2345024 spots for SRR11668423.sra SRR ids: ['SRR11668423.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qro0rzar SRR11668423.sra spots: 46900481 blocks: [[1, 2345024], [2345025, 4690048], [4690049, 7035072], [7035073, 9380096], [9380097, 11725120], [11725121, 14070144], [14070145, 16415168], [16415169, 18760192], [18760193, 21105216], [21105217, 23450240], [23450241, 25795264], [25795265, 28140288], [28140289, 30485312], [30485313, 32830336], [32830337, 35175360], [35175361, 37520384], [37520385, 39865408], [39865409, 42210432], [42210433, 44555456], [44555457, 46900481]] SRR11668423 file size 11337009 SRR11668423 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11668423 SRR11668423_1.fastq SRR11668423_2.fastq Input file: SRR11668423_1.fastq Paired file: SRR11668423_2.fastq trimmed: SRR11668423-trimmed-pair1.fastq, SRR11668423-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:25:39 2024 >> started Fri Dec 6 10:26:27 2024 >> done (48.718s) 46900481 read pairs processed; of these: 9451 ( 0.02%) short read pairs filtered out after trimming by size control 271770 ( 0.58%) empty read pairs filtered out after trimming by size control 46619260 (99.40%) read pairs available; of these: 2079131 ( 4.46%) trimmed read pairs available after processing 44540129 (95.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 306 0.00% 19 275 0.00% 20 264 0.00% 21 229 0.00% 22 217 0.00% 23 199 0.00% 24 204 0.00% 25 201 0.00% 26 209 0.00% 27 203 0.00% 28 220 0.00% 29 323 0.00% 30 268 0.00% 31 328 0.00% 32 386 0.00% 33 345 0.00% 34 379 0.00% 35 337 0.00% 36 513 0.00% 37 395 0.00% 38 524 0.00% 39 576 0.00% 40 664 0.00% 41 797 0.00% 42 775 0.00% 43 764 0.00% 44 806 0.00% 45 920 0.00% 46 1017 0.00% 47 1146 0.00% 48 1319 0.00% 49 1598 0.00% 50 1785 0.00% 51 1981 0.00% 52 2154 0.00% 53 2326 0.00% 54 2464 0.01% 55 2641 0.01% 56 2873 0.01% 57 3295 0.01% 58 3721 0.01% 59 4228 0.01% 60 4831 0.01% 61 5335 0.01% 62 5949 0.01% 63 6610 0.01% 64 7057 0.02% 65 7752 0.02% 66 8581 0.02% 67 9938 0.02% 68 10345 0.02% 69 11600 0.02% 70 12902 0.03% 71 14491 0.03% 72 16259 0.03% 73 18243 0.04% 74 19915 0.04% 75 22296 0.05% 76 23816 0.05% 77 26170 0.06% 78 28058 0.06% 79 30713 0.07% 80 33367 0.07% 81 36683 0.08% 82 40834 0.09% 83 44945 0.10% 84 49220 0.11% 85 54466 0.12% 86 58844 0.13% 87 62614 0.13% 88 67783 0.15% 89 71747 0.15% 90 77634 0.17% 91 82997 0.18% 92 89544 0.19% 93 96521 0.21% 94 104536 0.22% 95 111294 0.24% 96 118304 0.25% 97 126801 0.27% 98 132746 0.28% 99 136929 0.29% 100 146286 0.31% 101 44540129 95.54% 46619260 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=28 prefix-density=0.39 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=28 fanout-score=12.93 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=3.0 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=5.18 fanout-score-rank=9 prefix-density=0.48 prefix-fanout=3.9 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.20 sequence-density-rank=14 fanout-score=163.68 fanout-score-rank=1 prefix-density=1.51 prefix-fanout=21.5 sequence=GCCGCCGCCACCCT SRR11668423 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:27:03 Started mapping on | Dec 06 10:27:03 Finished on | Dec 06 10:29:04 Mapping speed, Million of reads per hour | 1387.02 Number of input reads | 46619260 Average input read length | 200 UNIQUE READS: Uniquely mapped reads number | 44354453 Uniquely mapped reads % | 95.14% Average mapped length | 200.27 Number of splices: Total | 25650588 Number of splices: Annotated (sjdb) | 24324848 Number of splices: GT/AG | 25301382 Number of splices: GC/AG | 292018 Number of splices: AT/AC | 12895 Number of splices: Non-canonical | 44293 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1278951 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 69833 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.22% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 985856 985856 985856 N_multimapping 1278951 1278951 1278951 N_noFeature 1121281 43231818 1529319 N_ambiguous 909062 6070 205435 UnstrandedReadsAssigned:42324110 PositiveStrandReadsAssigned:1116565 NegativeStrandReadsAssigned:42619699 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11668423 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11668423-trimmed-pair1.fastq SRR11668423-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 46,619,260 reads, 43,627,724 reads pseudoaligned [quant] estimated average fragment length: 205.434 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,250 rounds 52973 SRR11668423.ke.tsv 35125 SRR11668423.se.tsv 88098 total ==> SRR11668423.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 731.702 0 0 PNS24247 1044 839.566 54.5215 2.05524 PNS24249 1928 1723.57 477.886 8.775 PNS24246 1044 839.566 54.5215 2.05524 PNS24248 1044 839.566 54.5215 2.05524 PNS24244 1471 1266.57 65.5491 1.63791 PNS24243 293 122.944 0 0 KQK14069 1603 1398.57 6972.51 157.782 KQK14071 474 277.48 502.543 57.3181 ==> SRR11668423.se.tsv <== BRADI_1g14170v3 8053 BRADI_1g53295v3 59 BRADI_1g59795v3 788 BRADI_1g07683v3 0 BRADI_1g00485v3 77 BRADI_1g20270v3 5289 BRADI_1g74790v3 187 BRADI_1g09890v3 33 BRADI_1g77505v3 513 BRADI_1g48960v3 1 SRR11668423 completed mapping pipeline successfully