Starting /dee2/code/volunteer_pipeline.sh SRR11668430 current disk space = 1551616659456 free memory = 1605453336 SRR11668430 SRAfilesize 11d251014289225cf78c8bce15ea411c SRR11668430.sra SRR11668430.sra file validated SRR11668430 is paired end SRR11668430 is conventional basespace SRR11668430 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668430_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.192 37.0 37.0 37.0 37.0 37.0 2 35.862 37.0 37.0 37.0 37.0 37.0 3 36.234 37.0 37.0 37.0 37.0 37.0 4 36.28425 37.0 37.0 37.0 37.0 37.0 5 36.341 37.0 37.0 37.0 37.0 37.0 6 36.3055 37.0 37.0 37.0 37.0 37.0 7 36.127 37.0 37.0 37.0 37.0 37.0 8 36.147 37.0 37.0 37.0 37.0 37.0 9 36.3025 37.0 37.0 37.0 37.0 37.0 10-11 36.2245 37.0 37.0 37.0 37.0 37.0 12-13 36.26675 37.0 37.0 37.0 37.0 37.0 14-15 36.20225 37.0 37.0 37.0 37.0 37.0 16-17 36.223 37.0 37.0 37.0 37.0 37.0 18-19 36.224500000000006 37.0 37.0 37.0 37.0 37.0 20-21 36.145250000000004 37.0 37.0 37.0 37.0 37.0 22-23 36.24225 37.0 37.0 37.0 37.0 37.0 24-25 36.16974999999999 37.0 37.0 37.0 37.0 37.0 26-27 36.1495 37.0 37.0 37.0 37.0 37.0 28-29 36.064750000000004 37.0 37.0 37.0 37.0 37.0 30-31 36.18475 37.0 37.0 37.0 37.0 37.0 32-33 36.14725 37.0 37.0 37.0 37.0 37.0 34-35 36.06375 37.0 37.0 37.0 37.0 37.0 36-37 36.043 37.0 37.0 37.0 37.0 37.0 38-39 36.041250000000005 37.0 37.0 37.0 37.0 37.0 40-41 36.11025 37.0 37.0 37.0 37.0 37.0 42-43 36.04600000000001 37.0 37.0 37.0 37.0 37.0 44-45 35.98725 37.0 37.0 37.0 37.0 37.0 46-47 36.045500000000004 37.0 37.0 37.0 37.0 37.0 48-49 36.011250000000004 37.0 37.0 37.0 37.0 37.0 50-51 35.9925 37.0 37.0 37.0 37.0 37.0 52-53 35.988749999999996 37.0 37.0 37.0 37.0 37.0 54-55 35.92575 37.0 37.0 37.0 37.0 37.0 56-57 35.99625 37.0 37.0 37.0 37.0 37.0 58-59 35.9005 37.0 37.0 37.0 37.0 37.0 60-61 35.959999999999994 37.0 37.0 37.0 37.0 37.0 62-63 36.019999999999996 37.0 37.0 37.0 37.0 37.0 64-65 35.91175 37.0 37.0 37.0 37.0 37.0 66-67 35.968 37.0 37.0 37.0 37.0 37.0 68-69 35.77175 37.0 37.0 37.0 37.0 37.0 70-71 35.76275 37.0 37.0 37.0 37.0 37.0 72-73 35.98725 37.0 37.0 37.0 37.0 37.0 74-75 35.9185 37.0 37.0 37.0 37.0 37.0 76-77 35.8925 37.0 37.0 37.0 37.0 37.0 78-79 35.8855 37.0 37.0 37.0 37.0 37.0 80-81 35.952 37.0 37.0 37.0 37.0 37.0 82-83 35.8425 37.0 37.0 37.0 37.0 37.0 84-85 35.97125 37.0 37.0 37.0 37.0 37.0 86-87 35.851749999999996 37.0 37.0 37.0 37.0 37.0 88-89 35.852 37.0 37.0 37.0 37.0 37.0 90-91 35.84825 37.0 37.0 37.0 37.0 37.0 92-93 35.756249999999994 37.0 37.0 37.0 37.0 37.0 94-95 35.7825 37.0 37.0 37.0 37.0 37.0 96-97 35.7605 37.0 37.0 37.0 37.0 37.0 98-99 35.896249999999995 37.0 37.0 37.0 37.0 37.0 100-101 35.70525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 3.0 26 9.0 27 16.0 28 17.0 29 43.0 30 40.0 31 67.0 32 76.0 33 113.0 34 165.0 35 354.0 36 2446.0 37 649.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.75 10.424999999999999 13.325000000000001 42.5 2 30.656565656565654 11.893939393939394 28.81313131313131 28.636363636363637 3 28.275 17.150000000000002 21.45 33.125 4 32.749562171628725 20.89066800100075 17.112834625969477 29.246935201401055 5 30.599999999999998 25.374999999999996 19.825 24.2 6 26.525 28.4 21.8 23.275000000000002 7 18.3 25.825 33.575 22.3 8 21.275 22.25 27.85 28.625 9 23.925 20.150000000000002 30.4 25.525 10-11 24.7875 28.1125 22.662499999999998 24.4375 12-13 25.55 22.412499999999998 25.124999999999996 26.9125 14-15 26.0 23.674999999999997 23.962500000000002 26.3625 16-17 26.450000000000003 24.349999999999998 23.1875 26.0125 18-19 25.924999999999997 24.55 23.674999999999997 25.85 20-21 26.1 23.5125 24.175 26.2125 22-23 24.8625 24.5 24.474999999999998 26.1625 24-25 25.624999999999996 23.6625 23.775 26.937499999999996 26-27 25.224999999999998 23.599999999999998 23.45 27.725 28-29 25.162499999999998 23.575 23.3375 27.925 30-31 25.85 23.775 22.8625 27.5125 32-33 25.15 24.349999999999998 22.8625 27.6375 34-35 25.687500000000004 23.5875 23.7625 26.9625 36-37 26.4625 23.4125 22.975 27.150000000000002 38-39 25.8 24.175 22.8875 27.1375 40-41 25.587500000000002 24.1875 22.8125 27.4125 42-43 25.3125 24.15 23.45 27.0875 44-45 26.6 23.25 23.025000000000002 27.125 46-47 26.025 24.05 23.0 26.924999999999997 48-49 25.8625 23.0875 24.212500000000002 26.8375 50-51 25.8125 24.224999999999998 22.9625 27.0 52-53 25.3 23.974999999999998 23.8375 26.887499999999996 54-55 25.337500000000002 24.0625 23.9375 26.6625 56-57 26.400000000000002 22.7625 23.35 27.487499999999997 58-59 25.224999999999998 23.775 23.325000000000003 27.675 60-61 26.85 23.95 22.3625 26.8375 62-63 24.9875 23.275000000000002 23.225 28.512500000000003 64-65 27.025 22.525000000000002 23.45 27.0 66-67 25.137500000000003 24.5125 23.3875 26.9625 68-69 26.150000000000002 23.7375 23.1125 27.0 70-71 27.150000000000002 23.674999999999997 22.525000000000002 26.650000000000002 72-73 25.900000000000002 22.6375 24.087500000000002 27.375 74-75 27.150000000000002 23.2625 22.9625 26.625 76-77 26.2625 23.4625 22.9875 27.287499999999998 78-79 26.3125 23.8625 23.175 26.650000000000002 80-81 27.125 22.925 23.2625 26.687499999999996 82-83 26.387500000000003 23.775 22.112499999999997 27.725 84-85 27.0125 23.0875 23.1875 26.7125 86-87 27.750000000000004 22.95 22.625 26.674999999999997 88-89 26.987499999999997 23.35 22.475 27.187499999999996 90-91 27.462500000000002 23.1625 23.325000000000003 26.05 92-93 27.6375 23.25 22.650000000000002 26.4625 94-95 26.9625 23.8625 22.275 26.900000000000002 96-97 27.675 23.375 23.5375 25.412499999999998 98-99 27.3625 23.400000000000002 22.45 26.787499999999998 100-101 26.987499999999997 23.549999999999997 22.325 27.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 3.5 28 3.5 29 3.0 30 7.0 31 10.5 32 11.5 33 15.5 34 23.0 35 28.5 36 45.5 37 55.5 38 55.5 39 76.5 40 96.0 41 109.0 42 125.0 43 135.5 44 146.5 45 160.0 46 167.0 47 150.0 48 141.0 49 152.0 50 145.0 51 128.5 52 117.0 53 100.0 54 96.5 55 92.5 56 81.5 57 78.5 58 76.5 59 75.0 60 75.0 61 80.5 62 80.5 63 82.5 64 92.5 65 84.5 66 81.5 67 85.5 68 78.5 69 75.0 70 64.5 71 57.5 72 56.0 73 50.5 74 45.0 75 41.0 76 36.5 77 31.0 78 23.0 79 17.0 80 11.5 81 10.5 82 9.0 83 5.5 84 5.0 85 3.0 86 1.5 87 1.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.0 3 0.0 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.2632713554298 86.52499999999999 2 6.197790353004581 11.5 3 0.4850444624090542 1.35 4 0.0 0.0 5 0.026946914578280787 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026946914578280787 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTCGAAATATCTCGTAT 20 0.5 TruSeq Adapter, Index 12 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTCGAAATATCGCGTAT 5 0.125 TruSeq Adapter, Index 12 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0125 0.0 0.0 56-57 0.125 0.0 0.025 0.0 0.0 58-59 0.1375 0.0 0.025 0.0 0.0 60-61 0.175 0.0 0.025 0.0 0.0 62-63 0.175 0.0 0.025 0.0 0.0 64-65 0.2 0.0 0.025 0.0 0.0 66-67 0.2375 0.0 0.025 0.0 0.0 68-69 0.25 0.0 0.025 0.0 0.0 70-71 0.25 0.0 0.025 0.0 0.0 72-73 0.2625 0.0 0.025 0.0 0.0 74-75 0.32499999999999996 0.0 0.025 0.0 0.0 76-77 0.4 0.0 0.025 0.0 0.0 78-79 0.4875 0.0 0.025 0.0 0.0 80-81 0.5375000000000001 0.0 0.025 0.0 0.0 82-83 0.675 0.0 0.025 0.0 0.0 84-85 0.7375 0.0 0.025 0.0 0.0 86-87 0.9125 0.0 0.025 0.0 0.0 88-89 1.125 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11668430 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668430_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0235 37.0 37.0 37.0 37.0 37.0 2 35.8645 37.0 37.0 37.0 37.0 37.0 3 35.981 37.0 37.0 37.0 37.0 37.0 4 35.992 37.0 37.0 37.0 37.0 37.0 5 36.254 37.0 37.0 37.0 37.0 37.0 6 36.086 37.0 37.0 37.0 37.0 37.0 7 35.9645 37.0 37.0 37.0 37.0 37.0 8 36.106 37.0 37.0 37.0 37.0 37.0 9 36.098 37.0 37.0 37.0 37.0 37.0 10-11 36.0655 37.0 37.0 37.0 37.0 37.0 12-13 36.036249999999995 37.0 37.0 37.0 37.0 37.0 14-15 36.071 37.0 37.0 37.0 37.0 37.0 16-17 36.122 37.0 37.0 37.0 37.0 37.0 18-19 36.06675 37.0 37.0 37.0 37.0 37.0 20-21 36.0185 37.0 37.0 37.0 37.0 37.0 22-23 35.710625 37.0 37.0 37.0 37.0 37.0 24-25 35.938125 37.0 37.0 37.0 37.0 37.0 26-27 36.03675 37.0 37.0 37.0 37.0 37.0 28-29 35.9875 37.0 37.0 37.0 37.0 37.0 30-31 35.926500000000004 37.0 37.0 37.0 37.0 37.0 32-33 35.867374999999996 37.0 37.0 37.0 37.0 37.0 34-35 35.8865 37.0 37.0 37.0 37.0 37.0 36-37 35.792125 37.0 37.0 37.0 37.0 37.0 38-39 35.994749999999996 37.0 37.0 37.0 37.0 37.0 40-41 35.9015 37.0 37.0 37.0 37.0 37.0 42-43 35.806375 37.0 37.0 37.0 37.0 37.0 44-45 35.79625 37.0 37.0 37.0 37.0 37.0 46-47 35.807500000000005 37.0 37.0 37.0 37.0 37.0 48-49 35.87 37.0 37.0 37.0 37.0 37.0 50-51 35.897625 37.0 37.0 37.0 37.0 37.0 52-53 35.809250000000006 37.0 37.0 37.0 37.0 37.0 54-55 35.72425 37.0 37.0 37.0 37.0 37.0 56-57 35.76625 37.0 37.0 37.0 37.0 37.0 58-59 35.707375 37.0 37.0 37.0 37.0 37.0 60-61 35.882875 37.0 37.0 37.0 37.0 37.0 62-63 35.895125 37.0 37.0 37.0 37.0 37.0 64-65 35.666375 37.0 37.0 37.0 37.0 37.0 66-67 35.82425 37.0 37.0 37.0 37.0 37.0 68-69 35.765625 37.0 37.0 37.0 37.0 37.0 70-71 35.691375 37.0 37.0 37.0 37.0 37.0 72-73 35.686 37.0 37.0 37.0 37.0 37.0 74-75 35.815749999999994 37.0 37.0 37.0 37.0 37.0 76-77 35.69475 37.0 37.0 37.0 37.0 37.0 78-79 35.7405 37.0 37.0 37.0 37.0 37.0 80-81 35.58175 37.0 37.0 37.0 37.0 37.0 82-83 35.82925 37.0 37.0 37.0 37.0 37.0 84-85 35.713499999999996 37.0 37.0 37.0 37.0 37.0 86-87 35.745 37.0 37.0 37.0 37.0 37.0 88-89 35.7975 37.0 37.0 37.0 37.0 37.0 90-91 35.71925 37.0 37.0 37.0 37.0 37.0 92-93 35.67575 37.0 37.0 37.0 37.0 37.0 94-95 35.602999999999994 37.0 37.0 37.0 37.0 37.0 96-97 35.68025 37.0 37.0 37.0 37.0 37.0 98-99 35.62525 37.0 37.0 37.0 37.0 37.0 100-101 35.489 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 3.0 16 1.0 17 0.0 18 3.0 19 3.0 20 6.0 21 6.0 22 7.0 23 11.0 24 10.0 25 4.0 26 8.0 27 15.0 28 18.0 29 29.0 30 30.0 31 47.0 32 65.0 33 114.0 34 143.0 35 489.0 36 2380.0 37 605.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.15 16.675 12.35 38.824999999999996 2 31.874999999999996 22.625 26.075 19.425 3 25.775 25.650000000000002 23.075000000000003 25.5 4 28.925 28.125 18.4 24.55 5 31.15 30.0 18.65 20.200000000000003 6 22.85 33.85 19.975 23.325000000000003 7 24.425 17.0 33.175 25.4 8 25.5 20.225 23.45 30.825000000000003 9 27.6 18.95 24.05 29.4 10-11 28.237499999999997 26.674999999999997 19.125 25.9625 12-13 27.437499999999996 20.625 22.8875 29.049999999999997 14-15 27.0125 24.0125 21.925 27.05 16-17 27.35 22.900000000000002 22.775000000000002 26.974999999999998 18-19 26.55 23.7 22.6 27.150000000000002 20-21 27.5875 24.075 23.200000000000003 25.137500000000003 22-23 27.69096137017127 23.502937867233403 21.915239404925615 26.89086135766971 24-25 27.415926990873857 23.502937867233403 21.852731591448933 27.228403550443808 26-27 27.224999999999998 23.9875 22.05 26.737499999999997 28-29 27.725 22.975 21.75 27.55 30-31 27.800000000000004 22.5625 22.650000000000002 26.987499999999997 32-33 27.55344418052256 22.82785348168521 21.915239404925615 27.703462932866607 34-35 27.525 22.55 22.525000000000002 27.400000000000002 36-37 26.915864483060382 23.91548943617952 22.452806600825102 26.715839479934996 38-39 27.776388194097045 22.736368184092047 22.861430715357677 26.625812906453227 40-41 28.675 22.45 22.5625 26.3125 42-43 27.19089886235779 23.702962870358796 22.215276909613703 26.89086135766971 44-45 28.057014253563388 23.55588897224306 21.742935733933482 26.644161040260066 46-47 27.981995498874717 23.10577644411103 22.343085771442862 26.569142285571395 48-49 27.11927981995499 23.768442110527634 21.9679919979995 27.144286071517882 50-51 28.017510944340213 23.864915572232643 21.82614133833646 26.29143214509068 52-53 27.5887943971986 22.998999499749875 21.96098049024512 27.4512256128064 54-55 27.394348587146787 22.88072018004501 22.868217054263564 26.85671417854464 56-57 28.19454863715929 22.755688922230558 22.443110777694425 26.60665166291573 58-59 27.965995749468686 22.42780347543443 22.215276909613703 27.390923865483185 60-61 26.95336917114639 23.265408176022003 22.90286285785723 26.878359794974372 62-63 27.91598949868734 22.727840980122515 22.402800350043755 26.95336917114639 64-65 27.50343792974122 22.502812851606453 22.39029878734842 27.603450431303912 66-67 28.0625 23.05 22.2 26.687499999999996 68-69 27.590948868608578 23.177897237154642 22.240280035004375 26.990873859232405 70-71 27.665958244780597 22.027753469183647 22.765345668208525 27.54094261782723 72-73 26.825 23.1125 22.3 27.762500000000003 74-75 28.275 22.912499999999998 21.8625 26.950000000000003 76-77 27.400000000000002 22.675 22.237499999999997 27.6875 78-79 27.9125 22.875 22.725 26.487500000000004 80-81 27.962500000000002 23.5375 22.45 26.05 82-83 27.700000000000003 22.475 22.3125 27.5125 84-85 27.0125 23.35 22.975 26.6625 86-87 27.537499999999998 23.5875 22.0625 26.8125 88-89 28.050000000000004 22.7375 22.0875 27.125 90-91 27.725 22.1875 23.225 26.8625 92-93 28.299999999999997 23.974999999999998 21.912499999999998 25.8125 94-95 28.3625 24.2625 21.2 26.174999999999997 96-97 27.975 23.400000000000002 22.6375 25.9875 98-99 27.775 23.25 22.825 26.150000000000002 100-101 28.375 22.8625 22.6125 26.150000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 0.5 25 0.0 26 0.0 27 0.5 28 2.5 29 5.0 30 6.5 31 7.0 32 9.0 33 15.0 34 15.5 35 25.0 36 34.5 37 38.5 38 58.0 39 74.5 40 82.5 41 98.5 42 117.5 43 129.5 44 140.0 45 137.5 46 137.5 47 132.0 48 140.5 49 141.0 50 120.0 51 123.0 52 120.0 53 102.5 54 93.5 55 88.0 56 85.5 57 87.0 58 85.5 59 94.5 60 97.0 61 91.5 62 89.0 63 84.5 64 83.5 65 94.5 66 111.0 67 107.0 68 84.0 69 69.5 70 67.5 71 69.5 72 65.5 73 57.5 74 54.0 75 44.5 76 34.5 77 29.0 78 23.0 79 19.5 80 14.0 81 12.0 82 10.5 83 6.5 84 3.0 85 3.0 86 2.5 87 0.5 88 1.5 89 1.0 90 1.0 91 1.5 92 1.0 93 0.5 94 0.5 95 1.5 96 2.0 97 1.5 98 1.5 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0125 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0125 34-35 0.0 36-37 0.0125 38-39 0.05 40-41 0.0 42-43 0.0125 44-45 0.025 46-47 0.025 48-49 0.025 50-51 0.0625 52-53 0.05 54-55 0.025 56-57 0.025 58-59 0.0125 60-61 0.0125 62-63 0.0125 64-65 0.0125 66-67 0.0 68-69 0.0125 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.2 #Duplication Level Percentage of deduplicated Percentage of total 1 93.21351931330472 86.875 2 6.303648068669528 11.75 3 0.4560085836909871 1.275 4 0.02682403433476395 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.1375 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2375 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.30000000000000004 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.5375000000000001 0.0 0.0 0.0 0.0 82-83 0.675 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.9125 0.0 0.0 0.0 0.0 88-89 1.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190956 spots for SRR11668430.sra Written 3190956 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra Read 3190945 spots for SRR11668430.sra Written 3190945 spots for SRR11668430.sra SRR ids: ['SRR11668430.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tbjj43p8 SRR11668430.sra spots: 63818911 blocks: [[1, 3190945], [3190946, 6381890], [6381891, 9572835], [9572836, 12763780], [12763781, 15954725], [15954726, 19145670], [19145671, 22336615], [22336616, 25527560], [25527561, 28718505], [28718506, 31909450], [31909451, 35100395], [35100396, 38291340], [38291341, 41482285], [41482286, 44673230], [44673231, 47864175], [47864176, 51055120], [51055121, 54246065], [54246066, 57437010], [57437011, 60627955], [60627956, 63818911]] SRR11668430 file size 15434442 SRR11668430 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11668430 SRR11668430_1.fastq SRR11668430_2.fastq Input file: SRR11668430_1.fastq Paired file: SRR11668430_2.fastq trimmed: SRR11668430-trimmed-pair1.fastq, SRR11668430-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:46:38 2024 >> started Fri Dec 6 10:47:37 2024 >> done (58.870s) 63818911 read pairs processed; of these: 5409 ( 0.01%) short read pairs filtered out after trimming by size control 332427 ( 0.52%) empty read pairs filtered out after trimming by size control 63481075 (99.47%) read pairs available; of these: 2226768 ( 3.51%) trimmed read pairs available after processing 61254307 (96.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 144 0.00% 19 140 0.00% 20 117 0.00% 21 146 0.00% 22 121 0.00% 23 145 0.00% 24 118 0.00% 25 146 0.00% 26 175 0.00% 27 180 0.00% 28 230 0.00% 29 292 0.00% 30 294 0.00% 31 365 0.00% 32 411 0.00% 33 385 0.00% 34 484 0.00% 35 406 0.00% 36 637 0.00% 37 541 0.00% 38 615 0.00% 39 688 0.00% 40 808 0.00% 41 852 0.00% 42 844 0.00% 43 986 0.00% 44 955 0.00% 45 1004 0.00% 46 1165 0.00% 47 1351 0.00% 48 1502 0.00% 49 1782 0.00% 50 1981 0.00% 51 2196 0.00% 52 2368 0.00% 53 2555 0.00% 54 2588 0.00% 55 2871 0.00% 56 3145 0.00% 57 3429 0.01% 58 3983 0.01% 59 4519 0.01% 60 5110 0.01% 61 5643 0.01% 62 6192 0.01% 63 6761 0.01% 64 7516 0.01% 65 7958 0.01% 66 8641 0.01% 67 10390 0.02% 68 10796 0.02% 69 11577 0.02% 70 13482 0.02% 71 14765 0.02% 72 16640 0.03% 73 18742 0.03% 74 20431 0.03% 75 22264 0.04% 76 24886 0.04% 77 26741 0.04% 78 29151 0.05% 79 31900 0.05% 80 35193 0.06% 81 38457 0.06% 82 42337 0.07% 83 47123 0.07% 84 51955 0.08% 85 56980 0.09% 86 62384 0.10% 87 66491 0.10% 88 71386 0.11% 89 76703 0.12% 90 82042 0.13% 91 89639 0.14% 92 96295 0.15% 93 104179 0.16% 94 113748 0.18% 95 120869 0.19% 96 128741 0.20% 97 137948 0.22% 98 145592 0.23% 99 151457 0.24% 100 159999 0.25% 101 61254307 96.49% 63481075 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=22 prefix-density=0.35 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=32 fanout-score=20.11 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=4.0 sequence=CCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=5.66 fanout-score-rank=9 prefix-density=0.46 prefix-fanout=4.2 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.14 sequence-density-rank=21 fanout-score=242.94 fanout-score-rank=1 prefix-density=1.35 prefix-fanout=24.5 sequence=CCGCCGCCGCCTCC SRR11668430 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:48:09 Started mapping on | Dec 06 10:48:09 Finished on | Dec 06 10:51:50 Mapping speed, Million of reads per hour | 1034.08 Number of input reads | 63481075 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 60779388 Uniquely mapped reads % | 95.74% Average mapped length | 200.51 Number of splices: Total | 36067045 Number of splices: Annotated (sjdb) | 34168124 Number of splices: GT/AG | 35565013 Number of splices: GC/AG | 420077 Number of splices: AT/AC | 18934 Number of splices: Non-canonical | 63021 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.11 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1464995 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 94227 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.11% % of reads unmapped: other | 0.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1236692 1236692 1236692 N_multimapping 1464995 1464995 1464995 N_noFeature 1582244 59176149 2184464 N_ambiguous 1260656 8512 274887 UnstrandedReadsAssigned:57936488 PositiveStrandReadsAssigned:1594727 NegativeStrandReadsAssigned:58320037 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11668430 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11668430-trimmed-pair1.fastq SRR11668430-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 63,481,075 reads, 59,530,938 reads pseudoaligned [quant] estimated average fragment length: 212.514 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52973 SRR11668430.ke.tsv 35125 SRR11668430.se.tsv 88098 total ==> SRR11668430.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 724.761 0 0 PNS24247 1044 832.486 83.0197 2.33754 PNS24249 1928 1716.49 691.468 9.44248 PNS24246 1044 832.486 83.0197 2.33754 PNS24248 1044 832.486 83.0197 2.33754 PNS24244 1471 1259.49 116.473 2.16764 PNS24243 293 116.818 0 0 KQK14069 1603 1391.49 10887.4 183.4 KQK14071 474 270.909 642.09 55.5555 ==> SRR11668430.se.tsv <== BRADI_1g14170v3 12207 BRADI_1g53295v3 161 BRADI_1g59795v3 1281 BRADI_1g07683v3 0 BRADI_1g00485v3 82 BRADI_1g20270v3 7840 BRADI_1g74790v3 646 BRADI_1g09890v3 12 BRADI_1g77505v3 751 BRADI_1g48960v3 3 SRR11668430 completed mapping pipeline successfully