Starting /dee2/code/volunteer_pipeline.sh SRR11668428 current disk space = 1551674167296 free memory = 1603098180 SRR11668428 SRAfilesize 6f0a4107ec5732521bfa8cddc7700193 SRR11668428.sra SRR11668428.sra file validated SRR11668428 is paired end SRR11668428 is conventional basespace SRR11668428 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668428_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.16 37.0 37.0 37.0 37.0 37.0 2 35.61925 37.0 37.0 37.0 37.0 37.0 3 36.359 37.0 37.0 37.0 37.0 37.0 4 36.156 37.0 37.0 37.0 37.0 37.0 5 36.222 37.0 37.0 37.0 37.0 37.0 6 36.22 37.0 37.0 37.0 37.0 37.0 7 36.1385 37.0 37.0 37.0 37.0 37.0 8 36.176 37.0 37.0 37.0 37.0 37.0 9 36.307 37.0 37.0 37.0 37.0 37.0 10-11 36.2305 37.0 37.0 37.0 37.0 37.0 12-13 36.231750000000005 37.0 37.0 37.0 37.0 37.0 14-15 36.29925 37.0 37.0 37.0 37.0 37.0 16-17 36.194 37.0 37.0 37.0 37.0 37.0 18-19 36.27775 37.0 37.0 37.0 37.0 37.0 20-21 36.22325 37.0 37.0 37.0 37.0 37.0 22-23 36.189499999999995 37.0 37.0 37.0 37.0 37.0 24-25 36.17525 37.0 37.0 37.0 37.0 37.0 26-27 36.196 37.0 37.0 37.0 37.0 37.0 28-29 36.08 37.0 37.0 37.0 37.0 37.0 30-31 36.07325 37.0 37.0 37.0 37.0 37.0 32-33 36.0585 37.0 37.0 37.0 37.0 37.0 34-35 36.05925 37.0 37.0 37.0 37.0 37.0 36-37 36.03775 37.0 37.0 37.0 37.0 37.0 38-39 36.05825 37.0 37.0 37.0 37.0 37.0 40-41 35.966499999999996 37.0 37.0 37.0 37.0 37.0 42-43 35.9765 37.0 37.0 37.0 37.0 37.0 44-45 35.95125 37.0 37.0 37.0 37.0 37.0 46-47 35.881 37.0 37.0 37.0 37.0 37.0 48-49 35.86225 37.0 37.0 37.0 37.0 37.0 50-51 35.789 37.0 37.0 37.0 37.0 37.0 52-53 35.8675 37.0 37.0 37.0 37.0 37.0 54-55 35.897499999999994 37.0 37.0 37.0 37.0 37.0 56-57 35.762 37.0 37.0 37.0 37.0 37.0 58-59 35.74125 37.0 37.0 37.0 37.0 37.0 60-61 35.79025 37.0 37.0 37.0 37.0 37.0 62-63 35.7475 37.0 37.0 37.0 37.0 37.0 64-65 35.76075 37.0 37.0 37.0 37.0 37.0 66-67 35.78175 37.0 37.0 37.0 37.0 37.0 68-69 35.7365 37.0 37.0 37.0 37.0 37.0 70-71 35.601 37.0 37.0 37.0 37.0 37.0 72-73 35.7705 37.0 37.0 37.0 37.0 37.0 74-75 35.92075 37.0 37.0 37.0 37.0 37.0 76-77 35.843 37.0 37.0 37.0 37.0 37.0 78-79 35.908 37.0 37.0 37.0 37.0 37.0 80-81 35.798500000000004 37.0 37.0 37.0 37.0 37.0 82-83 35.769999999999996 37.0 37.0 37.0 37.0 37.0 84-85 35.95325 37.0 37.0 37.0 37.0 37.0 86-87 35.912 37.0 37.0 37.0 37.0 37.0 88-89 35.92175 37.0 37.0 37.0 37.0 37.0 90-91 35.84775 37.0 37.0 37.0 37.0 37.0 92-93 35.747 37.0 37.0 37.0 37.0 37.0 94-95 35.84725 37.0 37.0 37.0 37.0 37.0 96-97 35.7575 37.0 37.0 37.0 37.0 37.0 98-99 35.777 37.0 37.0 37.0 37.0 37.0 100-101 35.68875 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 3.0 25 10.0 26 11.0 27 15.0 28 31.0 29 39.0 30 41.0 31 63.0 32 85.0 33 104.0 34 151.0 35 332.0 36 2532.0 37 579.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.1 10.100000000000001 11.899999999999999 43.9 2 30.144633341791423 13.042375031717837 28.596802841918294 28.216188784572445 3 28.225 17.95 20.349999999999998 33.475 4 31.265632816408207 22.011005502751377 17.808904452226113 28.91445722861431 5 32.275 24.75 19.45 23.525 6 25.025 29.799999999999997 21.125 24.05 7 18.9 24.825 35.325 20.95 8 20.974999999999998 22.45 28.075 28.499999999999996 9 23.0 19.225 30.75 27.025 10-11 25.05 27.8375 22.4375 24.675 12-13 25.0625 22.75 24.349999999999998 27.8375 14-15 24.85 23.65 25.025 26.474999999999998 16-17 25.224999999999998 23.9375 23.375 27.462500000000002 18-19 24.349999999999998 24.25 24.15 27.250000000000004 20-21 25.2125 23.575 23.9 27.3125 22-23 25.224999999999998 24.7375 23.925 26.1125 24-25 25.162499999999998 23.875 23.325000000000003 27.6375 26-27 25.087500000000002 23.925 23.825 27.1625 28-29 25.4875 24.175 24.0 26.337500000000002 30-31 24.349999999999998 23.9125 24.7875 26.950000000000003 32-33 24.925 24.887500000000003 23.2875 26.900000000000002 34-35 25.074999999999996 23.925 23.5125 27.487499999999997 36-37 26.075 23.275000000000002 23.575 27.075 38-39 26.987499999999997 23.5 21.85 27.6625 40-41 26.424999999999997 25.087500000000002 22.4375 26.05 42-43 24.4875 25.0375 23.65 26.825 44-45 25.75 23.150000000000002 23.400000000000002 27.700000000000003 46-47 25.7125 23.1375 23.5625 27.5875 48-49 24.65 24.712500000000002 24.0625 26.575 50-51 26.237500000000004 23.7625 23.7 26.3 52-53 25.7 24.0125 22.5625 27.725 54-55 25.924999999999997 24.325 23.1375 26.6125 56-57 26.237500000000004 23.175 23.1375 27.450000000000003 58-59 25.637500000000003 24.15 22.5625 27.650000000000002 60-61 26.3125 23.0 23.8125 26.875 62-63 26.224999999999998 23.1 23.5125 27.1625 64-65 25.7125 22.900000000000002 23.9 27.487499999999997 66-67 25.7625 23.2875 23.724999999999998 27.224999999999998 68-69 26.6625 23.599999999999998 23.4125 26.325 70-71 27.0875 23.425 23.325000000000003 26.1625 72-73 26.575 23.1625 23.275000000000002 26.987499999999997 74-75 26.7625 23.5875 22.675 26.974999999999998 76-77 26.637499999999996 23.45 22.775000000000002 27.1375 78-79 25.924999999999997 24.0 23.0 27.075 80-81 27.0875 23.974999999999998 22.5625 26.375 82-83 28.15 23.4625 22.2625 26.125 84-85 27.150000000000002 23.6625 22.3125 26.875 86-87 27.6625 22.925 22.175 27.237499999999997 88-89 27.1625 23.45 22.5625 26.825 90-91 28.175 23.4875 22.2 26.137500000000003 92-93 27.3 24.25 22.2 26.25 94-95 27.325 23.175 22.3625 27.1375 96-97 27.6125 23.200000000000003 22.175 27.0125 98-99 26.987499999999997 22.662499999999998 24.025 26.325 100-101 27.6625 23.2625 22.7 26.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 1.0 24 0.5 25 1.0 26 3.5 27 4.5 28 2.5 29 1.0 30 4.5 31 7.5 32 9.5 33 16.5 34 22.5 35 30.5 36 39.5 37 50.5 38 65.0 39 80.0 40 96.0 41 106.0 42 129.0 43 143.0 44 136.0 45 142.0 46 166.0 47 166.5 48 139.0 49 137.5 50 142.5 51 131.0 52 123.0 53 117.5 54 99.0 55 85.5 56 76.0 57 80.0 58 98.5 59 96.5 60 83.5 61 73.5 62 70.0 63 77.0 64 72.5 65 65.5 66 89.0 67 93.5 68 80.5 69 82.0 70 66.0 71 53.0 72 54.5 73 50.5 74 47.0 75 37.5 76 35.0 77 37.5 78 26.5 79 15.0 80 9.0 81 11.0 82 8.5 83 2.5 84 1.5 85 1.0 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.4749999999999999 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.175 #Duplication Level Percentage of deduplicated Percentage of total 1 94.63764268648792 89.125 2 5.123440403504115 9.65 3 0.15927794000530926 0.44999999999999996 4 0.026546323334218212 0.1 5 0.026546323334218212 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026546323334218212 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGCGCAAATCTCGTAT 22 0.5499999999999999 TruSeq Adapter, Index 10 (97% over 37bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGCGCAAATCTCGTA 5 0.125 TruSeq Adapter, Index 10 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.225 0.0 0.0 0.0 0.0 2 0.225 0.0 0.0 0.0 0.0 3 0.225 0.0 0.0 0.0 0.0 4 0.225 0.0 0.0 0.0 0.0 5 0.225 0.0 0.0 0.0 0.0 6 0.225 0.0 0.0 0.0 0.0 7 0.225 0.0 0.0 0.0 0.0 8 0.225 0.0 0.0 0.0 0.0 9 0.225 0.0 0.0 0.0 0.0 10-11 0.225 0.0 0.0 0.0 0.0 12-13 0.225 0.0 0.0 0.0 0.0 14-15 0.225 0.0 0.0 0.0 0.0 16-17 0.225 0.0 0.0 0.0 0.0 18-19 0.225 0.0 0.0 0.0 0.0 20-21 0.225 0.0 0.0 0.0 0.0 22-23 0.225 0.0 0.0 0.0 0.0 24-25 0.225 0.0 0.0 0.0 0.0 26-27 0.225 0.0 0.0 0.0 0.0 28-29 0.225 0.0 0.0 0.0 0.0 30-31 0.225 0.0 0.0 0.0 0.0 32-33 0.2375 0.0 0.0 0.0 0.0 34-35 0.25 0.0 0.0 0.0 0.0 36-37 0.2625 0.0 0.0 0.0 0.0 38-39 0.30000000000000004 0.0 0.0 0.0 0.0 40-41 0.325 0.0 0.0 0.0 0.0 42-43 0.325 0.0 0.0 0.0 0.0 44-45 0.325 0.0 0.0 0.0 0.0 46-47 0.325 0.0 0.0 0.0 0.0 48-49 0.325 0.0 0.0 0.0 0.0 50-51 0.325 0.0 0.0 0.0 0.0 52-53 0.35 0.0 0.0 0.0 0.0 54-55 0.3625 0.0 0.0 0.0 0.0 56-57 0.375 0.0 0.0 0.0 0.0 58-59 0.375 0.0 0.0 0.0 0.0 60-61 0.375 0.0 0.0 0.0 0.0 62-63 0.375 0.0 0.0 0.0 0.0 64-65 0.375 0.0 0.0 0.0 0.0 66-67 0.4375 0.0 0.0 0.0 0.0 68-69 0.5125 0.0 0.0 0.0 0.0 70-71 0.5874999999999999 0.0 0.0 0.0 0.0 72-73 0.6375 0.0 0.0 0.0 0.0 74-75 0.65 0.0 0.0 0.0 0.0 76-77 0.75 0.0 0.0 0.0 0.0 78-79 0.9 0.0 0.0 0.0 0.0 80-81 1.0625 0.0 0.0 0.0 0.0 82-83 1.325 0.0 0.0 0.0 0.0 84-85 1.575 0.0 0.0 0.0 0.0 86-87 1.7125 0.0 0.0 0.0 0.0 88-89 1.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11668428 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668428_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.869 37.0 37.0 37.0 37.0 37.0 2 35.7765 37.0 37.0 37.0 37.0 37.0 3 35.96 37.0 37.0 37.0 37.0 37.0 4 35.9375 37.0 37.0 37.0 37.0 37.0 5 35.99 37.0 37.0 37.0 37.0 37.0 6 35.816 37.0 37.0 37.0 37.0 37.0 7 35.9135 37.0 37.0 37.0 37.0 37.0 8 35.924 37.0 37.0 37.0 37.0 37.0 9 35.9665 37.0 37.0 37.0 37.0 37.0 10-11 35.94225 37.0 37.0 37.0 37.0 37.0 12-13 35.98725 37.0 37.0 37.0 37.0 37.0 14-15 35.9345 37.0 37.0 37.0 37.0 37.0 16-17 36.052499999999995 37.0 37.0 37.0 37.0 37.0 18-19 36.024 37.0 37.0 37.0 37.0 37.0 20-21 35.8465 37.0 37.0 37.0 37.0 37.0 22-23 35.605374999999995 37.0 37.0 37.0 37.0 37.0 24-25 35.877375 37.0 37.0 37.0 37.0 37.0 26-27 35.83625 37.0 37.0 37.0 37.0 37.0 28-29 35.97425 37.0 37.0 37.0 37.0 37.0 30-31 35.73475 37.0 37.0 37.0 37.0 37.0 32-33 35.826875 37.0 37.0 37.0 37.0 37.0 34-35 35.717749999999995 37.0 37.0 37.0 37.0 37.0 36-37 35.723625 37.0 37.0 37.0 37.0 37.0 38-39 35.770250000000004 37.0 37.0 37.0 37.0 37.0 40-41 35.7695 37.0 37.0 37.0 37.0 37.0 42-43 35.629125 37.0 37.0 37.0 37.0 37.0 44-45 35.66875 37.0 37.0 37.0 37.0 37.0 46-47 35.6305 37.0 37.0 37.0 37.0 37.0 48-49 35.5685 37.0 37.0 37.0 37.0 37.0 50-51 35.555375 37.0 37.0 37.0 37.0 37.0 52-53 35.543625000000006 37.0 37.0 37.0 37.0 37.0 54-55 35.71 37.0 37.0 37.0 37.0 37.0 56-57 35.539249999999996 37.0 37.0 37.0 37.0 37.0 58-59 35.574625 37.0 37.0 37.0 37.0 37.0 60-61 35.701125000000005 37.0 37.0 37.0 37.0 37.0 62-63 35.732625 37.0 37.0 37.0 37.0 37.0 64-65 35.494625 37.0 37.0 37.0 37.0 37.0 66-67 35.597375 37.0 37.0 37.0 37.0 37.0 68-69 35.670625 37.0 37.0 37.0 37.0 37.0 70-71 35.438375 37.0 37.0 37.0 37.0 37.0 72-73 35.57725 37.0 37.0 37.0 37.0 37.0 74-75 35.602999999999994 37.0 37.0 37.0 37.0 37.0 76-77 35.46675 37.0 37.0 37.0 37.0 37.0 78-79 35.42525 37.0 37.0 37.0 37.0 37.0 80-81 35.42475 37.0 37.0 37.0 37.0 37.0 82-83 35.62575 37.0 37.0 37.0 37.0 37.0 84-85 35.441 37.0 37.0 37.0 37.0 37.0 86-87 35.5065 37.0 37.0 37.0 37.0 37.0 88-89 35.7205 37.0 37.0 37.0 37.0 37.0 90-91 35.636750000000006 37.0 37.0 37.0 37.0 37.0 92-93 35.35825 37.0 37.0 37.0 37.0 37.0 94-95 35.468 37.0 37.0 37.0 37.0 37.0 96-97 35.5585 37.0 37.0 37.0 37.0 37.0 98-99 35.5045 37.0 37.0 37.0 37.0 37.0 100-101 35.331500000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 4.0 16 4.0 17 3.0 18 5.0 19 1.0 20 2.0 21 5.0 22 7.0 23 11.0 24 14.0 25 16.0 26 18.0 27 22.0 28 24.0 29 38.0 30 39.0 31 54.0 32 56.0 33 83.0 34 179.0 35 544.0 36 2376.0 37 494.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.35 17.375 13.55 37.724999999999994 2 30.7 23.0 26.474999999999998 19.825 3 26.424999999999997 25.724999999999998 23.0 24.85 4 28.875 29.95 17.025000000000002 24.15 5 30.099999999999998 30.75 17.875 21.275 6 23.799999999999997 35.925000000000004 18.45 21.825 7 25.074999999999996 16.35 32.85 25.724999999999998 8 25.15 21.775 22.825 30.25 9 26.075 21.325 23.5 29.099999999999998 10-11 28.0875 26.7625 18.8125 26.337500000000002 12-13 27.775 20.0 23.025000000000002 29.2 14-15 26.525 23.95 22.6 26.924999999999997 16-17 28.037499999999998 22.412499999999998 21.9375 27.6125 18-19 27.5625 23.325000000000003 23.025000000000002 26.087500000000002 20-21 28.4 23.2875 22.425 25.887500000000003 22-23 27.678459807475935 22.852856607075882 21.94024253031629 27.528441055131893 24-25 27.15339417427178 23.35291911488936 22.62782847855982 26.865858232279034 26-27 27.3 24.212500000000002 22.3875 26.1 28-29 28.275 23.474999999999998 21.6 26.650000000000002 30-31 27.575 22.45 23.1375 26.8375 32-33 27.465933241655204 23.377922240280036 22.090261282660332 27.065883235404424 34-35 28.3375 22.8625 22.162499999999998 26.637499999999996 36-37 28.2410301287661 22.59032379047381 21.990248781097637 27.17839729966246 38-39 28.676838419209606 22.848924462231114 22.448724362181093 26.025512756378188 40-41 27.474999999999998 22.537499999999998 23.0125 26.974999999999998 42-43 28.55356919614952 22.352794099262407 22.702837854731843 26.390798849856235 44-45 27.419354838709676 22.918229557389346 23.3183295823956 26.344086021505376 46-47 27.94448612153038 22.280570142535634 22.518129532383096 27.25681420355089 48-49 27.094273568392097 22.980745186296573 22.468117029257314 27.45686421605401 50-51 27.529706066291432 22.73921200750469 22.589118198874296 27.141963727329582 52-53 28.792995622263916 22.388993120700437 21.425891181988742 27.392120075046904 54-55 27.68192048012003 22.593148287071767 22.380595148787197 27.344336084021002 56-57 28.244561140285075 23.48087021755439 22.643160790197552 25.63140785196299 58-59 29.078634829353668 22.7903487935992 22.39029878734842 25.740717589698715 60-61 28.20352544068008 22.415301912739093 22.615326915864483 26.765845730716343 62-63 28.92861607700963 23.202900362545318 22.352794099262407 25.51568946118265 64-65 27.15339417427178 22.977872234029252 22.14026753344168 27.728466058257283 66-67 27.490936367045883 22.99037379672459 23.090386298287285 26.428303537942245 68-69 28.378547318414803 22.777847230903863 22.077759719964995 26.765845730716343 70-71 28.22852856607076 22.052756594574323 22.7903487935992 26.92836604575572 72-73 28.0875 23.1 23.2375 25.575 74-75 27.4125 22.5125 23.225 26.85 76-77 28.5875 23.1875 21.8 26.424999999999997 78-79 28.1125 23.6125 22.025 26.25 80-81 28.4375 23.225 22.4375 25.900000000000002 82-83 28.95 23.25 21.349999999999998 26.450000000000003 84-85 28.0875 22.7125 23.5875 25.6125 86-87 28.375 22.775000000000002 22.3375 26.5125 88-89 28.775000000000002 22.825 21.987499999999997 26.4125 90-91 28.625 22.625 22.1 26.650000000000002 92-93 27.425 24.575 22.25 25.75 94-95 29.575000000000003 21.95 22.8625 25.6125 96-97 28.000000000000004 23.9125 22.037499999999998 26.05 98-99 27.737499999999997 23.3 22.7 26.2625 100-101 30.225 22.8 21.2375 25.7375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 2.0 22 0.5 23 0.0 24 2.0 25 4.0 26 2.5 27 1.5 28 3.0 29 8.0 30 9.5 31 9.5 32 10.0 33 13.0 34 21.5 35 27.5 36 31.5 37 41.5 38 60.5 39 67.0 40 76.0 41 107.5 42 128.5 43 127.5 44 122.5 45 131.0 46 143.5 47 149.5 48 139.5 49 118.5 50 125.5 51 123.0 52 107.0 53 116.5 54 109.5 55 90.5 56 78.0 57 68.0 58 80.5 59 85.5 60 85.0 61 80.0 62 77.0 63 99.0 64 97.0 65 84.5 66 92.0 67 87.0 68 88.5 69 90.5 70 79.0 71 77.5 72 70.5 73 58.0 74 51.0 75 45.5 76 39.0 77 34.5 78 26.5 79 15.5 80 10.0 81 7.5 82 7.5 83 7.0 84 4.0 85 4.0 86 3.0 87 2.5 88 2.5 89 1.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 2.5 98 4.5 99 7.0 100 8.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0125 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0125 34-35 0.0 36-37 0.0125 38-39 0.05 40-41 0.0 42-43 0.0125 44-45 0.025 46-47 0.025 48-49 0.025 50-51 0.0625 52-53 0.0625 54-55 0.025 56-57 0.025 58-59 0.0125 60-61 0.0125 62-63 0.0125 64-65 0.0125 66-67 0.0125 68-69 0.0125 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.6 #Duplication Level Percentage of deduplicated Percentage of total 1 94.71458773784354 89.60000000000001 2 5.100422832980973 9.65 3 0.15856236786469344 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026427061310782242 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.225 0.0 0.0 0.0 0.0 2 0.225 0.0 0.0 0.0 0.0 3 0.225 0.0 0.0 0.0 0.0 4 0.225 0.0 0.0 0.0 0.0 5 0.225 0.0 0.0 0.0 0.0 6 0.225 0.0 0.0 0.0 0.0 7 0.225 0.0 0.0 0.0 0.0 8 0.225 0.0 0.0 0.0 0.0 9 0.225 0.0 0.0 0.0 0.0 10-11 0.225 0.0 0.0 0.0 0.0 12-13 0.225 0.0 0.0 0.0 0.0 14-15 0.225 0.0 0.0 0.0 0.0 16-17 0.225 0.0 0.0 0.0 0.0 18-19 0.225 0.0 0.0 0.0 0.0 20-21 0.225 0.0 0.0 0.0 0.0 22-23 0.225 0.0 0.0 0.0 0.0 24-25 0.225 0.0 0.0 0.0 0.0 26-27 0.225 0.0 0.0 0.0 0.0 28-29 0.225 0.0 0.0 0.0 0.0 30-31 0.225 0.0 0.0 0.0 0.0 32-33 0.2375 0.0 0.0 0.0 0.0 34-35 0.25 0.0 0.0 0.0 0.0 36-37 0.2625 0.0 0.0 0.0 0.0 38-39 0.30000000000000004 0.0 0.0 0.0 0.0 40-41 0.325 0.0 0.0 0.0 0.0 42-43 0.325 0.0 0.0 0.0 0.0 44-45 0.325 0.0 0.0 0.0 0.0 46-47 0.325 0.0 0.0 0.0 0.0 48-49 0.325 0.0 0.0 0.0 0.0 50-51 0.325 0.0 0.0 0.0 0.0 52-53 0.35 0.0 0.0 0.0 0.0 54-55 0.3625 0.0 0.0 0.0 0.0 56-57 0.375 0.0 0.0 0.0 0.0 58-59 0.375 0.0 0.0 0.0 0.0 60-61 0.375 0.0 0.0 0.0 0.0 62-63 0.375 0.0 0.0 0.0 0.0 64-65 0.375 0.0 0.0 0.0 0.0 66-67 0.4375 0.0 0.0 0.0 0.0 68-69 0.5125 0.0 0.0 0.0 0.0 70-71 0.5874999999999999 0.0 0.0 0.0 0.0 72-73 0.6375 0.0 0.0 0.0 0.0 74-75 0.65 0.0 0.0 0.0 0.0 76-77 0.7250000000000001 0.0 0.0 0.0 0.0 78-79 0.85 0.0 0.0 0.0 0.0 80-81 0.9875 0.0 0.0 0.0 0.0 82-83 1.25 0.0 0.0 0.0 0.0 84-85 1.5125 0.0 0.0 0.0 0.0 86-87 1.65 0.0 0.0 0.0 0.0 88-89 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAGC 30 0.009594663 47.5 7 >>END_MODULE Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293512 spots for SRR11668428.sra Written 4293512 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra Read 4293503 spots for SRR11668428.sra Written 4293503 spots for SRR11668428.sra SRR ids: ['SRR11668428.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7g1227ms SRR11668428.sra spots: 85870069 blocks: [[1, 4293503], [4293504, 8587006], [8587007, 12880509], [12880510, 17174012], [17174013, 21467515], [21467516, 25761018], [25761019, 30054521], [30054522, 34348024], [34348025, 38641527], [38641528, 42935030], [42935031, 47228533], [47228534, 51522036], [51522037, 55815539], [55815540, 60109042], [60109043, 64402545], [64402546, 68696048], [68696049, 72989551], [72989552, 77283054], [77283055, 81576557], [81576558, 85870069]] SRR11668428 file size 20774956 SRR11668428 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11668428 SRR11668428_1.fastq SRR11668428_2.fastq Input file: SRR11668428_1.fastq Paired file: SRR11668428_2.fastq trimmed: SRR11668428-trimmed-pair1.fastq, SRR11668428-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:41:00 2024 >> started Fri Dec 6 10:42:22 2024 >> done (81.377s) 85870069 read pairs processed; of these: 10952 ( 0.01%) short read pairs filtered out after trimming by size control 686713 ( 0.80%) empty read pairs filtered out after trimming by size control 85172404 (99.19%) read pairs available; of these: 3573914 ( 4.20%) trimmed read pairs available after processing 81598490 (95.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 322 0.00% 19 299 0.00% 20 265 0.00% 21 264 0.00% 22 304 0.00% 23 265 0.00% 24 253 0.00% 25 257 0.00% 26 309 0.00% 27 338 0.00% 28 443 0.00% 29 580 0.00% 30 605 0.00% 31 667 0.00% 32 795 0.00% 33 713 0.00% 34 895 0.00% 35 835 0.00% 36 1300 0.00% 37 1030 0.00% 38 1225 0.00% 39 1328 0.00% 40 1487 0.00% 41 1701 0.00% 42 1796 0.00% 43 1839 0.00% 44 1921 0.00% 45 1970 0.00% 46 2309 0.00% 47 2642 0.00% 48 3016 0.00% 49 3499 0.00% 50 3731 0.00% 51 4357 0.01% 52 4471 0.01% 53 4847 0.01% 54 4878 0.01% 55 5398 0.01% 56 5824 0.01% 57 6363 0.01% 58 7476 0.01% 59 8117 0.01% 60 9345 0.01% 61 10365 0.01% 62 11403 0.01% 63 12178 0.01% 64 12985 0.02% 65 14353 0.02% 66 15522 0.02% 67 17971 0.02% 68 18690 0.02% 69 20704 0.02% 70 22820 0.03% 71 25542 0.03% 72 28149 0.03% 73 31721 0.04% 74 35005 0.04% 75 37854 0.04% 76 41611 0.05% 77 44253 0.05% 78 48090 0.06% 79 52753 0.06% 80 57160 0.07% 81 62571 0.07% 82 70281 0.08% 83 76698 0.09% 84 84030 0.10% 85 92020 0.11% 86 99061 0.12% 87 106149 0.12% 88 114489 0.13% 89 121786 0.14% 90 130606 0.15% 91 141572 0.17% 92 152267 0.18% 93 164596 0.19% 94 177959 0.21% 95 190918 0.22% 96 202197 0.24% 97 215260 0.25% 98 226232 0.27% 99 234915 0.28% 100 250899 0.29% 101 81598490 95.80% 85172404 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=21 prefix-density=0.38 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=28 fanout-score=11.71 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=2.8 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGG criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=4.56 fanout-score-rank=11 prefix-density=0.45 prefix-fanout=3.6 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCC criterion=fanout-score sequence-density=0.16 sequence-density-rank=16 fanout-score=192.75 fanout-score-rank=1 prefix-density=1.44 prefix-fanout=22.0 sequence=GCCGCCGCCACCCT SRR11668428 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:42:53 Started mapping on | Dec 06 10:42:53 Finished on | Dec 06 10:47:10 Mapping speed, Million of reads per hour | 1193.08 Number of input reads | 85172404 Average input read length | 200 UNIQUE READS: Uniquely mapped reads number | 81496340 Uniquely mapped reads % | 95.68% Average mapped length | 200.32 Number of splices: Total | 46459323 Number of splices: Annotated (sjdb) | 44034315 Number of splices: GT/AG | 45830920 Number of splices: GC/AG | 526828 Number of splices: AT/AC | 22936 Number of splices: Non-canonical | 78639 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.08 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2060165 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 105540 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.18% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1615899 1615899 1615899 N_multimapping 2060165 2060165 2060165 N_noFeature 2202706 79343162 3077739 N_ambiguous 1621316 10588 366976 UnstrandedReadsAssigned:77672318 PositiveStrandReadsAssigned:2142590 NegativeStrandReadsAssigned:78051625 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11668428 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11668428-trimmed-pair1.fastq SRR11668428-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 85,172,404 reads, 79,806,012 reads pseudoaligned [quant] estimated average fragment length: 205.948 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,282 rounds 52973 SRR11668428.ke.tsv 35125 SRR11668428.se.tsv 88098 total ==> SRR11668428.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 731.236 0 0 PNS24247 1044 839.052 109.222 2.33216 PNS24249 1928 1723.05 756.356 7.86439 PNS24246 1044 839.052 109.222 2.33216 PNS24248 1044 839.052 109.222 2.33216 PNS24244 1471 1266.05 199.979 2.82989 PNS24243 293 121.357 0 0 KQK14069 1603 1398.05 5630.28 72.1513 KQK14071 474 277.181 526.302 34.0181 ==> SRR11668428.se.tsv <== BRADI_1g14170v3 7254 BRADI_1g53295v3 66 BRADI_1g59795v3 1029 BRADI_1g07683v3 0 BRADI_1g00485v3 144 BRADI_1g20270v3 9366 BRADI_1g74790v3 630 BRADI_1g09890v3 48 BRADI_1g77505v3 1108 BRADI_1g48960v3 2 SRR11668428 completed mapping pipeline successfully