Starting /dee2/code/volunteer_pipeline.sh SRR11668425 current disk space = 1551589994496 free memory = 1597400808 SRR11668425 SRAfilesize 30f9f15eec612efb2dc49d6b040ac9cd SRR11668425.sra SRR11668425.sra file validated SRR11668425 is paired end SRR11668425 is conventional basespace SRR11668425 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668425_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.20625 32.0 32.0 32.0 32.0 32.0 2 31.43625 32.0 32.0 32.0 32.0 32.0 3 34.17 37.0 32.0 37.0 32.0 37.0 4 35.46625 37.0 37.0 37.0 32.0 37.0 5 36.09 37.0 37.0 37.0 37.0 37.0 6 38.9405 41.0 37.0 41.0 37.0 41.0 7 39.441 41.0 41.0 41.0 37.0 41.0 8 39.736 41.0 41.0 41.0 37.0 41.0 9 39.69425 41.0 41.0 41.0 37.0 41.0 10-11 39.8605 41.0 41.0 41.0 37.0 41.0 12-13 39.534125 41.0 41.0 41.0 37.0 41.0 14-15 39.535124999999994 41.0 41.0 41.0 37.0 41.0 16-17 39.58175 41.0 41.0 41.0 37.0 41.0 18-19 39.53325 41.0 41.0 41.0 37.0 41.0 20-21 39.6715 41.0 41.0 41.0 37.0 41.0 22-23 39.706125 41.0 41.0 41.0 37.0 41.0 24-25 39.575 41.0 41.0 41.0 37.0 41.0 26-27 39.35525 41.0 41.0 41.0 37.0 41.0 28-29 39.304 41.0 41.0 41.0 37.0 41.0 30-31 39.293 41.0 41.0 41.0 37.0 41.0 32-33 39.184875000000005 41.0 41.0 41.0 37.0 41.0 34-35 39.164375 41.0 41.0 41.0 37.0 41.0 36-37 39.00975 41.0 41.0 41.0 37.0 41.0 38-39 39.1025 41.0 41.0 41.0 37.0 41.0 40-41 38.982625 41.0 41.0 41.0 34.5 41.0 42-43 38.735375000000005 41.0 41.0 41.0 32.0 41.0 44-45 38.752875 41.0 39.0 41.0 32.0 41.0 46-47 39.054874999999996 41.0 41.0 41.0 37.0 41.0 48-49 38.96875 41.0 41.0 41.0 37.0 41.0 50-51 38.807500000000005 41.0 41.0 41.0 32.0 41.0 52-53 38.396 41.0 37.0 41.0 32.0 41.0 54-55 38.22675 41.0 37.0 41.0 32.0 41.0 56-57 38.310125 41.0 37.0 41.0 32.0 41.0 58-59 38.336124999999996 41.0 37.0 41.0 32.0 41.0 60-61 38.096374999999995 41.0 37.0 41.0 32.0 41.0 62-63 37.697375 41.0 37.0 41.0 29.5 41.0 64-65 37.863875 41.0 37.0 41.0 32.0 41.0 66-67 37.905625 41.0 37.0 41.0 32.0 41.0 68-69 37.689750000000004 41.0 37.0 41.0 29.5 41.0 70-71 37.666624999999996 41.0 37.0 41.0 27.0 41.0 72-73 37.646 41.0 37.0 41.0 29.5 41.0 74-75 37.079 41.0 37.0 41.0 27.0 41.0 76-77 36.363749999999996 39.0 34.5 41.0 24.5 41.0 78-79 37.126875 41.0 37.0 41.0 27.0 41.0 80-81 37.879374999999996 41.0 37.0 41.0 32.0 41.0 82-83 37.81875 41.0 37.0 41.0 29.5 41.0 84-85 37.80925 41.0 37.0 41.0 29.5 41.0 86-87 37.743375 41.0 37.0 41.0 27.0 41.0 88-89 37.344125000000005 41.0 37.0 41.0 27.0 41.0 90-91 37.2245 41.0 37.0 41.0 27.0 41.0 92-93 36.980999999999995 41.0 37.0 41.0 27.0 41.0 94-95 37.228 41.0 37.0 41.0 27.0 41.0 96-97 36.654875000000004 41.0 37.0 41.0 24.5 41.0 98-99 36.753 41.0 37.0 41.0 24.5 41.0 100 35.29 41.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 4.0 24 5.0 25 11.0 26 14.0 27 21.0 28 30.0 29 43.0 30 59.0 31 59.0 32 72.0 33 100.0 34 126.0 35 176.0 36 206.0 37 307.0 38 489.0 39 940.0 40 1336.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.860838985179605 9.897010801306203 13.011806078874654 43.23034413463954 2 30.599999999999998 11.0 28.849999999999998 29.549999999999997 3 27.625 16.25 21.3 34.825 4 29.775000000000002 20.325 18.875 31.025000000000002 5 32.4 23.65 19.900000000000002 24.05 6 25.900000000000002 27.675 23.575 22.85 7 19.75 25.05 33.575 21.625 8 21.775 22.3 29.25 26.674999999999997 9 24.20605151287822 19.654913728432106 29.83245811452863 26.30657664416104 10-11 24.224999999999998 26.8625 23.9375 24.975 12-13 25.362499999999997 22.400000000000002 24.775 27.462500000000002 14-15 24.9125 23.599999999999998 24.3125 27.175 16-17 25.587500000000002 23.674999999999997 23.375 27.3625 18-19 25.05 24.0125 23.962500000000002 26.974999999999998 20-21 25.8625 22.925 23.65 27.5625 22-23 24.9 23.9125 23.825 27.3625 24-25 24.55 24.337500000000002 24.05 27.0625 26-27 24.8625 23.25 24.525 27.3625 28-29 24.712500000000002 24.075 24.7375 26.474999999999998 30-31 25.2125 23.75 23.6375 27.400000000000002 32-33 24.575 24.0625 24.4875 26.875 34-35 24.85 23.8875 24.55 26.7125 36-37 24.4375 23.7625 24.712500000000002 27.0875 38-39 24.6875 23.325000000000003 24.425 27.5625 40-41 25.7125 23.799999999999997 24.075 26.4125 42-43 25.837500000000002 24.5125 22.7375 26.9125 44-45 25.2375 23.6125 23.8125 27.3375 46-47 25.324999999999996 23.25 24.125 27.3 48-49 25.8008008008008 23.736236236236234 23.16066066066066 27.3023023023023 50-51 25.662499999999998 23.7 23.7875 26.85 52-53 26.35 23.75 22.7375 27.1625 54-55 25.362499999999997 24.224999999999998 23.875 26.5375 56-57 25.412499999999998 23.4375 24.587500000000002 26.5625 58-59 25.2875 23.599999999999998 24.2375 26.875 60-61 25.5375 24.0125 23.65 26.8 62-63 25.25 22.85 24.4125 27.487499999999997 64-65 25.887500000000003 23.075000000000003 23.825 27.212500000000002 66-67 25.2125 23.775 23.625 27.3875 68-69 26.325 23.5875 23.3625 26.724999999999998 70-71 25.5 24.375 22.912499999999998 27.212500000000002 72-73 25.575 25.5125 23.1375 25.775 74-75 26.029282943311227 23.97697409585784 23.213615317231888 26.78012764359905 76-77 25.2125 24.2625 23.5125 27.0125 78-79 25.751126690035054 23.71056584877316 23.034551827741613 27.503755633450176 80-81 26.075 24.474999999999998 22.4875 26.9625 82-83 24.85 24.3625 23.8375 26.950000000000003 84-85 27.1625 23.3375 22.95 26.55 86-87 26.85 22.525000000000002 23.775 26.85 88-89 25.95 23.2875 23.325000000000003 27.437499999999996 90-91 25.4875 24.175 23.1875 27.150000000000002 92-93 26.400000000000002 24.1875 23.0375 26.375 94-95 26.2125 24.275 23.7375 25.775 96-97 26.1 23.6375 23.35 26.9125 98-99 27.287499999999998 22.95 23.525 26.237500000000004 100 27.575 24.125 23.200000000000003 25.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 0.5 25 1.0 26 1.5 27 2.5 28 3.5 29 3.0 30 5.5 31 8.0 32 9.0 33 16.5 34 23.5 35 27.0 36 40.0 37 57.0 38 71.0 39 85.5 40 103.0 41 118.0 42 124.0 43 144.0 44 154.0 45 146.5 46 150.5 47 165.5 48 173.0 49 164.0 50 147.5 51 136.5 52 113.5 53 96.5 54 101.0 55 93.0 56 94.0 57 91.0 58 77.5 59 83.5 60 87.0 61 76.5 62 72.5 63 69.0 64 63.5 65 67.0 66 64.5 67 64.5 68 74.0 69 69.0 70 62.5 71 57.0 72 56.5 73 51.0 74 41.5 75 37.0 76 33.5 77 28.5 78 20.5 79 18.0 80 11.5 81 12.0 82 10.5 83 6.5 84 6.5 85 3.0 86 1.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.1 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.11249999999999999 76-77 0.0 78-79 0.15 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.5732484076433 96.72500000000001 2 1.3503184713375795 2.65 3 0.05095541401273885 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025477707006369425 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCGTTAGAATCTCGTAT 19 0.475 TruSeq Adapter, Index 16 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.5125 0.0 0.0 0.0 0.0 78-79 0.625 0.0 0.0 0.0 0.0 80-81 0.7375 0.0 0.0 0.0 0.0 82-83 0.8625 0.0 0.0 0.0 0.0 84-85 1.0375 0.0 0.0 0.0 0.0 86-87 1.1749999999999998 0.0 0.0 0.0 0.0 88 1.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11668425 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668425_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9775 32.0 32.0 32.0 32.0 32.0 2 31.04 32.0 32.0 32.0 32.0 32.0 3 33.875 37.0 32.0 37.0 32.0 37.0 4 34.69125 37.0 37.0 37.0 32.0 37.0 5 35.34875 37.0 37.0 37.0 32.0 37.0 6 38.5705 41.0 37.0 41.0 32.0 41.0 7 38.636 41.0 41.0 41.0 32.0 41.0 8 38.59675 41.0 41.0 41.0 32.0 41.0 9 38.505 41.0 41.0 41.0 32.0 41.0 10-11 38.452375 41.0 41.0 41.0 32.0 41.0 12-13 38.43175 41.0 41.0 41.0 32.0 41.0 14-15 38.311875 41.0 39.0 41.0 32.0 41.0 16-17 38.260875 41.0 41.0 41.0 32.0 41.0 18-19 38.226749999999996 41.0 41.0 41.0 32.0 41.0 20-21 38.06075 41.0 39.0 41.0 29.5 41.0 22-23 38.119749999999996 41.0 39.0 41.0 32.0 41.0 24-25 38.172875 41.0 39.0 41.0 32.0 41.0 26-27 37.87375 41.0 39.0 41.0 29.5 41.0 28-29 37.961125 41.0 37.0 41.0 27.0 41.0 30-31 37.65025 41.0 37.0 41.0 27.0 41.0 32-33 37.717124999999996 41.0 37.0 41.0 27.0 41.0 34-35 37.507 41.0 37.0 41.0 27.0 41.0 36-37 37.73825 41.0 37.0 41.0 27.0 41.0 38-39 37.340999999999994 41.0 37.0 41.0 27.0 41.0 40-41 37.319874999999996 41.0 37.0 41.0 27.0 41.0 42-43 37.473625 41.0 37.0 41.0 27.0 41.0 44-45 37.441500000000005 41.0 37.0 41.0 27.0 41.0 46-47 37.366625 41.0 37.0 41.0 27.0 41.0 48-49 36.84287500000001 41.0 37.0 41.0 24.5 41.0 50-51 36.93175 41.0 37.0 41.0 24.5 41.0 52-53 37.10875 41.0 37.0 41.0 27.0 41.0 54-55 36.91975 41.0 37.0 41.0 27.0 41.0 56-57 36.75125 41.0 37.0 41.0 24.5 41.0 58-59 36.46275 41.0 37.0 41.0 22.0 41.0 60-61 36.295249999999996 41.0 37.0 41.0 22.0 41.0 62-63 36.250625 41.0 37.0 41.0 22.0 41.0 64-65 36.515874999999994 41.0 37.0 41.0 22.0 41.0 66-67 36.256625 41.0 37.0 41.0 22.0 41.0 68-69 36.08075 41.0 37.0 41.0 22.0 41.0 70-71 36.289 41.0 37.0 41.0 22.0 41.0 72-73 35.473 41.0 32.0 41.0 22.0 41.0 74-75 35.842 41.0 34.5 41.0 22.0 41.0 76-77 35.249125 39.0 34.5 41.0 22.0 41.0 78-79 35.947625 41.0 34.5 41.0 22.0 41.0 80-81 36.551500000000004 41.0 37.0 41.0 22.0 41.0 82-83 36.01525 41.0 37.0 41.0 22.0 41.0 84-85 36.100625 41.0 37.0 41.0 22.0 41.0 86-87 36.280625 41.0 37.0 41.0 22.0 41.0 88-89 35.740875 41.0 34.5 41.0 22.0 41.0 90-91 35.50975 41.0 32.0 41.0 22.0 41.0 92-93 35.843625 41.0 34.5 41.0 22.0 41.0 94-95 35.43875 41.0 32.0 41.0 22.0 41.0 96-97 35.378 41.0 32.0 41.0 22.0 41.0 98-99 35.664375 41.0 34.5 41.0 22.0 41.0 100 33.322 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 6.0 17 10.0 18 13.0 19 8.0 20 20.0 21 19.0 22 34.0 23 32.0 24 36.0 25 46.0 26 39.0 27 62.0 28 53.0 29 66.0 30 73.0 31 66.0 32 99.0 33 139.0 34 147.0 35 195.0 36 232.0 37 287.0 38 425.0 39 749.0 40 1144.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.864831038798496 18.247809762202756 11.889862327909889 37.997496871088856 2 30.4 25.650000000000002 23.775 20.175 3 23.175 27.625 24.375 24.825 4 28.825 30.099999999999998 17.2 23.875 5 31.7 30.45 17.575 20.275000000000002 6 22.6 35.075 19.675 22.650000000000002 7 23.1 17.925 33.125 25.85 8 24.05 20.724999999999998 24.224999999999998 31.0 9 25.224999999999998 21.475 25.124999999999996 28.175 10-11 27.975 26.637499999999996 18.45 26.937499999999996 12-13 26.450000000000003 21.475 22.537499999999998 29.5375 14-15 24.875 24.2375 24.6625 26.224999999999998 16-17 27.450000000000003 22.9375 22.7625 26.85 18-19 25.603200400050007 24.603075384423054 22.890361295161895 26.903362920365048 20-21 27.474999999999998 23.0625 22.375 27.0875 22-23 26.400000000000002 24.375 22.537499999999998 26.687499999999996 24-25 25.874999999999996 24.7875 22.3875 26.950000000000003 26-27 26.775 24.75 22.3375 26.137500000000003 28-29 26.6625 24.3 22.4625 26.575 30-31 26.740842605325664 24.353044130516317 22.86535816977122 26.040755094386796 32-33 27.1 23.825 22.625 26.450000000000003 34-35 27.237499999999997 22.9625 23.05 26.75 36-37 26.775 23.9875 23.1 26.137500000000003 38-39 27.0875 23.775 22.8875 26.25 40-41 27.3284160520065 22.59032379047381 23.1278909863733 26.95336917114639 42-43 27.0 23.724999999999998 22.4375 26.8375 44-45 27.1 23.925 22.4625 26.5125 46-47 27.47843480435054 23.202900362545318 22.202775346918365 27.11588948618577 48-49 26.690836354544317 23.87798474809351 22.565320665083135 26.865858232279034 50-51 26.37307644188665 23.470536719629674 22.694858000750656 27.461528837733017 52-53 27.675 23.4625 21.5625 27.3 54-55 26.5125 23.775 22.9875 26.724999999999998 56-57 26.5375 24.175 22.95 26.337500000000002 58-59 28.678584823102888 23.002875359419928 22.277784723090384 26.040755094386796 60-61 26.8125 24.025 22.6375 26.525 62-63 27.028378547318415 23.44043005375672 22.602825353169145 26.92836604575572 64-65 27.384230287859822 23.617021276595747 22.615769712140175 26.382978723404253 66-67 26.950000000000003 22.8125 23.425 26.8125 68-69 26.253281660207527 23.827978497312163 22.402800350043755 27.51593949243655 70-71 27.200000000000003 23.1375 22.5625 27.1 72-73 25.874999999999996 23.925 23.3625 26.8375 74-75 27.203400425053132 23.55294411801475 22.677834729341168 26.56582072759095 76-77 27.428428553569194 23.415426928366045 22.890361295161895 26.26578322290286 78-79 27.015876984623077 22.86535816977122 23.952994124265533 26.16577072134017 80-81 27.224999999999998 24.05 23.0875 25.637500000000003 82-83 27.665958244780597 23.827978497312163 21.990248781097637 26.515814476809602 84-85 26.75 23.6625 23.1875 26.400000000000002 86-87 27.528441055131893 23.96549568696087 22.027753469183647 26.478309788723593 88-89 28.253531691461433 23.377922240280036 22.490311288911112 25.87823477934742 90-91 27.37737737737738 23.04804804804805 22.985485485485484 26.58908908908909 92-93 27.037499999999998 24.125 23.1875 25.650000000000002 94-95 28.22852856607076 23.590448806100763 22.315289411176398 25.86573321665208 96-97 27.00337542192774 24.428053506688336 22.252781597699713 26.31578947368421 98-99 27.6625 24.525 22.6 25.2125 100 27.731932983245812 24.281070267566893 22.080520130032507 25.906476619154787 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 1.5 26 0.5 27 1.5 28 2.5 29 4.5 30 6.5 31 7.5 32 13.5 33 19.0 34 19.0 35 23.0 36 33.5 37 52.0 38 66.5 39 81.0 40 95.5 41 116.5 42 141.5 43 137.0 44 136.0 45 142.5 46 149.5 47 154.5 48 139.5 49 138.5 50 131.5 51 112.0 52 107.5 53 103.0 54 103.0 55 102.5 56 94.5 57 83.5 58 77.5 59 80.0 60 85.5 61 84.0 62 82.0 63 86.5 64 84.0 65 77.0 66 74.5 67 76.5 68 83.5 69 80.5 70 71.5 71 70.5 72 65.0 73 55.0 74 53.5 75 47.5 76 35.0 77 29.5 78 19.0 79 10.5 80 12.0 81 14.0 82 8.0 83 2.5 84 3.0 85 3.0 86 1.5 87 0.5 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0125 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0 46-47 0.0125 48-49 0.0125 50-51 0.08750000000000001 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0125 60-61 0.0 62-63 0.0125 64-65 0.125 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0125 76-77 0.0125 78-79 0.0125 80-81 0.0 82-83 0.0125 84-85 0.0 86-87 0.0125 88-89 0.0125 90-91 0.1 92-93 0.0 94-95 0.0125 96-97 0.0125 98-99 0.0 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.44467108618052 96.525 2 1.4788373278939317 2.9000000000000004 3 0.05099439061703213 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025497195308516064 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTATGCTGGTGTAGATCT 17 0.42500000000000004 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.5125 0.0 0.0 0.0 0.0 78-79 0.6499999999999999 0.0 0.0 0.0 0.0 80-81 0.7749999999999999 0.0 0.0 0.0 0.0 82-83 0.9125 0.0 0.0 0.0 0.0 84-85 1.0875 0.0 0.0 0.0 0.0 86-87 1.225 0.0 0.0 0.0 0.0 88 1.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763900 spots for SRR11668425.sra Written 763900 spots for SRR11668425.sra Read 763903 spots for SRR11668425.sra Written 763903 spots for SRR11668425.sra SRR ids: ['SRR11668425.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5y_pwwe5 SRR11668425.sra spots: 15278003 blocks: [[1, 763900], [763901, 1527800], [1527801, 2291700], [2291701, 3055600], [3055601, 3819500], [3819501, 4583400], [4583401, 5347300], [5347301, 6111200], [6111201, 6875100], [6875101, 7639000], [7639001, 8402900], [8402901, 9166800], [9166801, 9930700], [9930701, 10694600], [10694601, 11458500], [11458501, 12222400], [12222401, 12986300], [12986301, 13750200], [13750201, 14514100], [14514101, 15278003]] SRR11668425 file size 3648601 SRR11668425 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11668425 SRR11668425_1.fastq SRR11668425_2.fastq Input file: SRR11668425_1.fastq Paired file: SRR11668425_2.fastq trimmed: SRR11668425-trimmed-pair1.fastq, SRR11668425-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:33:30 2024 >> started Fri Dec 6 10:33:44 2024 >> done (14.414s) 15278003 read pairs processed; of these: 1324 ( 0.01%) short read pairs filtered out after trimming by size control 79466 ( 0.52%) empty read pairs filtered out after trimming by size control 15197213 (99.47%) read pairs available; of these: 1162232 ( 7.65%) trimmed read pairs available after processing 14034981 (92.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 27 0.00% 19 19 0.00% 20 38 0.00% 21 36 0.00% 22 43 0.00% 23 38 0.00% 24 29 0.00% 25 35 0.00% 26 36 0.00% 27 36 0.00% 28 41 0.00% 29 46 0.00% 30 52 0.00% 31 65 0.00% 32 71 0.00% 33 70 0.00% 34 62 0.00% 35 82 0.00% 36 92 0.00% 37 109 0.00% 38 126 0.00% 39 133 0.00% 40 131 0.00% 41 173 0.00% 42 177 0.00% 43 186 0.00% 44 201 0.00% 45 207 0.00% 46 246 0.00% 47 298 0.00% 48 321 0.00% 49 385 0.00% 50 443 0.00% 51 504 0.00% 52 538 0.00% 53 593 0.00% 54 633 0.00% 55 714 0.00% 56 753 0.00% 57 915 0.01% 58 963 0.01% 59 1152 0.01% 60 1341 0.01% 61 1404 0.01% 62 1692 0.01% 63 1853 0.01% 64 2124 0.01% 65 2303 0.02% 66 2427 0.02% 67 3189 0.02% 68 3087 0.02% 69 3483 0.02% 70 3903 0.03% 71 4352 0.03% 72 4904 0.03% 73 5610 0.04% 74 6119 0.04% 75 6946 0.05% 76 7683 0.05% 77 8540 0.06% 78 9250 0.06% 79 10274 0.07% 80 11284 0.07% 81 12294 0.08% 82 13775 0.09% 83 15067 0.10% 84 16884 0.11% 85 18773 0.12% 86 20218 0.13% 87 21939 0.14% 88 23624 0.16% 89 25677 0.17% 90 27377 0.18% 91 29425 0.19% 92 31625 0.21% 93 33851 0.22% 94 36702 0.24% 95 39273 0.26% 96 42349 0.28% 97 46881 0.31% 98 74637 0.49% 99 519274 3.42% 100 14034981 92.35% 15197213 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=12 prefix-density=0.53 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=150.48 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=20.7 sequence=CCGCCGCCGCCA criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=4.27 fanout-score-rank=17 prefix-density=0.55 prefix-fanout=3.3 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=226.00 fanout-score-rank=1 prefix-density=1.29 prefix-fanout=23.2 sequence=CCGCCGCCGCCA SRR11668425 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:34:13 Started mapping on | Dec 06 10:34:13 Finished on | Dec 06 10:35:08 Mapping speed, Million of reads per hour | 994.73 Number of input reads | 15197213 Average input read length | 198 UNIQUE READS: Uniquely mapped reads number | 14512877 Uniquely mapped reads % | 95.50% Average mapped length | 198.03 Number of splices: Total | 8737939 Number of splices: Annotated (sjdb) | 8304645 Number of splices: GT/AG | 8623117 Number of splices: GC/AG | 97869 Number of splices: AT/AC | 4121 Number of splices: Non-canonical | 12832 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.01% Deletion average length | 1.91 Insertion rate per base | 0.01% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 389415 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 14343 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.32% % of reads unmapped: other | 0.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 294921 294921 294921 N_multimapping 389415 389415 389415 N_noFeature 372715 14144525 512885 N_ambiguous 285722 1922 61992 UnstrandedReadsAssigned:13854440 PositiveStrandReadsAssigned:366430 NegativeStrandReadsAssigned:13938000 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR11668425 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11668425-trimmed-pair1.fastq SRR11668425-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,197,213 reads, 14,333,556 reads pseudoaligned [quant] estimated average fragment length: 199.777 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52973 SRR11668425.ke.tsv 35125 SRR11668425.se.tsv 88098 total ==> SRR11668425.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 737.39 0 0 PNS24247 1044 845.223 10.5722 1.21677 PNS24249 1928 1729.22 88.9377 5.00325 PNS24246 1044 845.223 10.5722 1.21677 PNS24248 1044 845.223 10.5722 1.21677 PNS24244 1471 1272.22 41.3458 3.16145 PNS24243 293 123.186 0 0 KQK14069 1603 1404.22 750.18 51.9693 KQK14071 474 280.998 17.1107 5.92353 ==> SRR11668425.se.tsv <== BRADI_1g14170v3 772 BRADI_1g53295v3 6 BRADI_1g59795v3 60 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 1339 BRADI_1g74790v3 148 BRADI_1g09890v3 2 BRADI_1g77505v3 147 BRADI_1g48960v3 0 SRR11668425 completed mapping pipeline successfully