Starting /dee2/code/volunteer_pipeline.sh SRR11668429 current disk space = 1551704727552 free memory = 1607248208 SRR11668429 SRAfilesize 16adcd9b4054e2b249b1b030bdbe526f SRR11668429.sra SRR11668429.sra file validated SRR11668429 is paired end SRR11668429 is conventional basespace SRR11668429 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668429_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.102 37.0 37.0 37.0 37.0 37.0 2 35.911 37.0 37.0 37.0 37.0 37.0 3 36.286 37.0 37.0 37.0 37.0 37.0 4 36.3175 37.0 37.0 37.0 37.0 37.0 5 36.2855 37.0 37.0 37.0 37.0 37.0 6 36.3205 37.0 37.0 37.0 37.0 37.0 7 36.2895 37.0 37.0 37.0 37.0 37.0 8 36.209 37.0 37.0 37.0 37.0 37.0 9 36.303 37.0 37.0 37.0 37.0 37.0 10-11 36.321 37.0 37.0 37.0 37.0 37.0 12-13 36.300250000000005 37.0 37.0 37.0 37.0 37.0 14-15 36.198499999999996 37.0 37.0 37.0 37.0 37.0 16-17 36.21325 37.0 37.0 37.0 37.0 37.0 18-19 36.21875 37.0 37.0 37.0 37.0 37.0 20-21 36.23025 37.0 37.0 37.0 37.0 37.0 22-23 36.22925 37.0 37.0 37.0 37.0 37.0 24-25 36.23025 37.0 37.0 37.0 37.0 37.0 26-27 36.11750000000001 37.0 37.0 37.0 37.0 37.0 28-29 36.138999999999996 37.0 37.0 37.0 37.0 37.0 30-31 36.152 37.0 37.0 37.0 37.0 37.0 32-33 36.107 37.0 37.0 37.0 37.0 37.0 34-35 36.03425 37.0 37.0 37.0 37.0 37.0 36-37 36.085750000000004 37.0 37.0 37.0 37.0 37.0 38-39 36.09625 37.0 37.0 37.0 37.0 37.0 40-41 36.091499999999996 37.0 37.0 37.0 37.0 37.0 42-43 36.144000000000005 37.0 37.0 37.0 37.0 37.0 44-45 36.00025 37.0 37.0 37.0 37.0 37.0 46-47 36.0305 37.0 37.0 37.0 37.0 37.0 48-49 35.932249999999996 37.0 37.0 37.0 37.0 37.0 50-51 36.04425 37.0 37.0 37.0 37.0 37.0 52-53 35.993 37.0 37.0 37.0 37.0 37.0 54-55 36.066 37.0 37.0 37.0 37.0 37.0 56-57 36.072500000000005 37.0 37.0 37.0 37.0 37.0 58-59 35.9245 37.0 37.0 37.0 37.0 37.0 60-61 36.00725 37.0 37.0 37.0 37.0 37.0 62-63 36.030249999999995 37.0 37.0 37.0 37.0 37.0 64-65 36.045 37.0 37.0 37.0 37.0 37.0 66-67 36.0145 37.0 37.0 37.0 37.0 37.0 68-69 35.966499999999996 37.0 37.0 37.0 37.0 37.0 70-71 35.957750000000004 37.0 37.0 37.0 37.0 37.0 72-73 36.0065 37.0 37.0 37.0 37.0 37.0 74-75 35.97775 37.0 37.0 37.0 37.0 37.0 76-77 35.94975 37.0 37.0 37.0 37.0 37.0 78-79 35.91175 37.0 37.0 37.0 37.0 37.0 80-81 35.9375 37.0 37.0 37.0 37.0 37.0 82-83 35.9165 37.0 37.0 37.0 37.0 37.0 84-85 35.972750000000005 37.0 37.0 37.0 37.0 37.0 86-87 35.90275 37.0 37.0 37.0 37.0 37.0 88-89 35.919 37.0 37.0 37.0 37.0 37.0 90-91 35.836 37.0 37.0 37.0 37.0 37.0 92-93 35.88675 37.0 37.0 37.0 37.0 37.0 94-95 35.8665 37.0 37.0 37.0 37.0 37.0 96-97 35.81325 37.0 37.0 37.0 37.0 37.0 98-99 35.801500000000004 37.0 37.0 37.0 37.0 37.0 100-101 35.841499999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 2.0 25 4.0 26 4.0 27 11.0 28 25.0 29 35.0 30 56.0 31 45.0 32 74.0 33 99.0 34 169.0 35 320.0 36 2467.0 37 685.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.449999999999996 10.5 11.225 43.824999999999996 2 30.93198992443325 11.460957178841308 29.72292191435768 27.88413098236776 3 28.025 16.950000000000003 19.025 36.0 4 32.324999999999996 20.45 18.45 28.775000000000002 5 32.0 24.425 19.775000000000002 23.799999999999997 6 27.125 26.375 22.2 24.3 7 19.650000000000002 24.95 33.925 21.475 8 21.125 21.925 29.775000000000002 27.175 9 22.95 19.275000000000002 29.425 28.349999999999998 10-11 25.087500000000002 26.437500000000004 22.4625 26.0125 12-13 26.337500000000002 21.987499999999997 24.4125 27.2625 14-15 25.525 22.9625 25.35 26.1625 16-17 25.3125 24.3 23.474999999999998 26.9125 18-19 25.7125 23.200000000000003 23.775 27.3125 20-21 25.900000000000002 23.25 23.825 27.025 22-23 26.0625 23.9 23.225 26.8125 24-25 25.525 23.7375 22.9875 27.750000000000004 26-27 25.124999999999996 23.5375 23.95 27.3875 28-29 26.150000000000002 23.7875 23.1875 26.875 30-31 25.575 23.225 23.875 27.325 32-33 26.275 23.35 23.525 26.85 34-35 26.174999999999997 23.3375 23.75 26.737499999999997 36-37 26.174999999999997 22.55 23.075000000000003 28.199999999999996 38-39 25.5625 23.325000000000003 24.1625 26.950000000000003 40-41 25.650000000000002 22.900000000000002 23.6375 27.8125 42-43 25.637500000000003 23.2375 23.4625 27.6625 44-45 26.424999999999997 23.2875 23.0 27.287499999999998 46-47 26.3 23.225 22.95 27.525 48-49 26.724999999999998 22.7125 23.724999999999998 26.8375 50-51 26.025 22.912499999999998 23.474999999999998 27.5875 52-53 26.224999999999998 23.5625 23.1 27.1125 54-55 26.525 22.975 23.025000000000002 27.474999999999998 56-57 25.9625 23.9 22.825 27.3125 58-59 26.150000000000002 23.849999999999998 22.75 27.250000000000004 60-61 26.7125 23.525 22.3875 27.375 62-63 26.3 23.549999999999997 23.7875 26.3625 64-65 26.987499999999997 21.987499999999997 22.95 28.075 66-67 26.025 23.25 23.025000000000002 27.700000000000003 68-69 27.975 21.6875 23.0125 27.325 70-71 26.075 22.9875 23.3875 27.55 72-73 26.687499999999996 22.55 22.9375 27.825 74-75 27.1125 22.625 23.75 26.5125 76-77 26.8 22.2 23.25 27.750000000000004 78-79 27.075 22.825 23.075000000000003 27.025 80-81 27.325 22.5 22.8375 27.3375 82-83 27.1375 23.0375 22.6375 27.187499999999996 84-85 27.0125 22.9375 22.1875 27.8625 86-87 26.950000000000003 22.8 22.8 27.450000000000003 88-89 26.8 23.275000000000002 22.975 26.950000000000003 90-91 26.987499999999997 22.900000000000002 23.2375 26.875 92-93 28.012500000000003 23.1125 21.95 26.924999999999997 94-95 27.8375 23.9 22.3875 25.874999999999996 96-97 27.700000000000003 23.1625 22.5625 26.575 98-99 26.6125 23.549999999999997 23.275000000000002 26.5625 100-101 27.6875 22.287499999999998 22.85 27.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.5 23 3.0 24 0.5 25 2.0 26 4.0 27 3.5 28 2.0 29 3.0 30 7.0 31 8.5 32 11.0 33 16.0 34 17.0 35 26.5 36 37.0 37 41.5 38 60.5 39 77.0 40 90.5 41 108.5 42 121.0 43 131.5 44 134.5 45 140.0 46 148.5 47 148.5 48 139.0 49 133.0 50 127.5 51 112.0 52 101.5 53 108.0 54 109.0 55 95.5 56 93.5 57 87.5 58 83.5 59 89.0 60 81.5 61 75.0 62 92.0 63 94.0 64 88.0 65 96.0 66 98.5 67 100.5 68 91.5 69 79.5 70 64.5 71 65.5 72 58.5 73 47.0 74 48.0 75 46.5 76 44.0 77 28.5 78 16.5 79 14.0 80 13.0 81 10.5 82 10.5 83 7.0 84 2.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.75 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.675 #Duplication Level Percentage of deduplicated Percentage of total 1 93.78169202028289 87.85 2 5.764611689351481 10.8 3 0.4003202562049639 1.125 4 0.02668801708033093 0.1 5 0.02668801708033093 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTACGGCAGATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1125 0.0 0.0 0.0 0.0 48-49 0.175 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.1875 0.0 0.0 0.0 0.0 60-61 0.21250000000000002 0.0 0.0 0.0 0.0 62-63 0.2625 0.0 0.0 0.0 0.0 64-65 0.2875 0.0 0.0 0.0 0.0 66-67 0.3 0.0 0.0 0.0 0.0 68-69 0.35 0.0 0.0 0.0 0.0 70-71 0.42500000000000004 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.575 0.0 0.0 0.0 0.0 76-77 0.7 0.0 0.0 0.0 0.0 78-79 0.825 0.0 0.0 0.0 0.0 80-81 0.975 0.0 0.0 0.0 0.0 82-83 1.0 0.0 0.0 0.0 0.0 84-85 1.1375 0.0 0.0 0.0 0.0 86-87 1.3125 0.0 0.0 0.0 0.0 88-89 1.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11668429 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668429_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9145 37.0 37.0 37.0 37.0 37.0 2 35.729 37.0 37.0 37.0 37.0 37.0 3 35.9545 37.0 37.0 37.0 37.0 37.0 4 35.8335 37.0 37.0 37.0 37.0 37.0 5 35.986 37.0 37.0 37.0 37.0 37.0 6 35.856 37.0 37.0 37.0 37.0 37.0 7 35.92 37.0 37.0 37.0 37.0 37.0 8 35.9475 37.0 37.0 37.0 37.0 37.0 9 35.892 37.0 37.0 37.0 37.0 37.0 10-11 35.9215 37.0 37.0 37.0 37.0 37.0 12-13 36.03125 37.0 37.0 37.0 37.0 37.0 14-15 36.058 37.0 37.0 37.0 37.0 37.0 16-17 36.073 37.0 37.0 37.0 37.0 37.0 18-19 35.94475 37.0 37.0 37.0 37.0 37.0 20-21 35.9675 37.0 37.0 37.0 37.0 37.0 22-23 35.710125 37.0 37.0 37.0 37.0 37.0 24-25 36.058499999999995 37.0 37.0 37.0 37.0 37.0 26-27 35.91875 37.0 37.0 37.0 37.0 37.0 28-29 36.03275 37.0 37.0 37.0 37.0 37.0 30-31 35.804 37.0 37.0 37.0 37.0 37.0 32-33 35.829750000000004 37.0 37.0 37.0 37.0 37.0 34-35 35.854749999999996 37.0 37.0 37.0 37.0 37.0 36-37 35.7235 37.0 37.0 37.0 37.0 37.0 38-39 35.828375 37.0 37.0 37.0 37.0 37.0 40-41 35.85075 37.0 37.0 37.0 37.0 37.0 42-43 35.83625 37.0 37.0 37.0 37.0 37.0 44-45 35.7195 37.0 37.0 37.0 37.0 37.0 46-47 35.669875 37.0 37.0 37.0 37.0 37.0 48-49 35.699 37.0 37.0 37.0 37.0 37.0 50-51 35.838125000000005 37.0 37.0 37.0 37.0 37.0 52-53 35.74925 37.0 37.0 37.0 37.0 37.0 54-55 35.71275 37.0 37.0 37.0 37.0 37.0 56-57 35.70575 37.0 37.0 37.0 37.0 37.0 58-59 35.64 37.0 37.0 37.0 37.0 37.0 60-61 35.701375 37.0 37.0 37.0 37.0 37.0 62-63 35.65925 37.0 37.0 37.0 37.0 37.0 64-65 35.53375 37.0 37.0 37.0 37.0 37.0 66-67 35.71475 37.0 37.0 37.0 37.0 37.0 68-69 35.82025 37.0 37.0 37.0 37.0 37.0 70-71 35.64675 37.0 37.0 37.0 37.0 37.0 72-73 35.62525 37.0 37.0 37.0 37.0 37.0 74-75 35.814750000000004 37.0 37.0 37.0 37.0 37.0 76-77 35.67125 37.0 37.0 37.0 37.0 37.0 78-79 35.6295 37.0 37.0 37.0 37.0 37.0 80-81 35.577749999999995 37.0 37.0 37.0 37.0 37.0 82-83 35.672 37.0 37.0 37.0 37.0 37.0 84-85 35.562 37.0 37.0 37.0 37.0 37.0 86-87 35.64425 37.0 37.0 37.0 37.0 37.0 88-89 35.60375 37.0 37.0 37.0 37.0 37.0 90-91 35.51275 37.0 37.0 37.0 37.0 37.0 92-93 35.444 37.0 37.0 37.0 37.0 37.0 94-95 35.52075 37.0 37.0 37.0 37.0 37.0 96-97 35.551500000000004 37.0 37.0 37.0 37.0 37.0 98-99 35.48125 37.0 37.0 37.0 37.0 37.0 100-101 35.32625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 3.0 16 0.0 17 0.0 18 0.0 19 2.0 20 2.0 21 3.0 22 9.0 23 9.0 24 5.0 25 11.0 26 19.0 27 27.0 28 24.0 29 30.0 30 46.0 31 45.0 32 77.0 33 119.0 34 183.0 35 502.0 36 2402.0 37 481.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.599999999999998 16.8 11.85 40.75 2 31.2 22.650000000000002 24.3 21.85 3 24.825 26.200000000000003 22.825 26.150000000000002 4 27.875 28.999999999999996 17.2 25.924999999999997 5 30.175 29.825000000000003 17.925 22.075 6 23.25 34.825 19.05 22.875 7 24.375 16.575 32.175 26.875 8 24.55 19.85 22.475 33.125 9 25.424999999999997 21.475 23.35 29.75 10-11 28.249999999999996 27.1625 17.962500000000002 26.625 12-13 27.675 20.599999999999998 22.5875 29.1375 14-15 26.487500000000004 23.4875 22.912499999999998 27.1125 16-17 27.425 22.25 22.125 28.199999999999996 18-19 26.687499999999996 24.087500000000002 21.912499999999998 27.3125 20-21 27.712500000000002 23.025000000000002 23.1625 26.1 22-23 26.35329416177022 24.20302537817227 21.965245655706962 27.47843480435054 24-25 26.300650325162582 22.798899449724864 23.424212106053027 27.47623811905953 26-27 26.8 22.9875 22.075 28.1375 28-29 28.225 23.5125 21.0625 27.200000000000003 30-31 27.250000000000004 23.65 21.55 27.55 32-33 26.969242310577645 23.518379594898725 22.418104526131533 27.094273568392097 34-35 27.3125 22.4375 22.1375 28.1125 36-37 27.276138069034516 23.311655827913956 21.635817908954476 27.776388194097045 38-39 26.473164018516204 22.99512073063931 22.970098836481924 27.561616414362568 40-41 28.1375 22.5875 21.9625 27.3125 42-43 27.544386096524132 23.030757689422355 22.305576394098527 27.11927981995499 44-45 27.545659244433324 23.079809857393045 21.95396547410558 27.420565424068048 46-47 27.336419366946078 22.982609783560616 22.294507694232454 27.386463155260856 48-49 26.857643232424316 22.39179384538404 23.34250688016012 27.408056042031525 50-51 27.79932440885775 22.594770424121105 22.557237582885026 27.048667584136123 52-53 27.165748622934398 23.097145718577867 21.807711567351028 27.929394091136707 54-55 27.595696772579437 22.42932199149362 22.004003002251686 27.970978233675257 56-57 27.231807951987996 22.768192048012004 22.48062015503876 27.51937984496124 58-59 28.60715178794699 22.418104526131533 21.780445111277817 27.19429857464366 60-61 27.885457046392396 21.8707015130674 22.608478179317242 27.635363261222956 62-63 27.86946736684171 22.493123280820203 22.58064516129032 27.056764191047762 64-65 27.74443610902726 23.118279569892472 21.142785696424106 27.994498624656167 66-67 27.200000000000003 23.724999999999998 22.7 26.375 68-69 27.975 22.8 22.075 27.150000000000002 70-71 28.294573643410853 22.643160790197552 21.24281070267567 27.819454863715933 72-73 27.800000000000004 22.6125 22.85 26.737499999999997 74-75 27.6125 23.225 21.837500000000002 27.325 76-77 27.487499999999997 22.9375 22.0625 27.5125 78-79 26.5375 22.675 22.900000000000002 27.8875 80-81 27.950000000000003 22.662499999999998 22.7125 26.674999999999997 82-83 28.4 21.7 21.8125 28.0875 84-85 28.449999999999996 21.6625 22.725 27.1625 86-87 27.6875 23.425 21.825 27.0625 88-89 27.55 22.4875 21.912499999999998 28.050000000000004 90-91 27.750000000000004 21.8125 22.287499999999998 28.15 92-93 28.3125 23.375 21.575 26.737499999999997 94-95 28.499999999999996 22.5625 22.2 26.737499999999997 96-97 28.5875 23.2125 21.4 26.8 98-99 28.012500000000003 23.825 21.9625 26.200000000000003 100-101 28.762500000000003 22.412499999999998 21.775 27.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.5 22 2.5 23 1.0 24 1.0 25 1.0 26 2.5 27 3.5 28 2.5 29 3.5 30 5.5 31 6.0 32 8.0 33 13.0 34 19.0 35 25.0 36 32.5 37 44.0 38 52.5 39 65.0 40 82.5 41 94.0 42 96.5 43 104.0 44 129.5 45 140.5 46 139.0 47 141.5 48 138.0 49 129.0 50 114.0 51 102.5 52 102.5 53 102.5 54 96.0 55 98.0 56 97.5 57 90.0 58 87.0 59 83.5 60 99.0 61 115.0 62 102.0 63 88.0 64 88.5 65 96.0 66 100.0 67 93.0 68 102.0 69 102.0 70 86.5 71 82.5 72 73.5 73 62.0 74 50.5 75 41.5 76 34.0 77 22.0 78 23.0 79 23.0 80 15.0 81 12.0 82 8.5 83 7.0 84 5.0 85 2.5 86 0.5 87 0.0 88 1.0 89 1.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 1.0 99 1.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0125 24-25 0.05 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.025 34-35 0.0 36-37 0.05 38-39 0.08750000000000001 40-41 0.0 42-43 0.025 44-45 0.075 46-47 0.08750000000000001 48-49 0.075 50-51 0.08750000000000001 52-53 0.15 54-55 0.075 56-57 0.025 58-59 0.025 60-61 0.0375 62-63 0.025 64-65 0.025 66-67 0.0 68-69 0.0 70-71 0.025 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.625 #Duplication Level Percentage of deduplicated Percentage of total 1 93.83177570093459 87.85 2 5.68758344459279 10.65 3 0.3738317757009346 1.05 4 0.0534045393858478 0.2 5 0.0534045393858478 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACC 5 0.125 No Hit CCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.1375 0.0 0.0 0.0 0.0 60-61 0.16249999999999998 0.0 0.0 0.0 0.0 62-63 0.21250000000000002 0.0 0.0 0.0 0.0 64-65 0.2375 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.30000000000000004 0.0 0.0 0.0 0.0 70-71 0.375 0.0 0.0 0.0 0.0 72-73 0.42500000000000004 0.0 0.0 0.0 0.0 74-75 0.525 0.0 0.0 0.0 0.0 76-77 0.65 0.0 0.0 0.0 0.0 78-79 0.775 0.0 0.0 0.0 0.0 80-81 0.925 0.0 0.0 0.0 0.0 82-83 0.9624999999999999 0.0 0.0 0.0 0.0 84-85 1.125 0.0 0.0 0.0 0.0 86-87 1.3625 0.0 0.0 0.0 0.0 88-89 1.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566891 spots for SRR11668429.sra Written 2566891 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra Read 2566873 spots for SRR11668429.sra Written 2566873 spots for SRR11668429.sra SRR ids: ['SRR11668429.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w7xkvtjs SRR11668429.sra spots: 51337478 blocks: [[1, 2566873], [2566874, 5133746], [5133747, 7700619], [7700620, 10267492], [10267493, 12834365], [12834366, 15401238], [15401239, 17968111], [17968112, 20534984], [20534985, 23101857], [23101858, 25668730], [25668731, 28235603], [28235604, 30802476], [30802477, 33369349], [33369350, 35936222], [35936223, 38503095], [38503096, 41069968], [41069969, 43636841], [43636842, 46203714], [46203715, 48770587], [48770588, 51337478]] SRR11668429 file size 12411595 SRR11668429 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11668429 SRR11668429_1.fastq SRR11668429_2.fastq Input file: SRR11668429_1.fastq Paired file: SRR11668429_2.fastq trimmed: SRR11668429-trimmed-pair1.fastq, SRR11668429-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:38:49 2024 >> started Fri Dec 6 10:39:37 2024 >> done (47.754s) 51337478 read pairs processed; of these: 7877 ( 0.02%) short read pairs filtered out after trimming by size control 138430 ( 0.27%) empty read pairs filtered out after trimming by size control 51191171 (99.72%) read pairs available; of these: 1827304 ( 3.57%) trimmed read pairs available after processing 49363867 (96.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 235 0.00% 19 200 0.00% 20 200 0.00% 21 191 0.00% 22 157 0.00% 23 148 0.00% 24 142 0.00% 25 173 0.00% 26 154 0.00% 27 179 0.00% 28 181 0.00% 29 271 0.00% 30 226 0.00% 31 276 0.00% 32 336 0.00% 33 268 0.00% 34 304 0.00% 35 289 0.00% 36 418 0.00% 37 346 0.00% 38 363 0.00% 39 438 0.00% 40 497 0.00% 41 546 0.00% 42 591 0.00% 43 535 0.00% 44 633 0.00% 45 619 0.00% 46 786 0.00% 47 825 0.00% 48 1012 0.00% 49 1174 0.00% 50 1288 0.00% 51 1515 0.00% 52 1574 0.00% 53 1727 0.00% 54 1805 0.00% 55 1978 0.00% 56 2101 0.00% 57 2397 0.00% 58 2769 0.01% 59 3215 0.01% 60 3510 0.01% 61 4018 0.01% 62 4456 0.01% 63 4915 0.01% 64 5374 0.01% 65 5960 0.01% 66 6405 0.01% 67 7456 0.01% 68 7910 0.02% 69 9055 0.02% 70 10141 0.02% 71 11468 0.02% 72 12558 0.02% 73 14111 0.03% 74 15786 0.03% 75 17653 0.03% 76 19162 0.04% 77 20896 0.04% 78 22700 0.04% 79 25322 0.05% 80 27869 0.05% 81 30872 0.06% 82 34484 0.07% 83 38180 0.07% 84 42254 0.08% 85 46373 0.09% 86 50503 0.10% 87 54722 0.11% 88 59019 0.12% 89 63154 0.12% 90 67428 0.13% 91 73822 0.14% 92 80491 0.16% 93 87095 0.17% 94 94781 0.19% 95 102173 0.20% 96 108472 0.21% 97 116857 0.23% 98 123306 0.24% 99 127728 0.25% 100 135783 0.27% 101 49363867 96.43% 51191171 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=22 prefix-density=0.59 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=14.91 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.8 sequence=TTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=18 prefix-density=0.50 prefix-fanout=2.4 sequence=TGAAGCAGATCGAGTA criterion=fanout-score sequence-density=0.20 sequence-density-rank=23 fanout-score=147.24 fanout-score-rank=1 prefix-density=1.48 prefix-fanout=19.8 sequence=GCCGCCGCCGCC SRR11668429 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:41:07 Started mapping on | Dec 06 10:41:14 Finished on | Dec 06 10:43:26 Mapping speed, Million of reads per hour | 1396.12 Number of input reads | 51191171 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 48384256 Uniquely mapped reads % | 94.52% Average mapped length | 200.52 Number of splices: Total | 27072739 Number of splices: Annotated (sjdb) | 25725421 Number of splices: GT/AG | 26706121 Number of splices: GC/AG | 310657 Number of splices: AT/AC | 10285 Number of splices: Non-canonical | 45676 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.10 Insertion rate per base | 0.01% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1822621 % of reads mapped to multiple loci | 3.56% Number of reads mapped to too many loci | 63185 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.16% % of reads unmapped: other | 0.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 984294 984294 984294 N_multimapping 1822621 1822621 1822621 N_noFeature 1221389 47082830 1735862 N_ambiguous 1025750 5558 254177 UnstrandedReadsAssigned:46137117 PositiveStrandReadsAssigned:1295868 NegativeStrandReadsAssigned:46394217 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11668429 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11668429-trimmed-pair1.fastq SRR11668429-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 51,191,171 reads, 47,955,140 reads pseudoaligned [quant] estimated average fragment length: 209.517 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,228 rounds 52973 SRR11668429.ke.tsv 35125 SRR11668429.se.tsv 88098 total ==> SRR11668429.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 727.619 0 0 PNS24247 1044 835.483 57.4365 1.98639 PNS24249 1928 1719.48 394.7 6.6326 PNS24246 1044 835.483 57.4365 1.98639 PNS24248 1044 835.483 57.4365 1.98639 PNS24244 1471 1262.48 79.9907 1.83075 PNS24243 293 119.304 0 0 KQK14069 1603 1394.48 4601.97 95.3553 KQK14071 474 273.477 318.522 33.6537 ==> SRR11668429.se.tsv <== BRADI_1g14170v3 5649 BRADI_1g53295v3 43 BRADI_1g59795v3 559 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 2493 BRADI_1g74790v3 263 BRADI_1g09890v3 13 BRADI_1g77505v3 528 BRADI_1g48960v3 0 SRR11668429 completed mapping pipeline successfully