Starting /dee2/code/volunteer_pipeline.sh SRR11668424 current disk space = 1551623221248 free memory = 1604590116 SRR11668424 SRAfilesize 570055815e5cc1b35d7dd7350dedae6f SRR11668424.sra SRR11668424.sra file validated SRR11668424 is paired end SRR11668424 is conventional basespace SRR11668424 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668424_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.31375 32.0 32.0 32.0 32.0 32.0 2 31.38375 32.0 32.0 32.0 32.0 32.0 3 34.22875 37.0 32.0 37.0 32.0 37.0 4 35.18 37.0 37.0 37.0 32.0 37.0 5 36.16875 37.0 37.0 37.0 37.0 37.0 6 38.923 41.0 37.0 41.0 32.0 41.0 7 39.4795 41.0 41.0 41.0 37.0 41.0 8 39.64725 41.0 41.0 41.0 37.0 41.0 9 39.79175 41.0 41.0 41.0 37.0 41.0 10-11 39.695 41.0 41.0 41.0 37.0 41.0 12-13 39.46875 41.0 41.0 41.0 37.0 41.0 14-15 39.415499999999994 41.0 41.0 41.0 37.0 41.0 16-17 39.412499999999994 41.0 41.0 41.0 37.0 41.0 18-19 39.4055 41.0 41.0 41.0 37.0 41.0 20-21 39.584374999999994 41.0 41.0 41.0 37.0 41.0 22-23 39.69375 41.0 41.0 41.0 37.0 41.0 24-25 39.492375 41.0 41.0 41.0 37.0 41.0 26-27 39.267375 41.0 41.0 41.0 37.0 41.0 28-29 39.319874999999996 41.0 41.0 41.0 37.0 41.0 30-31 39.253874999999994 41.0 41.0 41.0 37.0 41.0 32-33 38.962875 41.0 41.0 41.0 34.5 41.0 34-35 39.01625 41.0 41.0 41.0 37.0 41.0 36-37 38.99125 41.0 41.0 41.0 34.5 41.0 38-39 39.00625 41.0 41.0 41.0 37.0 41.0 40-41 38.950500000000005 41.0 41.0 41.0 34.5 41.0 42-43 38.630250000000004 41.0 39.0 41.0 32.0 41.0 44-45 38.744749999999996 41.0 41.0 41.0 34.5 41.0 46-47 38.86825 41.0 41.0 41.0 34.5 41.0 48-49 38.81075 41.0 41.0 41.0 32.0 41.0 50-51 38.667125 41.0 41.0 41.0 32.0 41.0 52-53 38.135999999999996 41.0 37.0 41.0 32.0 41.0 54-55 38.188 41.0 37.0 41.0 32.0 41.0 56-57 38.230000000000004 41.0 37.0 41.0 32.0 41.0 58-59 38.217875 41.0 37.0 41.0 32.0 41.0 60-61 37.991375000000005 41.0 37.0 41.0 29.5 41.0 62-63 37.652 41.0 37.0 41.0 29.5 41.0 64-65 37.803 41.0 37.0 41.0 32.0 41.0 66-67 37.790875 41.0 37.0 41.0 32.0 41.0 68-69 37.6325 41.0 37.0 41.0 27.0 41.0 70-71 37.42475 41.0 37.0 41.0 27.0 41.0 72-73 37.582499999999996 41.0 37.0 41.0 27.0 41.0 74-75 37.054125 41.0 37.0 41.0 27.0 41.0 76-77 36.38675 39.0 34.5 41.0 24.5 41.0 78-79 36.938625 41.0 37.0 41.0 27.0 41.0 80-81 37.628 41.0 37.0 41.0 29.5 41.0 82-83 37.6325 41.0 37.0 41.0 27.0 41.0 84-85 37.523375 41.0 37.0 41.0 27.0 41.0 86-87 37.666 41.0 37.0 41.0 29.5 41.0 88-89 37.195625 41.0 37.0 41.0 27.0 41.0 90-91 37.0135 41.0 37.0 41.0 27.0 41.0 92-93 36.899874999999994 41.0 37.0 41.0 27.0 41.0 94-95 37.151875000000004 41.0 37.0 41.0 27.0 41.0 96-97 36.851875 41.0 37.0 41.0 27.0 41.0 98-99 36.733875 41.0 37.0 41.0 24.5 41.0 100 35.47675 41.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 4.0 24 8.0 25 9.0 26 12.0 27 28.0 28 36.0 29 45.0 30 50.0 31 79.0 32 87.0 33 97.0 34 128.0 35 164.0 36 211.0 37 320.0 38 488.0 39 911.0 40 1320.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.70676691729324 10.300751879699249 12.431077694235588 44.56140350877193 2 29.625 10.325 30.125 29.925 3 26.650000000000002 15.8 21.5 36.05 4 31.724999999999998 20.05 18.425 29.799999999999997 5 30.599999999999998 24.099999999999998 21.775 23.525 6 25.424999999999997 24.775 24.525 25.275 7 19.975 25.074999999999996 33.175 21.775 8 20.825 23.125 29.75 26.3 9 22.2 19.55 30.975 27.275 10-11 24.275 27.187499999999996 23.962500000000002 24.575 12-13 24.975 22.1 24.825 28.1 14-15 24.712500000000002 23.2375 25.25 26.8 16-17 25.5125 22.825 24.462500000000002 27.200000000000003 18-19 23.7125 23.5625 25.15 27.575 20-21 25.474999999999998 23.2375 24.224999999999998 27.0625 22-23 24.7 23.8375 24.4125 27.05 24-25 24.5625 23.6625 24.325 27.450000000000003 26-27 24.95 23.875 24.224999999999998 26.950000000000003 28-29 25.1 22.9875 25.05 26.8625 30-31 25.7125 23.425 23.4375 27.425 32-33 25.4375 23.775 24.2375 26.55 34-35 25.587500000000002 23.799999999999997 24.1375 26.474999999999998 36-37 25.724999999999998 23.150000000000002 23.35 27.775 38-39 25.662499999999998 24.3 23.3625 26.674999999999997 40-41 24.925 24.3125 23.925 26.8375 42-43 25.724999999999998 22.787499999999998 24.4375 27.05 44-45 25.7625 22.05 24.875 27.3125 46-47 24.4875 23.0 25.1 27.4125 48-49 25.572375828850248 22.95758788940323 23.64568997873139 27.82434630301514 50-51 26.200000000000003 23.974999999999998 23.3625 26.4625 52-53 25.424999999999997 23.075000000000003 22.9875 28.512500000000003 54-55 25.087500000000002 23.3875 23.6875 27.8375 56-57 24.9875 22.8375 24.725 27.450000000000003 58-59 24.2875 23.6125 24.3875 27.712500000000002 60-61 25.724999999999998 23.0125 23.400000000000002 27.8625 62-63 25.2125 22.900000000000002 24.375 27.5125 64-65 25.4 23.3625 24.15 27.0875 66-67 25.4 23.3375 24.212500000000002 27.05 68-69 25.2125 23.625 24.075 27.0875 70-71 25.7 23.575 23.35 27.375 72-73 25.7125 23.775 22.975 27.537499999999998 74-75 24.95617330328074 23.766591535186578 24.054595542198847 27.222639619333833 76-77 26.575 22.2 24.275 26.950000000000003 78-79 25.854941751221343 22.096956031567082 23.725416510083928 28.322685707127647 80-81 25.15 24.075 24.0375 26.737499999999997 82-83 26.825 22.8625 23.1875 27.125 84-85 26.525 22.9625 23.5625 26.950000000000003 86-87 25.9625 23.724999999999998 23.125 27.187499999999996 88-89 26.187500000000004 23.3375 23.599999999999998 26.875 90-91 25.7125 23.1 23.3375 27.85 92-93 26.375 23.0125 23.9375 26.674999999999997 94-95 26.900000000000002 23.2875 23.6625 26.150000000000002 96-97 25.674999999999997 23.3 22.537499999999998 28.487499999999997 98-99 25.7 23.1125 23.724999999999998 27.462500000000002 100 26.3 23.875 22.075 27.750000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.5 26 1.5 27 1.5 28 2.0 29 2.5 30 5.0 31 7.5 32 11.0 33 13.0 34 20.0 35 29.5 36 36.5 37 55.0 38 67.5 39 78.0 40 95.0 41 105.0 42 121.5 43 146.0 44 156.5 45 163.5 46 170.5 47 171.5 48 163.0 49 155.0 50 141.0 51 132.0 52 121.5 53 100.0 54 102.5 55 95.0 56 83.5 57 90.0 58 88.5 59 68.5 60 61.5 61 70.5 62 74.5 63 75.0 64 75.0 65 74.0 66 74.0 67 79.0 68 72.0 69 60.5 70 63.5 71 65.5 72 58.0 73 49.5 74 43.5 75 47.5 76 45.0 77 26.5 78 16.0 79 14.5 80 14.0 81 12.0 82 9.0 83 6.0 84 2.5 85 1.0 86 0.5 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.08750000000000001 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.17500000000000002 76-77 0.0 78-79 0.21250000000000002 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34563502163401 96.6 2 1.6034614405701197 3.15 3 0.025451768897938407 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025451768897938407 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTACCGACATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 4 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.36250000000000004 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.8125 0.0 0.0 0.0 0.0 86-87 1.0875 0.0 0.0 0.0 0.0 88 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11668424 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668424_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.86625 32.0 32.0 32.0 32.0 32.0 2 31.04 32.0 32.0 32.0 32.0 32.0 3 33.89375 37.0 32.0 37.0 32.0 37.0 4 34.52375 37.0 37.0 37.0 32.0 37.0 5 35.235 37.0 37.0 37.0 32.0 37.0 6 38.57975 41.0 37.0 41.0 32.0 41.0 7 38.64925 41.0 41.0 41.0 32.0 41.0 8 38.49275 41.0 41.0 41.0 32.0 41.0 9 38.222 41.0 41.0 41.0 32.0 41.0 10-11 38.2595 41.0 39.0 41.0 29.5 41.0 12-13 38.259875 41.0 39.0 41.0 32.0 41.0 14-15 38.302 41.0 39.0 41.0 32.0 41.0 16-17 38.13775 41.0 39.0 41.0 29.5 41.0 18-19 38.16674999999999 41.0 39.0 41.0 32.0 41.0 20-21 38.09675 41.0 39.0 41.0 29.5 41.0 22-23 38.050625 41.0 37.0 41.0 32.0 41.0 24-25 38.163624999999996 41.0 39.0 41.0 32.0 41.0 26-27 37.94475 41.0 39.0 41.0 29.5 41.0 28-29 38.0675 41.0 37.0 41.0 29.5 41.0 30-31 37.829499999999996 41.0 37.0 41.0 29.5 41.0 32-33 37.816374999999994 41.0 37.0 41.0 27.0 41.0 34-35 37.578500000000005 41.0 37.0 41.0 27.0 41.0 36-37 37.659499999999994 41.0 37.0 41.0 27.0 41.0 38-39 37.4195 41.0 37.0 41.0 27.0 41.0 40-41 37.412125 41.0 37.0 41.0 27.0 41.0 42-43 37.369 41.0 37.0 41.0 27.0 41.0 44-45 37.241375 41.0 37.0 41.0 27.0 41.0 46-47 37.29675 41.0 37.0 41.0 27.0 41.0 48-49 36.845875 41.0 37.0 41.0 24.5 41.0 50-51 36.8925 41.0 37.0 41.0 24.5 41.0 52-53 37.159375 41.0 37.0 41.0 27.0 41.0 54-55 37.031625 41.0 37.0 41.0 27.0 41.0 56-57 36.758750000000006 41.0 37.0 41.0 22.0 41.0 58-59 36.084500000000006 41.0 34.5 41.0 22.0 41.0 60-61 36.051875 41.0 34.5 41.0 22.0 41.0 62-63 36.112 41.0 34.5 41.0 22.0 41.0 64-65 36.39725 41.0 37.0 41.0 22.0 41.0 66-67 36.252125 41.0 37.0 41.0 22.0 41.0 68-69 35.8665 41.0 34.5 41.0 22.0 41.0 70-71 36.136875 41.0 37.0 41.0 22.0 41.0 72-73 35.422375 41.0 32.0 41.0 22.0 41.0 74-75 35.656125 41.0 32.0 41.0 22.0 41.0 76-77 35.220749999999995 39.0 34.5 41.0 22.0 41.0 78-79 36.008875 41.0 34.5 41.0 22.0 41.0 80-81 36.688874999999996 41.0 37.0 41.0 22.0 41.0 82-83 36.281125 41.0 37.0 41.0 22.0 41.0 84-85 36.257875 41.0 37.0 41.0 22.0 41.0 86-87 36.37775 41.0 37.0 41.0 22.0 41.0 88-89 35.997749999999996 41.0 37.0 41.0 22.0 41.0 90-91 35.2765 41.0 32.0 41.0 22.0 41.0 92-93 35.907375 41.0 34.5 41.0 22.0 41.0 94-95 35.517875000000004 41.0 32.0 41.0 22.0 41.0 96-97 35.452625 41.0 32.0 41.0 22.0 41.0 98-99 35.720375000000004 41.0 37.0 41.0 22.0 41.0 100 33.55725 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 1.0 16 2.0 17 10.0 18 6.0 19 17.0 20 18.0 21 22.0 22 31.0 23 25.0 24 33.0 25 49.0 26 49.0 27 60.0 28 62.0 29 62.0 30 85.0 31 87.0 32 112.0 33 123.0 34 142.0 35 172.0 36 231.0 37 283.0 38 416.0 39 698.0 40 1202.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.048286214660997 19.339504628471353 11.85889417062797 37.75331498623968 2 29.75 27.575 24.25 18.425 3 22.975 29.849999999999998 23.075000000000003 24.099999999999998 4 28.599999999999998 29.849999999999998 18.025 23.525 5 29.225 31.225 18.6 20.95 6 22.8 35.325 19.575 22.3 7 23.75 17.275 32.775 26.200000000000003 8 23.25 22.225 23.45 31.075000000000003 9 26.6 21.224999999999998 25.424999999999997 26.75 10-11 27.800000000000004 26.1125 19.325 26.7625 12-13 27.650000000000002 21.925 22.525000000000002 27.900000000000002 14-15 26.3125 23.4875 24.0125 26.187500000000004 16-17 27.1125 23.2125 23.674999999999997 26.0 18-19 27.787499999999998 23.3 23.4625 25.45 20-21 26.2875 24.762500000000003 22.775000000000002 26.174999999999997 22-23 28.249999999999996 23.400000000000002 21.75 26.6 24-25 27.0 24.275 22.4625 26.2625 26-27 26.987499999999997 24.9125 22.287499999999998 25.8125 28-29 27.5625 23.775 21.7875 26.875 30-31 26.150000000000002 24.325 22.6375 26.887499999999996 32-33 26.575 24.325 22.3875 26.7125 34-35 27.6 24.575 22.237499999999997 25.587500000000002 36-37 25.974999999999998 23.3375 23.5125 27.175 38-39 26.737499999999997 24.125 22.4875 26.650000000000002 40-41 27.237499999999997 24.2 22.0125 26.55 42-43 26.174999999999997 23.6375 22.787499999999998 27.400000000000002 44-45 27.625 24.5125 22.025 25.837500000000002 46-47 27.375 23.5875 21.6625 27.375 48-49 26.525 23.875 23.5125 26.087500000000002 50-51 25.93194896172129 24.055541656242184 23.642732049036777 26.36977733299975 52-53 27.1375 22.325 23.400000000000002 27.1375 54-55 27.150000000000002 23.2125 22.8 26.8375 56-57 27.325 22.975 23.275000000000002 26.424999999999997 58-59 27.6625 22.662499999999998 22.4625 27.212500000000002 60-61 26.787499999999998 24.0625 22.037499999999998 27.1125 62-63 28.199999999999996 23.825 22.775000000000002 25.2 64-65 28.02802802802803 23.435935935935937 22.35985985985986 26.176176176176174 66-67 27.237499999999997 23.625 22.4625 26.674999999999997 68-69 26.937499999999996 24.462500000000002 23.0 25.6 70-71 28.3125 23.375 20.95 27.3625 72-73 27.0875 24.6 22.1375 26.174999999999997 74-75 27.875 23.925 22.912499999999998 25.2875 76-77 27.925 23.3875 21.987499999999997 26.700000000000003 78-79 26.775 23.1 23.0625 27.0625 80-81 27.3875 24.7875 22.2625 25.5625 82-83 27.737499999999997 24.675 21.625 25.9625 84-85 27.2625 24.025 22.287499999999998 26.424999999999997 86-87 27.9375 23.825 22.4625 25.775 88-89 27.962500000000002 24.1125 21.712500000000002 26.2125 90-91 27.08281210908181 23.967975981986488 22.66700025018764 26.28221165874406 92-93 27.975 24.962500000000002 22.5 24.5625 94-95 28.316039504938118 23.92799099887486 21.802725340667585 25.95324415551944 96-97 27.790973871733964 24.20302537817227 22.115264408051004 25.890736342042754 98-99 27.800000000000004 24.099999999999998 22.025 26.075 100 28.4 24.275 22.2 25.124999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 2.5 23 3.0 24 2.0 25 1.0 26 2.5 27 4.0 28 3.0 29 3.0 30 5.0 31 9.5 32 11.0 33 13.5 34 19.5 35 22.0 36 35.0 37 55.0 38 61.5 39 78.0 40 93.5 41 110.0 42 138.0 43 137.0 44 127.5 45 141.5 46 157.5 47 152.0 48 146.5 49 137.5 50 125.5 51 127.5 52 110.0 53 91.0 54 96.5 55 106.0 56 109.0 57 96.0 58 85.0 59 87.5 60 81.0 61 81.0 62 91.0 63 91.5 64 80.0 65 80.5 66 79.5 67 67.0 68 67.0 69 64.5 70 67.0 71 64.5 72 62.0 73 64.0 74 59.0 75 50.0 76 36.0 77 26.5 78 20.0 79 17.5 80 13.0 81 9.0 82 7.5 83 4.5 84 2.5 85 1.0 86 2.0 87 1.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.075 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.1 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.075 92-93 0.0 94-95 0.0125 96-97 0.0125 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.44862665310275 96.775 2 1.5005086469989828 2.9499999999999997 3 0.025432349949135298 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025432349949135298 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCGTATTCGGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.0875 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.36250000000000004 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.8125 0.0 0.0 0.0 0.0 86-87 1.0625 0.0 0.0 0.0 0.0 88 1.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004203 spots for SRR11668424.sra Written 1004203 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra Read 1004188 spots for SRR11668424.sra Written 1004188 spots for SRR11668424.sra SRR ids: ['SRR11668424.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r7aud6jd SRR11668424.sra spots: 20083775 blocks: [[1, 1004188], [1004189, 2008376], [2008377, 3012564], [3012565, 4016752], [4016753, 5020940], [5020941, 6025128], [6025129, 7029316], [7029317, 8033504], [8033505, 9037692], [9037693, 10041880], [10041881, 11046068], [11046069, 12050256], [12050257, 13054444], [13054445, 14058632], [14058633, 15062820], [15062821, 16067008], [16067009, 17071196], [17071197, 18075384], [18075385, 19079572], [19079573, 20083775]] SRR11668424 file size 4803112 SRR11668424 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11668424 SRR11668424_1.fastq SRR11668424_2.fastq Input file: SRR11668424_1.fastq Paired file: SRR11668424_2.fastq trimmed: SRR11668424-trimmed-pair1.fastq, SRR11668424-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:26:16 2024 >> started Fri Dec 6 10:26:36 2024 >> done (20.192s) 20083775 read pairs processed; of these: 2228 ( 0.01%) short read pairs filtered out after trimming by size control 49706 ( 0.25%) empty read pairs filtered out after trimming by size control 20031841 (99.74%) read pairs available; of these: 1303916 ( 6.51%) trimmed read pairs available after processing 18727925 (93.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 45 0.00% 19 46 0.00% 20 44 0.00% 21 54 0.00% 22 34 0.00% 23 43 0.00% 24 53 0.00% 25 64 0.00% 26 75 0.00% 27 60 0.00% 28 53 0.00% 29 76 0.00% 30 79 0.00% 31 68 0.00% 32 97 0.00% 33 93 0.00% 34 83 0.00% 35 107 0.00% 36 90 0.00% 37 104 0.00% 38 133 0.00% 39 135 0.00% 40 163 0.00% 41 160 0.00% 42 184 0.00% 43 217 0.00% 44 185 0.00% 45 188 0.00% 46 218 0.00% 47 256 0.00% 48 320 0.00% 49 333 0.00% 50 380 0.00% 51 425 0.00% 52 477 0.00% 53 518 0.00% 54 560 0.00% 55 612 0.00% 56 659 0.00% 57 753 0.00% 58 849 0.00% 59 990 0.00% 60 1111 0.01% 61 1341 0.01% 62 1557 0.01% 63 1651 0.01% 64 1869 0.01% 65 2025 0.01% 66 2268 0.01% 67 2537 0.01% 68 2741 0.01% 69 3209 0.02% 70 3503 0.02% 71 3940 0.02% 72 4552 0.02% 73 5193 0.03% 74 5565 0.03% 75 6270 0.03% 76 7097 0.04% 77 7898 0.04% 78 8725 0.04% 79 9605 0.05% 80 10568 0.05% 81 11635 0.06% 82 12979 0.06% 83 14499 0.07% 84 16032 0.08% 85 18117 0.09% 86 19749 0.10% 87 21611 0.11% 88 23667 0.12% 89 25280 0.13% 90 27589 0.14% 91 29299 0.15% 92 31643 0.16% 93 34743 0.17% 94 38018 0.19% 95 40983 0.20% 96 44500 0.22% 97 50451 0.25% 98 85767 0.43% 99 654046 3.27% 100 18727925 93.49% 20031841 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=15 prefix-density=0.49 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=153.10 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=21.4 sequence=CCGCCGCCGCCA criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=4.53 fanout-score-rank=14 prefix-density=0.50 prefix-fanout=3.4 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.14 sequence-density-rank=21 fanout-score=215.70 fanout-score-rank=1 prefix-density=1.29 prefix-fanout=22.9 sequence=CCGCCGCCGCCA SRR11668424 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:27:10 Started mapping on | Dec 06 10:27:10 Finished on | Dec 06 10:28:35 Mapping speed, Million of reads per hour | 848.41 Number of input reads | 20031841 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 19177829 Uniquely mapped reads % | 95.74% Average mapped length | 198.28 Number of splices: Total | 11898802 Number of splices: Annotated (sjdb) | 11309574 Number of splices: GT/AG | 11740477 Number of splices: GC/AG | 134777 Number of splices: AT/AC | 5679 Number of splices: Non-canonical | 17869 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.01% Deletion average length | 1.93 Insertion rate per base | 0.01% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 495264 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 12583 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.35% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 358748 358748 358748 N_multimapping 495264 495264 495264 N_noFeature 508512 18697377 690433 N_ambiguous 373328 2501 80380 UnstrandedReadsAssigned:18295989 PositiveStrandReadsAssigned:477951 NegativeStrandReadsAssigned:18407016 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR11668424 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11668424-trimmed-pair1.fastq SRR11668424-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,031,841 reads, 18,917,259 reads pseudoaligned [quant] estimated average fragment length: 204.379 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR11668424.ke.tsv 35125 SRR11668424.se.tsv 88098 total ==> SRR11668424.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.774 0 0 PNS24247 1044 840.621 16.1534 1.4318 PNS24249 1928 1724.62 160.05 6.9148 PNS24246 1044 840.621 16.1534 1.4318 PNS24248 1044 840.621 16.1534 1.4318 PNS24244 1471 1267.62 33.4896 1.96851 PNS24243 293 119.068 0 0 KQK14069 1603 1399.62 897.068 47.7565 KQK14071 474 276.585 0 0 ==> SRR11668424.se.tsv <== BRADI_1g14170v3 899 BRADI_1g53295v3 5 BRADI_1g59795v3 65 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 1421 BRADI_1g74790v3 211 BRADI_1g09890v3 2 BRADI_1g77505v3 194 BRADI_1g48960v3 0 SRR11668424 completed mapping pipeline successfully