Starting /dee2/code/volunteer_pipeline.sh SRR11668427 current disk space = 1544146235392 free memory = 1604102308 SRR11668427 SRAfilesize c0af04e79a97788094924f404914925c SRR11668427.sra SRR11668427.sra file validated SRR11668427 is paired end SRR11668427 is conventional basespace SRR11668427 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668427_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.08625 32.0 32.0 32.0 32.0 32.0 2 31.4525 32.0 32.0 32.0 32.0 32.0 3 34.545 37.0 32.0 37.0 32.0 37.0 4 35.385 37.0 37.0 37.0 32.0 37.0 5 36.08125 37.0 37.0 37.0 37.0 37.0 6 38.96125 41.0 41.0 41.0 37.0 41.0 7 39.55675 41.0 41.0 41.0 37.0 41.0 8 39.65025 41.0 41.0 41.0 37.0 41.0 9 39.75975 41.0 41.0 41.0 37.0 41.0 10-11 39.867625000000004 41.0 41.0 41.0 37.0 41.0 12-13 39.424375 41.0 41.0 41.0 37.0 41.0 14-15 39.488375 41.0 41.0 41.0 37.0 41.0 16-17 39.527875 41.0 41.0 41.0 37.0 41.0 18-19 39.585499999999996 41.0 41.0 41.0 37.0 41.0 20-21 39.7915 41.0 41.0 41.0 37.0 41.0 22-23 39.737875 41.0 41.0 41.0 37.0 41.0 24-25 39.567875 41.0 41.0 41.0 37.0 41.0 26-27 39.35875 41.0 41.0 41.0 37.0 41.0 28-29 39.361375 41.0 41.0 41.0 37.0 41.0 30-31 39.304 41.0 41.0 41.0 37.0 41.0 32-33 39.022875 41.0 41.0 41.0 37.0 41.0 34-35 39.12425 41.0 41.0 41.0 37.0 41.0 36-37 39.18825 41.0 41.0 41.0 37.0 41.0 38-39 39.116749999999996 41.0 41.0 41.0 37.0 41.0 40-41 39.101875 41.0 41.0 41.0 37.0 41.0 42-43 38.668375 41.0 39.0 41.0 32.0 41.0 44-45 38.731875 41.0 39.0 41.0 34.5 41.0 46-47 39.060249999999996 41.0 41.0 41.0 37.0 41.0 48-49 38.917625 41.0 41.0 41.0 37.0 41.0 50-51 38.88875 41.0 41.0 41.0 32.0 41.0 52-53 38.257625000000004 41.0 37.0 41.0 32.0 41.0 54-55 38.19525 41.0 37.0 41.0 32.0 41.0 56-57 38.312 41.0 37.0 41.0 32.0 41.0 58-59 38.335 41.0 37.0 41.0 32.0 41.0 60-61 38.079750000000004 41.0 37.0 41.0 32.0 41.0 62-63 37.6905 41.0 37.0 41.0 29.5 41.0 64-65 37.920875 41.0 37.0 41.0 32.0 41.0 66-67 38.048249999999996 41.0 37.0 41.0 32.0 41.0 68-69 37.788624999999996 41.0 37.0 41.0 29.5 41.0 70-71 37.645875000000004 41.0 37.0 41.0 27.0 41.0 72-73 37.5715 41.0 37.0 41.0 27.0 41.0 74-75 37.137875 41.0 37.0 41.0 27.0 41.0 76-77 36.452124999999995 39.0 34.5 41.0 27.0 41.0 78-79 36.633125 41.0 37.0 41.0 24.5 41.0 80-81 37.332125000000005 41.0 37.0 41.0 27.0 41.0 82-83 37.26475 41.0 37.0 41.0 27.0 41.0 84-85 37.243625 41.0 37.0 41.0 27.0 41.0 86-87 37.066125 41.0 37.0 41.0 27.0 41.0 88-89 36.58025 41.0 37.0 41.0 22.0 41.0 90-91 36.446625 41.0 37.0 41.0 22.0 41.0 92-93 36.2055 41.0 37.0 41.0 22.0 41.0 94-95 36.545625 41.0 37.0 41.0 22.0 41.0 96-97 36.00375 41.0 34.5 41.0 22.0 41.0 98-99 35.741875 41.0 32.0 41.0 22.0 41.0 100 34.68325 41.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 1.0 22 6.0 23 3.0 24 4.0 25 16.0 26 16.0 27 19.0 28 29.0 29 37.0 30 48.0 31 73.0 32 84.0 33 107.0 34 157.0 35 200.0 36 214.0 37 323.0 38 476.0 39 873.0 40 1311.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.12797992471769 10.96612296110414 13.97741530740276 40.92848180677541 2 29.725 12.675 28.749999999999996 28.849999999999998 3 25.900000000000002 17.1 21.925 35.075 4 31.7 19.125 18.0 31.175000000000004 5 31.724999999999998 23.1 20.849999999999998 24.325 6 27.125 26.825 22.275 23.775 7 18.35 27.125 33.550000000000004 20.974999999999998 8 18.9 25.624999999999996 28.325 27.150000000000002 9 24.23105776444111 20.355088772193046 29.80745186296574 25.6064016004001 10-11 25.637500000000003 27.8125 22.475 24.075 12-13 24.675 22.9375 24.2375 28.15 14-15 24.2 25.55 24.837500000000002 25.412499999999998 16-17 25.724999999999998 23.2625 23.3125 27.700000000000003 18-19 24.025 23.599999999999998 24.224999999999998 28.15 20-21 25.6125 23.35 24.775 26.2625 22-23 24.3625 25.7125 24.2875 25.637500000000003 24-25 23.47793474184273 24.615576947118388 24.715589448681087 27.19089886235779 26-27 24.6625 22.9625 23.925 28.449999999999996 28-29 25.2625 24.212500000000002 23.825 26.700000000000003 30-31 25.2375 23.1 24.65 27.0125 32-33 24.587500000000002 24.625 23.175 27.6125 34-35 24.5 23.400000000000002 24.7 27.400000000000002 36-37 24.05 24.6 23.724999999999998 27.625 38-39 25.874999999999996 24.9125 23.3125 25.900000000000002 40-41 26.237500000000004 24.4875 23.1125 26.1625 42-43 24.5625 24.425 24.75 26.2625 44-45 25.650000000000002 23.3625 24.0375 26.950000000000003 46-47 26.150000000000002 22.6375 23.175 28.037499999999998 48-49 24.784078107397672 23.82025284766554 25.397421454499934 25.99824759043685 50-51 26.0625 23.1125 25.074999999999996 25.75 52-53 25.412499999999998 23.925 23.2375 27.425 54-55 26.875 23.425 23.8875 25.8125 56-57 25.0625 23.9 23.8625 27.175 58-59 24.990623827978496 23.47793474184273 24.14051756469559 27.390923865483185 60-61 25.8125 22.8625 24.099999999999998 27.224999999999998 62-63 25.6125 23.474999999999998 23.849999999999998 27.0625 64-65 26.3625 23.3375 23.549999999999997 26.75 66-67 25.174999999999997 24.9 23.474999999999998 26.450000000000003 68-69 25.912499999999998 25.025 22.9375 26.125 70-71 25.974999999999998 25.5125 22.625 25.887500000000003 72-73 24.962500000000002 24.775 23.2375 27.025 74-75 25.153528011028953 25.529514976814138 22.571750845970673 26.745206166186236 76-77 25.15 25.85 22.6 26.400000000000002 78-79 24.27622509086352 25.466850482516605 22.847474620879808 27.409449805740067 80-81 25.2375 25.162499999999998 23.0375 26.5625 82-83 26.55 24.85 22.400000000000002 26.200000000000003 84-85 25.2125 25.474999999999998 21.987499999999997 27.325 86-87 26.0625 24.925 23.075000000000003 25.937500000000004 88-89 24.925 25.0375 23.5375 26.5 90-91 25.112499999999997 25.124999999999996 22.2625 27.500000000000004 92-93 25.374999999999996 25.4625 23.2625 25.900000000000002 94-95 25.887500000000003 24.837500000000002 22.912499999999998 26.3625 96-97 25.8625 24.474999999999998 22.3875 27.275 98-99 26.137500000000003 25.074999999999996 22.400000000000002 26.387500000000003 100 25.900000000000002 24.075 22.2 27.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.5 28 3.5 29 4.5 30 3.0 31 7.0 32 13.5 33 17.0 34 35.0 35 45.0 36 51.0 37 62.0 38 69.5 39 87.0 40 95.0 41 113.5 42 143.5 43 155.0 44 165.0 45 172.0 46 170.5 47 150.5 48 140.5 49 151.0 50 144.5 51 130.5 52 115.0 53 94.5 54 88.5 55 94.5 56 88.5 57 77.0 58 74.0 59 88.0 60 93.5 61 81.5 62 75.0 63 69.0 64 66.5 65 74.0 66 70.0 67 65.0 68 59.0 69 53.5 70 54.0 71 52.5 72 50.0 73 44.5 74 44.0 75 44.5 76 37.0 77 28.5 78 25.0 79 18.5 80 9.5 81 7.5 82 6.0 83 5.0 84 4.0 85 2.0 86 3.0 87 1.5 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.13749999999999998 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0125 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.2625 76-77 0.0 78-79 0.2625 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.50129198966408 95.3 2 1.3953488372093024 2.7 3 0.05167958656330749 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025839793281653745 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025839793281653745 1.675 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTCAGAAGATCTCGTAT 67 1.675 TruSeq Adapter, Index 1 (97% over 37bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTCAGAAGATCTCGTA 7 0.17500000000000002 TruSeq Adapter, Index 1 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.175 0.0 0.0 0.0 0.0 2 0.175 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10-11 0.175 0.0 0.0 0.0 0.0 12-13 0.175 0.0 0.0 0.0 0.0 14-15 0.175 0.0 0.0 0.0 0.0 16-17 0.175 0.0 0.0 0.0 0.0 18-19 0.175 0.0 0.0 0.0 0.0 20-21 0.175 0.0 0.0 0.0 0.0 22-23 0.175 0.0 0.0 0.0 0.0 24-25 0.175 0.0 0.0 0.0 0.0 26-27 0.175 0.0 0.0 0.0 0.0 28-29 0.175 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.175 0.0 0.0 0.0 0.0 34-35 0.175 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.2 0.0 0.0 0.0 0.0 40-41 0.2 0.0 0.0 0.0 0.0 42-43 0.2 0.0 0.0 0.0 0.0 44-45 0.2 0.0 0.0 0.0 0.0 46-47 0.2 0.0 0.0 0.0 0.0 48-49 0.21250000000000002 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.2375 0.0 0.0 0.0 0.0 54-55 0.25 0.0 0.0 0.0 0.0 56-57 0.25 0.0 0.0 0.0 0.0 58-59 0.2625 0.0 0.0 0.0 0.0 60-61 0.30000000000000004 0.0 0.0 0.0 0.0 62-63 0.325 0.0 0.0 0.0 0.0 64-65 0.375 0.0 0.0 0.0 0.0 66-67 0.375 0.0 0.0 0.0 0.0 68-69 0.4125 0.0 0.0 0.0 0.0 70-71 0.4375 0.0 0.0 0.0 0.0 72-73 0.5375 0.0 0.0 0.0 0.0 74-75 0.65 0.0 0.0 0.0 0.0 76-77 0.8 0.0 0.0 0.0 0.0 78-79 0.8999999999999999 0.0 0.0 0.0 0.0 80-81 0.975 0.0 0.0 0.0 0.0 82-83 1.0875 0.0 0.0 0.0 0.0 84-85 1.3875000000000002 0.0 0.0 0.0 0.0 86-87 1.5875 0.0 0.0 0.0 0.0 88 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGC 25 0.004866334 56.392498 6 TCGGAAG 25 0.004866334 56.392498 3 GAGCACA 25 0.004866334 56.392498 9 AGAGCAC 25 0.004866334 56.392498 8 ATCGGAA 25 0.004866334 56.392498 2 >>END_MODULE SRR11668427 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668427_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.90375 32.0 32.0 32.0 32.0 32.0 2 30.86125 32.0 32.0 32.0 32.0 32.0 3 33.44875 37.0 32.0 37.0 22.0 37.0 4 34.18625 37.0 32.0 37.0 27.0 37.0 5 34.86375 37.0 37.0 37.0 32.0 37.0 6 38.0935 41.0 37.0 41.0 32.0 41.0 7 38.20275 41.0 37.0 41.0 32.0 41.0 8 38.12875 41.0 37.0 41.0 32.0 41.0 9 37.837 41.0 37.0 41.0 27.0 41.0 10-11 37.767375 41.0 37.0 41.0 29.5 41.0 12-13 37.75425 41.0 37.0 41.0 27.0 41.0 14-15 37.612125 41.0 37.0 41.0 27.0 41.0 16-17 37.656875 41.0 37.0 41.0 27.0 41.0 18-19 37.59125 41.0 37.0 41.0 27.0 41.0 20-21 37.58625 41.0 37.0 41.0 27.0 41.0 22-23 37.537125 41.0 37.0 41.0 27.0 41.0 24-25 37.689625 41.0 37.0 41.0 27.0 41.0 26-27 37.299 41.0 37.0 41.0 24.5 41.0 28-29 37.43175 41.0 37.0 41.0 27.0 41.0 30-31 37.1705 41.0 37.0 41.0 27.0 41.0 32-33 37.274125 41.0 37.0 41.0 27.0 41.0 34-35 36.8215 41.0 37.0 41.0 24.5 41.0 36-37 37.093875 41.0 37.0 41.0 27.0 41.0 38-39 36.761375 41.0 37.0 41.0 27.0 41.0 40-41 36.69725 41.0 37.0 41.0 27.0 41.0 42-43 36.8395 41.0 37.0 41.0 27.0 41.0 44-45 36.680375 41.0 37.0 41.0 24.5 41.0 46-47 36.578500000000005 41.0 37.0 41.0 22.0 41.0 48-49 36.1805 41.0 37.0 41.0 22.0 41.0 50-51 36.221999999999994 41.0 37.0 41.0 22.0 41.0 52-53 36.426875 41.0 37.0 41.0 22.0 41.0 54-55 36.2745 41.0 37.0 41.0 22.0 41.0 56-57 36.165125 41.0 37.0 41.0 22.0 41.0 58-59 35.626999999999995 41.0 34.5 41.0 22.0 41.0 60-61 35.4905 41.0 32.0 41.0 22.0 41.0 62-63 35.635125 41.0 32.0 41.0 22.0 41.0 64-65 35.83775 41.0 34.5 41.0 22.0 41.0 66-67 35.498125 41.0 32.0 41.0 22.0 41.0 68-69 35.331875 41.0 32.0 41.0 22.0 41.0 70-71 35.653499999999994 41.0 32.0 41.0 22.0 41.0 72-73 34.538875000000004 41.0 32.0 41.0 12.0 41.0 74-75 34.954625 41.0 32.0 41.0 22.0 41.0 76-77 34.603875 39.0 32.0 41.0 22.0 41.0 78-79 35.198 39.0 32.0 41.0 22.0 41.0 80-81 36.046375 41.0 34.5 41.0 22.0 41.0 82-83 35.150000000000006 41.0 32.0 41.0 22.0 41.0 84-85 35.082625 41.0 32.0 41.0 22.0 41.0 86-87 35.161875 41.0 32.0 41.0 22.0 41.0 88-89 34.66275 41.0 32.0 41.0 12.0 41.0 90-91 34.125625 37.0 32.0 41.0 12.0 41.0 92-93 34.78675 39.0 32.0 41.0 22.0 41.0 94-95 34.14475 37.0 32.0 41.0 12.0 41.0 96-97 34.34 37.0 32.0 41.0 22.0 41.0 98-99 34.720875 41.0 32.0 41.0 17.0 41.0 100 32.53225 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 2.0 16 6.0 17 11.0 18 23.0 19 21.0 20 26.0 21 28.0 22 37.0 23 38.0 24 56.0 25 41.0 26 56.0 27 58.0 28 60.0 29 74.0 30 85.0 31 111.0 32 123.0 33 142.0 34 179.0 35 230.0 36 262.0 37 317.0 38 418.0 39 686.0 40 909.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.631631631631627 18.31831831831832 11.861861861861863 38.188188188188185 2 29.9 24.975 25.4 19.725 3 24.5 26.974999999999998 25.1 23.425 4 26.450000000000003 30.0 18.5 25.05 5 31.525 28.599999999999998 19.55 20.325 6 25.1 32.9 19.625 22.375 7 22.05 19.7 33.125 25.124999999999996 8 23.775 22.95 23.599999999999998 29.675 9 26.900000000000002 21.2 24.75 27.150000000000002 10-11 28.275 26.787499999999998 19.3375 25.6 12-13 27.800000000000004 21.2375 22.275 28.6875 14-15 25.7375 23.5125 24.1625 26.5875 16-17 28.249999999999996 23.1125 23.425 25.2125 18-19 26.52831603950494 22.927865983247905 24.32804100512564 26.215776972121514 20-21 27.275 24.474999999999998 22.3 25.95 22-23 28.475 23.1125 22.412499999999998 26.0 24-25 26.2625 25.174999999999997 22.3625 26.200000000000003 26-27 27.3375 24.175 22.35 26.137500000000003 28-29 27.825 23.7375 22.05 26.387500000000003 30-31 28.27853481685211 23.1278909863733 23.35291911488936 25.240655081885237 32-33 25.937500000000004 24.075 23.400000000000002 26.5875 34-35 26.5625 24.425 21.512500000000003 27.500000000000004 36-37 26.237500000000004 23.825 24.4 25.5375 38-39 26.75 23.425 22.7 27.125 40-41 26.915864483060382 22.840355044380548 22.30278784848106 27.94099262407801 42-43 27.200000000000003 23.0125 24.099999999999998 25.687500000000004 44-45 26.55 24.95 23.3125 25.1875 46-47 27.86598324790599 24.353044130516317 21.402675334416802 26.378297287160894 48-49 26.478309788723593 22.815351918989872 23.615451931491435 27.090886360795096 50-51 26.238738738738736 22.635135135135133 23.54854854854855 27.57757757757758 52-53 27.712500000000002 22.8375 23.025000000000002 26.424999999999997 54-55 27.500000000000004 23.4125 23.6625 25.424999999999997 56-57 28.3875 23.4375 22.5 25.674999999999997 58-59 28.20352544068008 23.265408176022003 21.665208151018877 26.865858232279034 60-61 26.52831603950494 23.365420677584698 21.640205025628205 28.46605825728216 62-63 27.990998874859358 23.64045505688211 22.640330041255158 25.728216027003377 64-65 26.55643241889014 23.324564699987473 23.299511461856444 26.81949141926594 66-67 26.200000000000003 24.462500000000002 21.925 27.4125 68-69 26.215776972121514 24.128016002000248 24.315539442430303 25.340667583447928 70-71 27.3625 24.825 22.5625 25.25 72-73 27.0875 25.412499999999998 21.6875 25.8125 74-75 26.490811351418923 25.465683210401302 22.740342542817853 25.30316289536192 76-77 26.865858232279034 24.678084760595073 22.615326915864483 25.84073009126141 78-79 25.753219152394045 25.340667583447928 23.165395674459308 25.740717589698715 80-81 27.800000000000004 25.5375 22.55 24.1125 82-83 27.703462932866607 25.278159769971246 21.865233154144267 25.153144143017876 84-85 27.075 25.0625 22.775000000000002 25.087500000000002 86-87 25.890736342042754 25.090636329541194 22.42780347543443 26.59082385298162 88-89 27.21590198774847 24.70308788598575 22.10276284535567 25.978247280910118 90-91 26.599073726373764 26.060833646263614 22.042808862185506 25.29728376517712 92-93 27.075 25.3125 22.787499999999998 24.825 94-95 26.981745436359088 24.3935983995999 22.493123280820203 26.131532883220803 96-97 26.86921730432608 25.29382345586397 22.893223305826456 24.943735933983497 98-99 27.6625 25.825 21.6 24.9125 100 27.556889222305575 25.681420355088775 22.53063265816454 24.23105776444111 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 0.5 24 1.0 25 2.5 26 2.0 27 2.5 28 4.0 29 5.5 30 7.0 31 6.0 32 6.5 33 15.0 34 23.0 35 27.0 36 41.5 37 68.0 38 86.0 39 97.0 40 107.0 41 114.0 42 125.0 43 145.5 44 154.5 45 153.0 46 147.0 47 142.0 48 136.0 49 124.0 50 123.5 51 120.5 52 119.5 53 107.5 54 88.5 55 91.0 56 90.5 57 83.5 58 77.0 59 71.0 60 78.5 61 88.0 62 85.5 63 86.5 64 84.5 65 69.5 66 67.5 67 77.0 68 69.5 69 70.5 70 70.0 71 56.0 72 63.5 73 66.5 74 57.0 75 45.0 76 35.0 77 27.5 78 19.5 79 13.5 80 11.0 81 11.0 82 8.5 83 5.5 84 4.5 85 4.0 86 3.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0125 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0125 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0 46-47 0.0125 48-49 0.0125 50-51 0.1 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0125 60-61 0.0125 62-63 0.0125 64-65 0.21250000000000002 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0125 76-77 0.0125 78-79 0.0125 80-81 0.0 82-83 0.0125 84-85 0.0 86-87 0.0125 88-89 0.0125 90-91 0.13749999999999998 92-93 0.0 94-95 0.025 96-97 0.025 98-99 0.0 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70834409713252 95.525 2 1.2141565486954276 2.35 3 0.025833118057349523 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025833118057349523 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.025833118057349523 1.8499999999999999 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAACTTGCCGTGTAGATCT 74 1.8499999999999999 Illumina Single End PCR Primer 1 (96% over 33bp) AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAACTTGCCGTGTAGATC 8 0.2 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.2 0.0 0.0 0.0 0.0 2 0.2 0.0 0.0 0.0 0.0 3 0.2 0.0 0.0 0.0 0.0 4 0.2 0.0 0.0 0.0 0.0 5 0.2 0.0 0.0 0.0 0.0 6 0.2 0.0 0.0 0.0 0.0 7 0.2 0.0 0.0 0.0 0.0 8 0.2 0.0 0.0 0.0 0.0 9 0.2 0.0 0.0 0.0 0.0 10-11 0.2 0.0 0.0 0.0 0.0 12-13 0.2 0.0 0.0 0.0 0.0 14-15 0.2 0.0 0.0 0.0 0.0 16-17 0.2 0.0 0.0 0.0 0.0 18-19 0.2 0.0 0.0 0.0 0.0 20-21 0.2 0.0 0.0 0.0 0.0 22-23 0.2 0.0 0.0 0.0 0.0 24-25 0.2 0.0 0.0 0.0 0.0 26-27 0.2 0.0 0.0 0.0 0.0 28-29 0.2 0.0 0.0 0.0 0.0 30-31 0.2 0.0 0.0 0.0 0.0 32-33 0.2 0.0 0.0 0.0 0.0 34-35 0.2 0.0 0.0 0.0 0.0 36-37 0.2 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.225 0.0 0.0 0.0 0.0 44-45 0.225 0.0 0.0 0.0 0.0 46-47 0.225 0.0 0.0 0.0 0.0 48-49 0.2375 0.0 0.0 0.0 0.0 50-51 0.25 0.0 0.0 0.0 0.0 52-53 0.2625 0.0 0.0 0.0 0.0 54-55 0.275 0.0 0.0 0.0 0.0 56-57 0.275 0.0 0.0 0.0 0.0 58-59 0.2875 0.0 0.0 0.0 0.0 60-61 0.32499999999999996 0.0 0.0 0.0 0.0 62-63 0.35 0.0 0.0 0.0 0.0 64-65 0.4 0.0 0.0 0.0 0.0 66-67 0.4 0.0 0.0 0.0 0.0 68-69 0.4375 0.0 0.0 0.0 0.0 70-71 0.4625 0.0 0.0 0.0 0.0 72-73 0.5875 0.0 0.0 0.0 0.0 74-75 0.7 0.0 0.0 0.0 0.0 76-77 0.8875 0.0 0.0 0.0 0.0 78-79 1.0 0.0 0.0 0.0 0.0 80-81 1.075 0.0 0.0 0.0 0.0 82-83 1.2 0.0 0.0 0.0 0.0 84-85 1.525 0.0 0.0 0.0 0.0 86-87 1.775 0.0 0.0 0.0 0.0 88 1.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGCG 25 0.0048637707 56.4 7 TCGGAAG 25 0.0048637707 56.4 3 ATCGGAA 25 0.0048637707 56.4 2 >>END_MODULE Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra Read 1249851 spots for SRR11668427.sra Written 1249851 spots for SRR11668427.sra Read 1249848 spots for SRR11668427.sra Written 1249848 spots for SRR11668427.sra SRR ids: ['SRR11668427.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bjxsh5ga SRR11668427.sra spots: 24996963 blocks: [[1, 1249848], [1249849, 2499696], [2499697, 3749544], [3749545, 4999392], [4999393, 6249240], [6249241, 7499088], [7499089, 8748936], [8748937, 9998784], [9998785, 11248632], [11248633, 12498480], [12498481, 13748328], [13748329, 14998176], [14998177, 16248024], [16248025, 17497872], [17497873, 18747720], [18747721, 19997568], [19997569, 21247416], [21247417, 22497264], [22497265, 23747112], [23747113, 24996963]] SRR11668427 file size 5983429 SRR11668427 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11668427 SRR11668427_1.fastq SRR11668427_2.fastq Input file: SRR11668427_1.fastq Paired file: SRR11668427_2.fastq trimmed: SRR11668427-trimmed-pair1.fastq, SRR11668427-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:41:41 2024 >> started Sat Dec 7 09:42:02 2024 >> done (20.819s) 24996963 read pairs processed; of these: 2009 ( 0.01%) short read pairs filtered out after trimming by size control 549533 ( 2.20%) empty read pairs filtered out after trimming by size control 24445421 (97.79%) read pairs available; of these: 2123960 ( 8.69%) trimmed read pairs available after processing 22321461 (91.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 60 0.00% 19 56 0.00% 20 56 0.00% 21 61 0.00% 22 65 0.00% 23 82 0.00% 24 73 0.00% 25 104 0.00% 26 96 0.00% 27 122 0.00% 28 149 0.00% 29 168 0.00% 30 171 0.00% 31 237 0.00% 32 232 0.00% 33 286 0.00% 34 251 0.00% 35 282 0.00% 36 301 0.00% 37 329 0.00% 38 406 0.00% 39 421 0.00% 40 508 0.00% 41 583 0.00% 42 638 0.00% 43 653 0.00% 44 632 0.00% 45 660 0.00% 46 825 0.00% 47 838 0.00% 48 998 0.00% 49 1128 0.00% 50 1286 0.01% 51 1434 0.01% 52 1671 0.01% 53 1648 0.01% 54 1761 0.01% 55 1925 0.01% 56 2035 0.01% 57 2327 0.01% 58 2504 0.01% 59 2856 0.01% 60 3375 0.01% 61 3621 0.01% 62 4093 0.02% 63 4367 0.02% 64 4867 0.02% 65 5283 0.02% 66 5584 0.02% 67 6746 0.03% 68 6861 0.03% 69 7396 0.03% 70 8322 0.03% 71 9138 0.04% 72 10056 0.04% 73 11403 0.05% 74 12518 0.05% 75 13737 0.06% 76 15152 0.06% 77 16216 0.07% 78 17499 0.07% 79 19283 0.08% 80 20521 0.08% 81 22867 0.09% 82 25083 0.10% 83 27826 0.11% 84 30464 0.12% 85 33490 0.14% 86 36337 0.15% 87 38812 0.16% 88 41834 0.17% 89 44452 0.18% 90 46988 0.19% 91 50565 0.21% 92 54109 0.22% 93 57790 0.24% 94 62703 0.26% 95 67969 0.28% 96 72814 0.30% 97 81271 0.33% 98 138260 0.57% 99 953370 3.90% 100 22321461 91.31% 24445421 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=17 prefix-density=0.41 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=330.05 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=25.2 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.59 fanout-score-rank=12 prefix-density=0.45 prefix-fanout=3.4 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCC criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=235.67 fanout-score-rank=1 prefix-density=1.29 prefix-fanout=23.8 sequence=GCCGCCGCCACC SRR11668427 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:42:32 Started mapping on | Dec 07 09:42:32 Finished on | Dec 07 09:43:53 Mapping speed, Million of reads per hour | 1086.46 Number of input reads | 24445421 Average input read length | 198 UNIQUE READS: Uniquely mapped reads number | 23173812 Uniquely mapped reads % | 94.80% Average mapped length | 197.63 Number of splices: Total | 13531953 Number of splices: Annotated (sjdb) | 12823560 Number of splices: GT/AG | 13356707 Number of splices: GC/AG | 147654 Number of splices: AT/AC | 6315 Number of splices: Non-canonical | 21277 Mismatch rate per base, % | 0.56% Deletion rate per base | 0.01% Deletion average length | 1.91 Insertion rate per base | 0.01% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 606279 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 18245 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 665330 665330 665330 N_multimapping 606279 606279 606279 N_noFeature 658866 22559090 897285 N_ambiguous 460490 2944 90147 UnstrandedReadsAssigned:22054456 PositiveStrandReadsAssigned:611778 NegativeStrandReadsAssigned:22186380 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR11668427 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11668427-trimmed-pair1.fastq SRR11668427-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,445,421 reads, 22,977,946 reads pseudoaligned [quant] estimated average fragment length: 196.329 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR11668427.ke.tsv 35125 SRR11668427.se.tsv 88098 total ==> SRR11668427.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 740.887 0 0 PNS24247 1044 848.671 26.4718 1.93498 PNS24249 1928 1732.67 163.493 5.8535 PNS24246 1044 848.671 26.4718 1.93498 PNS24248 1044 848.671 26.4718 1.93498 PNS24244 1471 1275.67 42.0916 2.04686 PNS24243 293 124.869 0 0 KQK14069 1603 1407.67 3725 164.156 KQK14071 474 284.296 53.5235 11.679 ==> SRR11668427.se.tsv <== BRADI_1g14170v3 3780 BRADI_1g53295v3 1 BRADI_1g59795v3 91 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 1387 BRADI_1g74790v3 378 BRADI_1g09890v3 6 BRADI_1g77505v3 218 BRADI_1g48960v3 0 SRR11668427 completed mapping pipeline successfully