Starting /dee2/code/volunteer_pipeline.sh SRR11668426 current disk space = 1551525982208 free memory = 1607233652 SRR11668426 SRAfilesize 122003e76f99008ff71e46c734f947dd SRR11668426.sra SRR11668426.sra file validated SRR11668426 is paired end SRR11668426 is conventional basespace SRR11668426 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668426_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.13625 32.0 32.0 32.0 32.0 32.0 2 31.385 32.0 32.0 32.0 32.0 32.0 3 34.48625 37.0 32.0 37.0 32.0 37.0 4 35.27 37.0 37.0 37.0 32.0 37.0 5 36.06 37.0 37.0 37.0 37.0 37.0 6 38.92875 41.0 37.0 41.0 32.0 41.0 7 39.501 41.0 41.0 41.0 37.0 41.0 8 39.669 41.0 41.0 41.0 37.0 41.0 9 39.747 41.0 41.0 41.0 37.0 41.0 10-11 39.922250000000005 41.0 41.0 41.0 37.0 41.0 12-13 39.549375 41.0 41.0 41.0 37.0 41.0 14-15 39.52475 41.0 41.0 41.0 37.0 41.0 16-17 39.455124999999995 41.0 41.0 41.0 37.0 41.0 18-19 39.535375 41.0 41.0 41.0 37.0 41.0 20-21 39.729124999999996 41.0 41.0 41.0 37.0 41.0 22-23 39.650625 41.0 41.0 41.0 37.0 41.0 24-25 39.375 41.0 41.0 41.0 37.0 41.0 26-27 39.275125 41.0 41.0 41.0 37.0 41.0 28-29 39.293375 41.0 41.0 41.0 37.0 41.0 30-31 39.320125000000004 41.0 41.0 41.0 37.0 41.0 32-33 38.797 41.0 41.0 41.0 32.0 41.0 34-35 38.935 41.0 41.0 41.0 37.0 41.0 36-37 38.847125000000005 41.0 41.0 41.0 34.5 41.0 38-39 38.891125 41.0 41.0 41.0 34.5 41.0 40-41 38.913250000000005 41.0 41.0 41.0 34.5 41.0 42-43 38.437625 41.0 37.0 41.0 32.0 41.0 44-45 38.49425 41.0 39.0 41.0 32.0 41.0 46-47 38.727000000000004 41.0 39.0 41.0 34.5 41.0 48-49 38.492875 41.0 39.0 41.0 32.0 41.0 50-51 38.52175 41.0 37.0 41.0 32.0 41.0 52-53 37.860125 41.0 37.0 41.0 29.5 41.0 54-55 37.752375 41.0 37.0 41.0 29.5 41.0 56-57 37.784875 41.0 37.0 41.0 29.5 41.0 58-59 37.791 41.0 37.0 41.0 29.5 41.0 60-61 37.712125 41.0 37.0 41.0 29.5 41.0 62-63 37.05575 41.0 37.0 41.0 27.0 41.0 64-65 37.017250000000004 41.0 37.0 41.0 27.0 41.0 66-67 36.933625 41.0 37.0 41.0 27.0 41.0 68-69 36.525625 41.0 37.0 41.0 24.5 41.0 70-71 36.152874999999995 41.0 37.0 41.0 22.0 41.0 72-73 36.0635 41.0 34.5 41.0 22.0 41.0 74-75 35.17975 41.0 32.0 41.0 22.0 41.0 76-77 33.574125 39.0 29.5 41.0 22.0 41.0 78-79 33.7605 37.0 29.5 41.0 17.0 41.0 80-81 35.042500000000004 41.0 32.0 41.0 22.0 41.0 82-83 34.766125 41.0 32.0 41.0 17.0 41.0 84-85 34.66325 41.0 32.0 41.0 22.0 41.0 86-87 34.524249999999995 39.0 32.0 41.0 17.0 41.0 88-89 33.74225 37.0 29.5 41.0 12.0 41.0 90-91 33.256375 37.0 27.0 41.0 12.0 41.0 92-93 32.94125 37.0 27.0 41.0 12.0 41.0 94-95 33.089875000000006 37.0 27.0 41.0 12.0 41.0 96-97 32.3805 37.0 27.0 41.0 12.0 41.0 98-99 31.910875 37.0 24.5 41.0 12.0 41.0 100 30.037 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 7.0 23 5.0 24 12.0 25 11.0 26 30.0 27 39.0 28 60.0 29 74.0 30 73.0 31 104.0 32 135.0 33 168.0 34 220.0 35 279.0 36 348.0 37 398.0 38 535.0 39 804.0 40 696.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.52261306532664 11.080402010050252 13.015075376884422 41.381909547738694 2 28.625 11.700000000000001 29.575000000000003 30.099999999999998 3 27.875 15.9 22.475 33.75 4 31.825 18.825 18.95 30.4 5 31.05 22.95 21.475 24.525 6 27.175 26.900000000000002 22.8 23.125 7 18.075 27.500000000000004 32.6 21.825 8 20.65 23.150000000000002 29.299999999999997 26.900000000000002 9 23.95 19.35 30.4 26.3 10-11 24.1375 28.275 22.900000000000002 24.6875 12-13 25.7125 22.85 24.099999999999998 27.3375 14-15 23.875 24.6125 24.1625 27.35 16-17 25.525 23.275000000000002 23.375 27.825 18-19 24.55 24.15 24.7 26.6 20-21 25.324999999999996 23.962500000000002 24.7875 25.924999999999997 22-23 24.462500000000002 24.975 23.5375 27.025 24-25 23.658872077028885 23.733900212579716 25.159434788045516 27.447792922345883 26-27 25.2875 23.575 23.225 27.9125 28-29 25.3125 23.3 24.1125 27.275 30-31 24.5125 23.75 25.0125 26.724999999999998 32-33 25.087500000000002 24.0 24.2875 26.625 34-35 25.174999999999997 23.175 24.6 27.05 36-37 24.5 23.25 24.7 27.55 38-39 25.1 24.925 24.6875 25.2875 40-41 25.775 24.175 23.5 26.55 42-43 24.6875 24.25 24.462500000000002 26.6 44-45 25.137500000000003 23.525 24.525 26.8125 46-47 25.025 23.6375 24.099999999999998 27.237499999999997 48-49 24.53019293410173 24.392382861438236 24.191931846654974 26.885492357805063 50-51 24.875 23.6875 24.5625 26.875 52-53 24.875 23.3375 23.1375 28.65 54-55 26.5125 23.599999999999998 23.65 26.237500000000004 56-57 25.025 22.95 24.575 27.450000000000003 58-59 25.965745718214777 22.62782847855982 23.92799099887486 27.47843480435054 60-61 24.85 23.7125 24.725 26.7125 62-63 25.124999999999996 23.674999999999997 23.849999999999998 27.35 64-65 25.8625 23.125 24.3125 26.700000000000003 66-67 25.0 24.337500000000002 24.075 26.5875 68-69 25.0 24.5 23.474999999999998 27.025 70-71 25.5625 24.325 23.375 26.737499999999997 72-73 25.087500000000002 24.575 23.65 26.687499999999996 74-75 25.856658717208486 24.63913643780595 23.471821262708673 26.032383582276893 76-77 25.387500000000003 25.025 23.025000000000002 26.5625 78-79 25.605927414291095 24.425467788521914 23.82267989451212 26.14592490267487 80-81 24.45 24.8125 23.599999999999998 27.1375 82-83 24.8625 24.6875 23.175 27.275 84-85 25.15 25.6 23.4375 25.8125 86-87 24.3125 24.6125 24.1375 26.937499999999996 88-89 25.724999999999998 24.825 22.7125 26.737499999999997 90-91 25.1 25.162499999999998 23.599999999999998 26.137500000000003 92-93 24.8625 24.575 23.6625 26.900000000000002 94-95 25.275 25.3 22.75 26.674999999999997 96-97 25.15 24.099999999999998 23.2625 27.487499999999997 98-99 25.4625 24.1125 23.974999999999998 26.450000000000003 100 25.45 25.05 23.35 26.150000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 1.5 26 1.5 27 2.0 28 3.0 29 4.0 30 6.0 31 9.0 32 15.0 33 18.0 34 28.0 35 40.0 36 42.5 37 57.5 38 70.5 39 82.0 40 113.0 41 140.0 42 135.0 43 146.5 44 168.0 45 167.5 46 166.5 47 163.5 48 155.5 49 147.5 50 147.0 51 131.0 52 114.5 53 105.5 54 93.0 55 80.0 56 77.0 57 78.0 58 68.5 59 75.0 60 81.0 61 74.5 62 68.0 63 66.0 64 75.0 65 75.0 66 69.5 67 64.5 68 67.0 69 71.0 70 65.5 71 56.0 72 48.0 73 45.5 74 43.0 75 35.0 76 25.0 77 25.5 78 25.5 79 17.5 80 10.0 81 10.0 82 9.0 83 5.5 84 5.5 85 3.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0375 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.22499999999999998 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0125 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.41250000000000003 76-77 0.0 78-79 0.46249999999999997 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.87295081967213 96.5 2 0.9733606557377049 1.9 3 0.10245901639344263 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05122950819672131 1.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCTAAGATCTCGTAT 42 1.05 TruSeq Adapter, Index 18 (97% over 37bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCTAAGATCTCGTA 10 0.25 TruSeq Adapter, Index 18 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.25 0.0 0.0 0.0 0.0 2 0.25 0.0 0.0 0.0 0.0 3 0.25 0.0 0.0 0.0 0.0 4 0.25 0.0 0.0 0.0 0.0 5 0.25 0.0 0.0 0.0 0.0 6 0.25 0.0 0.0 0.0 0.0 7 0.25 0.0 0.0 0.0 0.0 8 0.25 0.0 0.0 0.0 0.0 9 0.25 0.0 0.0 0.0 0.0 10-11 0.25 0.0 0.0 0.0 0.0 12-13 0.25 0.0 0.0 0.0 0.0 14-15 0.25 0.0 0.0 0.0 0.0 16-17 0.25 0.0 0.0 0.0 0.0 18-19 0.25 0.0 0.0 0.0 0.0 20-21 0.25 0.0 0.0 0.0 0.0 22-23 0.25 0.0 0.0 0.0 0.0 24-25 0.25 0.0 0.0 0.0 0.0 26-27 0.25 0.0 0.0 0.0 0.0 28-29 0.25 0.0 0.0 0.0 0.0 30-31 0.25 0.0 0.0 0.0 0.0 32-33 0.25 0.0 0.0 0.0 0.0 34-35 0.25 0.0 0.0 0.0 0.0 36-37 0.25 0.0 0.0 0.0 0.0 38-39 0.25 0.0 0.0 0.0 0.0 40-41 0.25 0.0 0.0 0.0 0.0 42-43 0.25 0.0 0.0 0.0 0.0 44-45 0.25 0.0 0.0 0.0 0.0 46-47 0.275 0.0 0.0 0.0 0.0 48-49 0.275 0.0 0.0 0.0 0.0 50-51 0.275 0.0 0.0 0.0 0.0 52-53 0.2875 0.0 0.0 0.0 0.0 54-55 0.3 0.0 0.0 0.0 0.0 56-57 0.3 0.0 0.0 0.0 0.0 58-59 0.325 0.0 0.0 0.0 0.0 60-61 0.3375 0.0 0.0 0.0 0.0 62-63 0.3625 0.0 0.0 0.0 0.0 64-65 0.375 0.0 0.0 0.0 0.0 66-67 0.3875 0.0 0.0 0.0 0.0 68-69 0.42500000000000004 0.0 0.0 0.0 0.0 70-71 0.48750000000000004 0.0 0.0 0.0 0.0 72-73 0.55 0.0 0.0 0.0 0.0 74-75 0.5625 0.0 0.0 0.0 0.0 76-77 0.6499999999999999 0.0 0.0 0.0 0.0 78-79 0.8125 0.0 0.0 0.0 0.0 80-81 1.0499999999999998 0.0 0.0 0.0 0.0 82-83 1.1625 0.0 0.0 0.0 0.0 84-85 1.3624999999999998 0.0 0.0 0.0 0.0 86-87 1.5 0.0 0.0 0.0 0.0 88 1.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCGT 20 5.3435756E-4 47.0 42-43 TGCCGTC 20 5.3435756E-4 47.0 50-51 CCAGTCA 20 5.3435756E-4 47.0 26-27 CCTAAGA 20 5.3435756E-4 47.0 36-37 TATGCCG 20 5.3435756E-4 47.0 48-49 TAAGATC 20 5.3435756E-4 47.0 38-39 CCGTCTT 20 5.3435756E-4 47.0 52-53 TCACGTC 20 5.3435756E-4 47.0 30-31 TGCTTGA 20 5.3435756E-4 47.0 60-61 CGTATGC 20 5.3435756E-4 47.0 46-47 TCTGAAC 20 5.3435756E-4 47.0 18-19 TGAACTC 20 5.3435756E-4 47.0 20-21 CTTGAAA 20 5.3435756E-4 47.0 62-63 AGATCTC 20 5.3435756E-4 47.0 40-41 AGTCACG 20 5.3435756E-4 47.0 28-29 CTCGTAT 20 5.3435756E-4 47.0 44-45 CGTCTGA 20 5.3435756E-4 47.0 16-17 ACGTCCT 25 0.0016030063 37.600002 32-33 CACGTCT 25 0.0016030063 37.600002 14-15 CTCCAGT 25 0.0016030063 37.600002 24-25 >>END_MODULE SRR11668426 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668426_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.40375 32.0 32.0 32.0 27.0 32.0 2 30.905 32.0 32.0 32.0 32.0 32.0 3 32.735 37.0 32.0 37.0 22.0 37.0 4 33.4425 37.0 32.0 37.0 22.0 37.0 5 34.38125 37.0 37.0 37.0 27.0 37.0 6 37.462 41.0 37.0 41.0 32.0 41.0 7 37.4585 41.0 37.0 41.0 27.0 41.0 8 37.24775 41.0 37.0 41.0 27.0 41.0 9 36.7275 41.0 37.0 41.0 27.0 41.0 10-11 36.47525 41.0 37.0 41.0 24.5 41.0 12-13 35.895375 41.0 37.0 41.0 22.0 41.0 14-15 35.7675 41.0 37.0 41.0 22.0 41.0 16-17 35.448750000000004 41.0 34.5 41.0 17.0 41.0 18-19 35.501374999999996 41.0 32.0 41.0 22.0 41.0 20-21 35.764125 41.0 34.5 41.0 22.0 41.0 22-23 35.8815 41.0 37.0 41.0 22.0 41.0 24-25 36.31575 41.0 37.0 41.0 22.0 41.0 26-27 35.94175 41.0 34.5 41.0 22.0 41.0 28-29 36.283 41.0 37.0 41.0 22.0 41.0 30-31 35.942375 41.0 34.5 41.0 22.0 41.0 32-33 36.18275 41.0 37.0 41.0 22.0 41.0 34-35 35.90075 41.0 34.5 41.0 22.0 41.0 36-37 36.151624999999996 41.0 34.5 41.0 22.0 41.0 38-39 35.92775 41.0 34.5 41.0 22.0 41.0 40-41 35.668625000000006 41.0 32.0 41.0 22.0 41.0 42-43 35.699875 41.0 34.5 41.0 22.0 41.0 44-45 35.723 41.0 34.5 41.0 22.0 41.0 46-47 35.84075 41.0 34.5 41.0 22.0 41.0 48-49 35.27825 41.0 32.0 41.0 17.0 41.0 50-51 35.39275 41.0 32.0 41.0 22.0 41.0 52-53 35.557375 41.0 32.0 41.0 22.0 41.0 54-55 35.4675 41.0 32.0 41.0 22.0 41.0 56-57 35.18375 41.0 32.0 41.0 22.0 41.0 58-59 34.439 41.0 32.0 41.0 12.0 41.0 60-61 34.5505 39.0 32.0 41.0 17.0 41.0 62-63 34.453875 39.0 32.0 41.0 17.0 41.0 64-65 34.7935 41.0 32.0 41.0 22.0 41.0 66-67 34.32725 41.0 32.0 41.0 12.0 41.0 68-69 34.005624999999995 39.0 32.0 41.0 12.0 41.0 70-71 34.45525 39.0 32.0 41.0 17.0 41.0 72-73 33.443625 37.0 27.0 41.0 12.0 41.0 74-75 33.96025 37.0 29.5 41.0 12.0 41.0 76-77 33.680875 39.0 29.5 41.0 17.0 41.0 78-79 34.3595 37.0 32.0 41.0 22.0 41.0 80-81 35.0985 41.0 32.0 41.0 22.0 41.0 82-83 34.294875000000005 41.0 32.0 41.0 12.0 41.0 84-85 34.44475 39.0 32.0 41.0 17.0 41.0 86-87 34.619625 41.0 32.0 41.0 17.0 41.0 88-89 33.81625 39.0 32.0 41.0 12.0 41.0 90-91 33.15975 37.0 27.0 41.0 12.0 41.0 92-93 33.822 37.0 32.0 41.0 12.0 41.0 94-95 33.287625 37.0 27.0 41.0 12.0 41.0 96-97 33.435500000000005 37.0 27.0 41.0 12.0 41.0 98-99 33.7765 37.0 29.5 41.0 12.0 41.0 100 31.158 37.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 9.0 17 15.0 18 17.0 19 25.0 20 41.0 21 52.0 22 45.0 23 40.0 24 73.0 25 66.0 26 82.0 27 93.0 28 96.0 29 105.0 30 118.0 31 136.0 32 126.0 33 169.0 34 201.0 35 215.0 36 286.0 37 355.0 38 447.0 39 642.0 40 545.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.83383383383383 18.493493493493492 11.411411411411411 36.26126126126126 2 28.414207103551774 26.688344172086044 24.23711855927964 20.66033016508254 3 24.025 27.025 24.825 24.125 4 27.775 28.349999999999998 19.45 24.425 5 29.925 30.475 18.625 20.974999999999998 6 24.3 34.4 19.225 22.075 7 24.875 17.849999999999998 33.275 24.0 8 24.349999999999998 22.2 24.025 29.425 9 25.575 21.025 25.25 28.15 10-11 26.8 28.9125 19.325 24.962500000000002 12-13 27.575 21.175 22.3875 28.8625 14-15 25.9875 24.9125 24.15 24.95 16-17 27.3375 23.925 22.7 26.0375 18-19 26.650000000000002 24.125 23.5125 25.7125 20-21 26.3 25.2375 22.575 25.887500000000003 22-23 27.2625 23.962500000000002 22.525000000000002 26.25 24-25 26.25 25.124999999999996 21.975 26.650000000000002 26-27 27.0625 25.137500000000003 22.0 25.8 28-29 26.75 24.4125 23.1625 25.674999999999997 30-31 26.85 24.15 22.8625 26.137500000000003 32-33 26.887499999999996 24.587500000000002 23.5125 25.0125 34-35 26.987499999999997 24.6875 22.6125 25.7125 36-37 26.125 25.4 22.725 25.75 38-39 26.6 24.349999999999998 22.1375 26.9125 40-41 26.950000000000003 23.875 23.1375 26.0375 42-43 26.8375 24.0125 23.325000000000003 25.825 44-45 26.875 24.45 22.425 26.25 46-47 26.825 24.3 21.9375 26.937499999999996 48-49 26.0625 23.7 23.6125 26.625 50-51 26.761797471523348 24.170734760295407 22.13042934034297 26.937038427838278 52-53 27.4125 23.9375 22.975 25.674999999999997 54-55 26.8375 23.2125 23.7125 26.237500000000004 56-57 27.625 23.95 22.787499999999998 25.637500000000003 58-59 27.05 24.762500000000003 21.912499999999998 26.275 60-61 26.578322290286287 23.44043005375672 22.99037379672459 26.990873859232405 62-63 27.9375 24.3 22.8875 24.875 64-65 26.36591478696742 24.724310776942357 22.69423558897243 26.21553884711779 66-67 27.4125 24.3 23.400000000000002 24.887500000000003 68-69 26.525 24.224999999999998 23.4625 25.7875 70-71 27.175 24.587500000000002 21.925 26.3125 72-73 25.5 25.5625 23.425 25.5125 74-75 25.937500000000004 24.7875 23.3375 25.937500000000004 76-77 26.1625 25.387500000000003 22.75 25.7 78-79 26.1625 24.962500000000002 23.425 25.45 80-81 27.187499999999996 25.412499999999998 22.75 24.65 82-83 26.487500000000004 25.35 22.900000000000002 25.2625 84-85 27.0875 25.387500000000003 21.775 25.75 86-87 27.675 25.5375 22.400000000000002 24.3875 88-89 27.425 24.7 22.7125 25.162499999999998 90-91 26.891282565130258 25.651302605210418 21.693386773547093 25.764028056112227 92-93 26.9625 24.962500000000002 22.6375 25.4375 94-95 27.1 24.675 23.3625 24.8625 96-97 27.0 25.074999999999996 22.15 25.775 98-99 27.187499999999996 26.325 22.7375 23.75 100 26.174999999999997 26.674999999999997 22.275 24.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 1.0 22 1.0 23 1.5 24 2.0 25 3.0 26 3.0 27 3.5 28 5.0 29 9.5 30 11.0 31 9.0 32 9.0 33 14.0 34 23.5 35 31.5 36 43.0 37 56.0 38 73.0 39 84.0 40 102.0 41 139.0 42 154.0 43 152.0 44 150.5 45 143.5 46 146.0 47 155.0 48 152.5 49 135.5 50 119.5 51 118.0 52 114.5 53 102.5 54 87.5 55 88.5 56 92.0 57 84.5 58 84.5 59 79.5 60 86.5 61 92.5 62 75.0 63 76.0 64 80.0 65 73.5 66 70.0 67 64.5 68 62.5 69 71.5 70 74.5 71 66.0 72 49.0 73 42.5 74 48.0 75 40.0 76 33.0 77 28.5 78 20.0 79 14.0 80 12.0 81 9.0 82 4.5 83 4.5 84 5.0 85 2.0 86 1.5 87 1.0 88 1.0 89 0.5 90 0.5 91 1.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.13749999999999998 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0125 62-63 0.0 64-65 0.25 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.2 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13198876691347 97.075 2 0.791422006637733 1.55 3 0.025529742149604292 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051059484299208584 1.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTGGTAGCTGTGTAGATCT 42 1.05 Illumina Single End PCR Primer 1 (97% over 34bp) AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTGGTAGCTGTGTAGATC 10 0.25 Illumina Single End PCR Primer 1 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.25 0.0 0.0 0.0 0.0 2 0.25 0.0 0.0 0.0 0.0 3 0.25 0.0 0.0 0.0 0.0 4 0.25 0.0 0.0 0.0 0.0 5 0.25 0.0 0.0 0.0 0.0 6 0.25 0.0 0.0 0.0 0.0 7 0.25 0.0 0.0 0.0 0.0 8 0.25 0.0 0.0 0.0 0.0 9 0.25 0.0 0.0 0.0 0.0 10-11 0.25 0.0 0.0 0.0 0.0 12-13 0.25 0.0 0.0 0.0 0.0 14-15 0.25 0.0 0.0 0.0 0.0 16-17 0.25 0.0 0.0 0.0 0.0 18-19 0.25 0.0 0.0 0.0 0.0 20-21 0.25 0.0 0.0 0.0 0.0 22-23 0.25 0.0 0.0 0.0 0.0 24-25 0.25 0.0 0.0 0.0 0.0 26-27 0.25 0.0 0.0 0.0 0.0 28-29 0.25 0.0 0.0 0.0 0.0 30-31 0.25 0.0 0.0 0.0 0.0 32-33 0.25 0.0 0.0 0.0 0.0 34-35 0.25 0.0 0.0 0.0 0.0 36-37 0.25 0.0 0.0 0.0 0.0 38-39 0.25 0.0 0.0 0.0 0.0 40-41 0.25 0.0 0.0 0.0 0.0 42-43 0.25 0.0 0.0 0.0 0.0 44-45 0.25 0.0 0.0 0.0 0.0 46-47 0.275 0.0 0.0 0.0 0.0 48-49 0.275 0.0 0.0 0.0 0.0 50-51 0.275 0.0 0.0 0.0 0.0 52-53 0.2875 0.0 0.0 0.0 0.0 54-55 0.3 0.0 0.0 0.0 0.0 56-57 0.3 0.0 0.0 0.0 0.0 58-59 0.325 0.0 0.0 0.0 0.0 60-61 0.3375 0.0 0.0 0.0 0.0 62-63 0.3625 0.0 0.0 0.0 0.0 64-65 0.375 0.0 0.0 0.0 0.0 66-67 0.3875 0.0 0.0 0.0 0.0 68-69 0.42500000000000004 0.0 0.0 0.0 0.0 70-71 0.5249999999999999 0.0 0.0 0.0 0.0 72-73 0.6 0.0 0.0 0.0 0.0 74-75 0.6125 0.0 0.0 0.0 0.0 76-77 0.7 0.0 0.0 0.0 0.0 78-79 0.8625 0.0 0.0 0.0 0.0 80-81 1.0875 0.0 0.0 0.0 0.0 82-83 1.1875 0.0 0.0 0.0 0.0 84-85 1.4 0.0 0.0 0.0 0.0 86-87 1.55 0.0 0.0 0.0 0.0 88 1.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTAAA 25 2.748136E-5 47.000004 66-67 TGTTGGT 20 5.3435756E-4 47.0 30-31 TGGTCGC 20 5.3435756E-4 47.0 54-55 GTGTAGG 20 5.3435756E-4 47.0 16-17 TAGCTGT 20 5.3435756E-4 47.0 36-37 AGGGAAA 20 5.3435756E-4 47.0 20-21 TCTCGGT 20 5.3435756E-4 47.0 48-49 GCTGTGT 20 5.3435756E-4 47.0 38-39 TGTAGAT 20 5.3435756E-4 47.0 42-43 GGTAGCT 20 5.3435756E-4 47.0 34-35 ATCATTA 20 5.3435756E-4 47.0 64-65 GGTGGTC 20 5.3435756E-4 47.0 52-53 GTAGGGA 20 5.3435756E-4 47.0 18-19 TTGGTAG 20 5.3435756E-4 47.0 32-33 TAGATCT 20 5.3435756E-4 47.0 44-45 TGTGTAG 20 5.3435756E-4 47.0 40-41 TTAAAAA 20 5.3435756E-4 47.0 68-69 GTCGCCG 25 0.0016030063 37.600002 56-57 TCGGTGG 25 0.0016030063 37.600002 50-51 GTATCAT 25 0.0016030063 37.600002 62-63 >>END_MODULE Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682117 spots for SRR11668426.sra Written 1682117 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra Read 1682111 spots for SRR11668426.sra Written 1682111 spots for SRR11668426.sra SRR ids: ['SRR11668426.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ahx2hjer SRR11668426.sra spots: 33642226 blocks: [[1, 1682111], [1682112, 3364222], [3364223, 5046333], [5046334, 6728444], [6728445, 8410555], [8410556, 10092666], [10092667, 11774777], [11774778, 13456888], [13456889, 15138999], [15139000, 16821110], [16821111, 18503221], [18503222, 20185332], [20185333, 21867443], [21867444, 23549554], [23549555, 25231665], [25231666, 26913776], [26913777, 28595887], [28595888, 30277998], [30277999, 31960109], [31960110, 33642226]] SRR11668426 file size 8060318 SRR11668426 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11668426 SRR11668426_1.fastq SRR11668426_2.fastq Input file: SRR11668426_1.fastq Paired file: SRR11668426_2.fastq trimmed: SRR11668426-trimmed-pair1.fastq, SRR11668426-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:35:56 2024 >> started Fri Dec 6 10:36:29 2024 >> done (33.083s) 33642226 read pairs processed; of these: 2380 ( 0.01%) short read pairs filtered out after trimming by size control 414628 ( 1.23%) empty read pairs filtered out after trimming by size control 33225218 (98.76%) read pairs available; of these: 2569274 ( 7.73%) trimmed read pairs available after processing 30655944 (92.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 63 0.00% 19 65 0.00% 20 48 0.00% 21 64 0.00% 22 81 0.00% 23 77 0.00% 24 65 0.00% 25 116 0.00% 26 109 0.00% 27 125 0.00% 28 132 0.00% 29 179 0.00% 30 174 0.00% 31 219 0.00% 32 226 0.00% 33 228 0.00% 34 247 0.00% 35 287 0.00% 36 259 0.00% 37 352 0.00% 38 352 0.00% 39 433 0.00% 40 502 0.00% 41 533 0.00% 42 597 0.00% 43 653 0.00% 44 607 0.00% 45 609 0.00% 46 691 0.00% 47 794 0.00% 48 831 0.00% 49 1071 0.00% 50 1234 0.00% 51 1345 0.00% 52 1532 0.00% 53 1578 0.00% 54 1649 0.00% 55 1821 0.01% 56 1937 0.01% 57 2129 0.01% 58 2460 0.01% 59 2899 0.01% 60 3305 0.01% 61 3547 0.01% 62 4003 0.01% 63 4504 0.01% 64 4769 0.01% 65 5239 0.02% 66 5713 0.02% 67 6736 0.02% 68 6946 0.02% 69 7565 0.02% 70 8544 0.03% 71 9586 0.03% 72 10580 0.03% 73 11913 0.04% 74 13308 0.04% 75 14766 0.04% 76 16193 0.05% 77 17873 0.05% 78 18909 0.06% 79 21120 0.06% 80 22837 0.07% 81 25217 0.08% 82 27742 0.08% 83 30682 0.09% 84 34267 0.10% 85 37251 0.11% 86 40917 0.12% 87 44239 0.13% 88 48110 0.14% 89 50229 0.15% 90 54242 0.16% 91 58364 0.18% 92 62631 0.19% 93 67178 0.20% 94 73219 0.22% 95 79223 0.24% 96 85256 0.26% 97 95450 0.29% 98 165121 0.50% 99 1242607 3.74% 100 30655944 92.27% 33225218 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=21 prefix-density=0.35 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=330.50 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=24.3 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=5.16 fanout-score-rank=11 prefix-density=0.39 prefix-fanout=3.8 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=239.48 fanout-score-rank=1 prefix-density=1.22 prefix-fanout=23.4 sequence=GCCGCCGCCACC SRR11668426 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:37:05 Started mapping on | Dec 06 10:37:06 Finished on | Dec 06 10:38:52 Mapping speed, Million of reads per hour | 1128.40 Number of input reads | 33225218 Average input read length | 198 UNIQUE READS: Uniquely mapped reads number | 31725001 Uniquely mapped reads % | 95.48% Average mapped length | 197.91 Number of splices: Total | 18785493 Number of splices: Annotated (sjdb) | 17807135 Number of splices: GT/AG | 18538856 Number of splices: GC/AG | 207966 Number of splices: AT/AC | 9711 Number of splices: Non-canonical | 28960 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.01% Deletion average length | 1.92 Insertion rate per base | 0.01% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 781251 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 23626 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.69% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 718966 718966 718966 N_multimapping 781251 781251 781251 N_noFeature 896053 30888316 1213570 N_ambiguous 625597 4190 113258 UnstrandedReadsAssigned:30203351 PositiveStrandReadsAssigned:832495 NegativeStrandReadsAssigned:30398173 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR11668426 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11668426-trimmed-pair1.fastq SRR11668426-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,225,218 reads, 31,252,316 reads pseudoaligned [quant] estimated average fragment length: 197.25 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52973 SRR11668426.ke.tsv 35125 SRR11668426.se.tsv 88098 total ==> SRR11668426.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 739.961 0 0 PNS24247 1044 847.75 40.1963 2.17439 PNS24249 1928 1731.75 190.617 5.04771 PNS24246 1044 847.75 40.1963 2.17439 PNS24248 1044 847.75 40.1963 2.17439 PNS24244 1471 1274.75 67.794 2.43885 PNS24243 293 121.554 0 0 KQK14069 1603 1406.75 4551 148.357 KQK14071 474 281.993 93.7 15.2377 ==> SRR11668426.se.tsv <== BRADI_1g14170v3 4684 BRADI_1g53295v3 8 BRADI_1g59795v3 130 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 2144 BRADI_1g74790v3 509 BRADI_1g09890v3 13 BRADI_1g77505v3 331 BRADI_1g48960v3 0 SRR11668426 completed mapping pipeline successfully