Starting /dee2/code/volunteer_pipeline.sh SRR11668431 current disk space = 1544133689344 free memory = 1601227852 SRR11668431 SRAfilesize 0b36eefe6e2fc48a4a59e74aa0368bca SRR11668431.sra SRR11668431.sra file validated SRR11668431 is paired end SRR11668431 is conventional basespace SRR11668431 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668431_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.172 37.0 37.0 37.0 37.0 37.0 2 35.846 37.0 37.0 37.0 37.0 37.0 3 36.305 37.0 37.0 37.0 37.0 37.0 4 36.3545 37.0 37.0 37.0 37.0 37.0 5 36.3125 37.0 37.0 37.0 37.0 37.0 6 36.2525 37.0 37.0 37.0 37.0 37.0 7 36.215 37.0 37.0 37.0 37.0 37.0 8 36.168 37.0 37.0 37.0 37.0 37.0 9 36.27 37.0 37.0 37.0 37.0 37.0 10-11 36.23775 37.0 37.0 37.0 37.0 37.0 12-13 36.2655 37.0 37.0 37.0 37.0 37.0 14-15 36.1605 37.0 37.0 37.0 37.0 37.0 16-17 36.22525 37.0 37.0 37.0 37.0 37.0 18-19 36.20225000000001 37.0 37.0 37.0 37.0 37.0 20-21 36.2465 37.0 37.0 37.0 37.0 37.0 22-23 36.223 37.0 37.0 37.0 37.0 37.0 24-25 36.187250000000006 37.0 37.0 37.0 37.0 37.0 26-27 36.17225 37.0 37.0 37.0 37.0 37.0 28-29 36.127750000000006 37.0 37.0 37.0 37.0 37.0 30-31 36.10725 37.0 37.0 37.0 37.0 37.0 32-33 36.03025 37.0 37.0 37.0 37.0 37.0 34-35 36.08175 37.0 37.0 37.0 37.0 37.0 36-37 36.057 37.0 37.0 37.0 37.0 37.0 38-39 36.08175 37.0 37.0 37.0 37.0 37.0 40-41 36.06275 37.0 37.0 37.0 37.0 37.0 42-43 36.089 37.0 37.0 37.0 37.0 37.0 44-45 36.00625 37.0 37.0 37.0 37.0 37.0 46-47 35.998 37.0 37.0 37.0 37.0 37.0 48-49 35.92225 37.0 37.0 37.0 37.0 37.0 50-51 35.93275 37.0 37.0 37.0 37.0 37.0 52-53 35.839 37.0 37.0 37.0 37.0 37.0 54-55 35.87525 37.0 37.0 37.0 37.0 37.0 56-57 35.84525 37.0 37.0 37.0 37.0 37.0 58-59 35.899 37.0 37.0 37.0 37.0 37.0 60-61 35.8495 37.0 37.0 37.0 37.0 37.0 62-63 35.82575 37.0 37.0 37.0 37.0 37.0 64-65 35.85025 37.0 37.0 37.0 37.0 37.0 66-67 35.82 37.0 37.0 37.0 37.0 37.0 68-69 35.725 37.0 37.0 37.0 37.0 37.0 70-71 35.727999999999994 37.0 37.0 37.0 37.0 37.0 72-73 35.8555 37.0 37.0 37.0 37.0 37.0 74-75 35.93025 37.0 37.0 37.0 37.0 37.0 76-77 35.89825 37.0 37.0 37.0 37.0 37.0 78-79 35.769999999999996 37.0 37.0 37.0 37.0 37.0 80-81 35.894000000000005 37.0 37.0 37.0 37.0 37.0 82-83 35.8585 37.0 37.0 37.0 37.0 37.0 84-85 35.86875 37.0 37.0 37.0 37.0 37.0 86-87 35.97324999999999 37.0 37.0 37.0 37.0 37.0 88-89 35.884 37.0 37.0 37.0 37.0 37.0 90-91 35.814750000000004 37.0 37.0 37.0 37.0 37.0 92-93 35.7485 37.0 37.0 37.0 37.0 37.0 94-95 35.86625 37.0 37.0 37.0 37.0 37.0 96-97 35.71575 37.0 37.0 37.0 37.0 37.0 98-99 35.74 37.0 37.0 37.0 37.0 37.0 100-101 35.67175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 6.0 26 6.0 27 18.0 28 28.0 29 29.0 30 55.0 31 65.0 32 67.0 33 116.0 34 174.0 35 336.0 36 2511.0 37 586.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.15 10.45 11.95 44.45 2 29.252902574457345 11.736496718828874 30.969207470974258 28.041393235739527 3 27.750000000000004 17.925 19.725 34.599999999999994 4 30.64032016008004 22.26113056528264 17.58379189594797 29.514757378689342 5 32.925 24.275 20.0 22.8 6 25.525 28.625 21.65 24.2 7 18.175 25.55 34.599999999999994 21.675 8 20.925 22.650000000000002 29.2 27.224999999999998 9 23.9 19.950000000000003 29.975 26.174999999999997 10-11 24.1875 27.750000000000004 22.575 25.4875 12-13 25.1875 22.375 24.15 28.287499999999998 14-15 24.3875 24.2375 24.4 26.974999999999998 16-17 25.5125 23.7875 23.95 26.75 18-19 25.4 23.200000000000003 24.8125 26.5875 20-21 25.575 23.5875 24.675 26.1625 22-23 24.3875 24.775 23.0625 27.775 24-25 24.775 23.7875 23.6875 27.750000000000004 26-27 25.0375 23.8625 23.4875 27.6125 28-29 25.95 23.75 23.325000000000003 26.974999999999998 30-31 25.5375 23.400000000000002 24.425 26.637499999999996 32-33 24.587500000000002 24.7375 23.549999999999997 27.125 34-35 25.2125 24.3875 22.7125 27.6875 36-37 25.0375 24.25 23.2125 27.500000000000004 38-39 25.0 24.4125 23.575 27.0125 40-41 25.2625 24.05 23.425 27.2625 42-43 25.387500000000003 23.95 23.3875 27.275 44-45 25.662499999999998 24.1125 23.425 26.8 46-47 25.724999999999998 24.099999999999998 22.875 27.3 48-49 26.1125 23.6375 24.0125 26.237500000000004 50-51 26.1625 23.3125 23.3875 27.1375 52-53 25.687500000000004 24.375 23.05 26.887499999999996 54-55 24.887500000000003 23.525 23.8125 27.775 56-57 26.437500000000004 22.3625 24.5625 26.637499999999996 58-59 26.187500000000004 23.425 22.7375 27.650000000000002 60-61 25.7 23.549999999999997 23.1625 27.5875 62-63 26.375 23.125 24.1375 26.3625 64-65 26.575 22.675 23.625 27.125 66-67 25.900000000000002 23.825 23.0375 27.237499999999997 68-69 25.924999999999997 24.575 22.45 27.05 70-71 26.987499999999997 23.6625 22.625 26.724999999999998 72-73 25.900000000000002 23.375 23.075000000000003 27.650000000000002 74-75 26.224999999999998 23.8875 23.3125 26.575 76-77 26.85 23.200000000000003 22.825 27.125 78-79 26.974999999999998 23.6375 22.6875 26.700000000000003 80-81 27.3 23.849999999999998 23.225 25.624999999999996 82-83 26.087500000000002 23.5125 23.6875 26.7125 84-85 27.35 22.650000000000002 23.1 26.900000000000002 86-87 26.974999999999998 22.525000000000002 23.525 26.974999999999998 88-89 27.075 23.3625 22.7125 26.85 90-91 26.525 22.85 23.175 27.450000000000003 92-93 26.8375 23.05 22.8375 27.275 94-95 27.3125 23.75 22.5875 26.35 96-97 26.8625 23.599999999999998 23.125 26.4125 98-99 26.674999999999997 23.7875 22.975 26.5625 100-101 28.0875 23.962500000000002 22.425 25.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 2.0 27 4.0 28 6.0 29 7.0 30 6.0 31 9.0 32 13.0 33 13.0 34 17.5 35 32.0 36 42.0 37 42.5 38 61.0 39 83.5 40 94.5 41 110.0 42 129.5 43 139.0 44 143.0 45 149.0 46 150.0 47 147.0 48 159.0 49 160.0 50 143.5 51 128.0 52 117.0 53 115.0 54 109.0 55 97.0 56 97.0 57 94.0 58 70.5 59 68.0 60 75.0 61 73.0 62 74.5 63 81.0 64 78.5 65 73.5 66 70.5 67 78.5 68 93.0 69 87.5 70 75.0 71 62.0 72 57.0 73 52.0 74 44.5 75 38.0 76 24.5 77 19.5 78 22.5 79 19.5 80 12.0 81 7.0 82 7.0 83 6.0 84 2.0 85 1.0 86 1.0 87 1.0 88 1.0 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.95 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.841642228739 88.0 2 5.865102639296188 11.0 3 0.18661690215942417 0.525 4 0.07997867235403892 0.3 5 0.0 0.0 6 0.0 0.0 7 0.026659557451346308 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGGTAGGAATCTCGGTT 7 0.17500000000000002 TruSeq Adapter, Index 14 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.15 0.0 0.0 0.0 0.0 2 0.15 0.0 0.0 0.0 0.0 3 0.15 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10-11 0.175 0.0 0.0 0.0 0.0 12-13 0.175 0.0 0.0 0.0 0.0 14-15 0.2 0.0 0.0 0.0 0.0 16-17 0.2 0.0 0.0 0.0 0.0 18-19 0.2 0.0 0.0 0.0 0.0 20-21 0.2 0.0 0.0 0.0 0.0 22-23 0.2 0.0 0.0 0.0 0.0 24-25 0.2 0.0 0.0 0.0 0.0 26-27 0.2 0.0 0.0 0.0 0.0 28-29 0.2 0.0 0.0 0.0 0.0 30-31 0.2 0.0 0.0 0.0 0.0 32-33 0.225 0.0 0.0 0.0 0.0 34-35 0.225 0.0 0.0 0.0 0.0 36-37 0.225 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.2375 0.0 0.0 0.0 0.0 42-43 0.25 0.0 0.0 0.0 0.0 44-45 0.25 0.0 0.0 0.0 0.0 46-47 0.25 0.0 0.0 0.0 0.0 48-49 0.25 0.0 0.0 0.0 0.0 50-51 0.25 0.0 0.0 0.0 0.0125 52-53 0.25 0.0 0.0 0.0 0.025 54-55 0.25 0.0 0.0 0.0 0.025 56-57 0.25 0.0 0.0 0.0 0.025 58-59 0.25 0.0 0.0 0.0 0.025 60-61 0.25 0.0 0.0 0.0 0.025 62-63 0.25 0.0 0.0 0.0 0.025 64-65 0.25 0.0 0.0 0.0 0.025 66-67 0.275 0.0 0.0 0.0 0.025 68-69 0.2875 0.0 0.0 0.0 0.025 70-71 0.32499999999999996 0.0 0.0 0.0 0.025 72-73 0.3875 0.0 0.0 0.0 0.025 74-75 0.4625 0.0 0.0 0.0 0.025 76-77 0.575 0.0 0.0 0.0 0.025 78-79 0.7250000000000001 0.0 0.0 0.0 0.025 80-81 0.925 0.0 0.0 0.0 0.025 82-83 1.1124999999999998 0.0 0.0 0.0 0.025 84-85 1.2625000000000002 0.0 0.0 0.0 0.025 86-87 1.4625 0.0 0.0 0.0 0.025 88-89 1.6375000000000002 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11668431 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668431_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6455 37.0 37.0 37.0 37.0 37.0 2 35.498 37.0 37.0 37.0 37.0 37.0 3 35.7045 37.0 37.0 37.0 37.0 37.0 4 35.72 37.0 37.0 37.0 37.0 37.0 5 35.7495 37.0 37.0 37.0 37.0 37.0 6 35.8235 37.0 37.0 37.0 37.0 37.0 7 35.721 37.0 37.0 37.0 37.0 37.0 8 35.853 37.0 37.0 37.0 37.0 37.0 9 35.8205 37.0 37.0 37.0 37.0 37.0 10-11 35.81725 37.0 37.0 37.0 37.0 37.0 12-13 35.81975 37.0 37.0 37.0 37.0 37.0 14-15 35.84575 37.0 37.0 37.0 37.0 37.0 16-17 35.8835 37.0 37.0 37.0 37.0 37.0 18-19 35.801 37.0 37.0 37.0 37.0 37.0 20-21 35.791 37.0 37.0 37.0 37.0 37.0 22-23 35.588 37.0 37.0 37.0 37.0 37.0 24-25 35.768125 37.0 37.0 37.0 37.0 37.0 26-27 35.6325 37.0 37.0 37.0 37.0 37.0 28-29 35.7255 37.0 37.0 37.0 37.0 37.0 30-31 35.582499999999996 37.0 37.0 37.0 37.0 37.0 32-33 35.575874999999996 37.0 37.0 37.0 37.0 37.0 34-35 35.685500000000005 37.0 37.0 37.0 37.0 37.0 36-37 35.548125 37.0 37.0 37.0 37.0 37.0 38-39 35.587875 37.0 37.0 37.0 37.0 37.0 40-41 35.58275 37.0 37.0 37.0 37.0 37.0 42-43 35.665125 37.0 37.0 37.0 37.0 37.0 44-45 35.600750000000005 37.0 37.0 37.0 37.0 37.0 46-47 35.441500000000005 37.0 37.0 37.0 37.0 37.0 48-49 35.4315 37.0 37.0 37.0 37.0 37.0 50-51 35.586124999999996 37.0 37.0 37.0 37.0 37.0 52-53 35.5015 37.0 37.0 37.0 37.0 37.0 54-55 35.50925 37.0 37.0 37.0 37.0 37.0 56-57 35.445625 37.0 37.0 37.0 37.0 37.0 58-59 35.397625000000005 37.0 37.0 37.0 37.0 37.0 60-61 35.491375 37.0 37.0 37.0 37.0 37.0 62-63 35.563375 37.0 37.0 37.0 37.0 37.0 64-65 35.289125 37.0 37.0 37.0 37.0 37.0 66-67 35.56175 37.0 37.0 37.0 37.0 37.0 68-69 35.571749999999994 37.0 37.0 37.0 37.0 37.0 70-71 35.371624999999995 37.0 37.0 37.0 37.0 37.0 72-73 35.423 37.0 37.0 37.0 37.0 37.0 74-75 35.42275 37.0 37.0 37.0 37.0 37.0 76-77 35.437 37.0 37.0 37.0 37.0 37.0 78-79 35.4255 37.0 37.0 37.0 37.0 37.0 80-81 35.30175 37.0 37.0 37.0 37.0 37.0 82-83 35.51175 37.0 37.0 37.0 37.0 37.0 84-85 35.45375 37.0 37.0 37.0 37.0 37.0 86-87 35.3735 37.0 37.0 37.0 37.0 37.0 88-89 35.527249999999995 37.0 37.0 37.0 37.0 37.0 90-91 35.356750000000005 37.0 37.0 37.0 37.0 37.0 92-93 35.295249999999996 37.0 37.0 37.0 37.0 37.0 94-95 35.43325 37.0 37.0 37.0 37.0 37.0 96-97 35.37425 37.0 37.0 37.0 37.0 37.0 98-99 35.42475 37.0 37.0 37.0 37.0 37.0 100-101 35.1455 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 0.0 17 3.0 18 2.0 19 5.0 20 3.0 21 6.0 22 5.0 23 11.0 24 18.0 25 13.0 26 24.0 27 17.0 28 37.0 29 46.0 30 47.0 31 56.0 32 83.0 33 109.0 34 225.0 35 590.0 36 2275.0 37 423.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.0 18.05 12.575 39.375 2 32.975 23.25 25.074999999999996 18.7 3 24.075 26.400000000000002 22.725 26.8 4 29.45 29.9 16.650000000000002 24.0 5 30.425 30.625000000000004 17.025000000000002 21.925 6 23.150000000000002 35.949999999999996 17.5 23.400000000000002 7 25.1 16.575 33.0 25.324999999999996 8 25.174999999999997 20.175 23.125 31.525 9 25.775 19.975 24.925 29.325000000000003 10-11 28.999999999999996 25.7375 19.025 26.237500000000004 12-13 27.0125 20.9875 23.1375 28.8625 14-15 25.7625 23.7 23.8875 26.650000000000002 16-17 27.287499999999998 23.4625 22.375 26.875 18-19 26.775 23.962500000000002 23.0625 26.200000000000003 20-21 27.175 23.799999999999997 22.45 26.575 22-23 26.974999999999998 22.525000000000002 24.125 26.375 24-25 27.040880110013752 23.40292536567071 22.977872234029252 26.578322290286287 26-27 27.3875 23.9 21.462500000000002 27.250000000000004 28-29 28.0625 22.4375 22.900000000000002 26.6 30-31 27.800000000000004 23.575 22.7625 25.8625 32-33 28.053506688336043 23.44043005375672 22.215276909613703 26.290786348293537 34-35 29.1375 22.5 22.162499999999998 26.200000000000003 36-37 27.728466058257283 23.29041130141268 22.077759719964995 26.903362920365048 38-39 27.228403550443808 24.190523815476936 21.627703462932867 26.95336917114639 40-41 27.275 23.9 21.55 27.275 42-43 27.490936367045883 23.06538317289661 23.165395674459308 26.2782847855982 44-45 27.28182045511378 22.88072018004501 22.9057264316079 26.93173293323331 46-47 27.144286071517882 23.543385846461614 22.280570142535634 27.031757939484873 48-49 27.631907976994246 22.53063265816454 23.20580145036259 26.63165791447862 50-51 27.703462932866607 23.465433179147393 22.440305038129765 26.390798849856235 52-53 28.107026756689173 23.568392098024507 21.530382595648913 26.79419854963741 54-55 27.619404851212803 23.093273318329583 23.355838959739934 25.93148287071768 56-57 27.678459807475935 22.82785348168521 22.927865983247905 26.56582072759095 58-59 28.003500437554695 23.427928491061383 22.127765970746342 26.440805100637583 60-61 27.17839729966246 23.31541442680335 21.927740967620952 27.57844730591324 62-63 27.403425428178522 22.977872234029252 23.11538942367796 26.503312914114264 64-65 27.57844730591324 22.040255031878985 23.29041130141268 27.090886360795096 66-67 27.8625 22.6375 22.5125 26.987499999999997 68-69 27.85 22.4625 22.9625 26.724999999999998 70-71 27.590948868608578 22.927865983247905 22.10276284535567 27.378422302787847 72-73 27.2625 23.2375 22.95 26.55 74-75 26.974999999999998 23.775 22.6125 26.637499999999996 76-77 29.1125 22.3375 22.75 25.8 78-79 27.750000000000004 22.875 22.8 26.575 80-81 27.0875 23.9125 22.1875 26.8125 82-83 27.750000000000004 22.9375 22.525000000000002 26.787499999999998 84-85 27.450000000000003 23.775 22.787499999999998 25.9875 86-87 28.237499999999997 23.6125 22.037499999999998 26.1125 88-89 28.225 23.3 22.225 26.25 90-91 28.1 23.3125 22.3375 26.25 92-93 28.025 23.8125 21.762500000000003 26.400000000000002 94-95 28.712500000000002 23.05 22.825 25.412499999999998 96-97 27.85 23.3625 22.537499999999998 26.25 98-99 28.012500000000003 23.3 22.6125 26.075 100-101 29.3875 22.6375 22.0875 25.887500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 2.0 23 2.5 24 0.5 25 1.0 26 1.5 27 4.0 28 4.5 29 4.5 30 6.5 31 5.5 32 10.0 33 15.5 34 19.0 35 23.5 36 32.0 37 40.0 38 56.5 39 77.0 40 85.0 41 97.0 42 124.5 43 135.0 44 134.0 45 141.5 46 147.5 47 150.5 48 142.5 49 133.5 50 125.0 51 115.5 52 107.0 53 105.5 54 97.0 55 90.5 56 92.5 57 89.5 58 87.5 59 81.0 60 82.0 61 85.5 62 97.0 63 104.0 64 97.0 65 86.0 66 86.0 67 97.0 68 95.5 69 78.0 70 69.0 71 68.0 72 57.0 73 51.0 74 51.0 75 41.5 76 32.0 77 32.5 78 23.5 79 14.0 80 8.0 81 6.5 82 6.0 83 2.5 84 2.0 85 3.0 86 3.0 87 3.5 88 3.0 89 2.0 90 1.0 91 0.5 92 1.0 93 1.0 94 0.5 95 1.5 96 2.5 97 1.5 98 2.5 99 3.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0125 34-35 0.0 36-37 0.0125 38-39 0.0125 40-41 0.0 42-43 0.0125 44-45 0.025 46-47 0.025 48-49 0.025 50-51 0.0125 52-53 0.025 54-55 0.025 56-57 0.0125 58-59 0.0125 60-61 0.0125 62-63 0.0125 64-65 0.0125 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.19252187748609 88.8 2 5.595332802970034 10.549999999999999 3 0.18562715460090162 0.525 4 0.0 0.0 5 0.026518164942985947 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.15 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.15 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10-11 0.15 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.175 0.0 0.0 0.0 0.0 16-17 0.175 0.0 0.0 0.0 0.0 18-19 0.175 0.0 0.0 0.0 0.0 20-21 0.175 0.0 0.0 0.0 0.0 22-23 0.175 0.0 0.0 0.0 0.0 24-25 0.175 0.0 0.0 0.0 0.0 26-27 0.175 0.0 0.0 0.0 0.0 28-29 0.175 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.2 0.0 0.0 0.0 0.0 34-35 0.2 0.0 0.0 0.0 0.0 36-37 0.2 0.0 0.0 0.0 0.0 38-39 0.2 0.0 0.0 0.0 0.0 40-41 0.21250000000000002 0.0 0.0 0.0 0.0 42-43 0.225 0.0 0.0 0.0 0.0 44-45 0.225 0.0 0.0 0.0 0.0 46-47 0.225 0.0 0.0 0.0 0.0 48-49 0.225 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.225 0.0 0.0 0.0 0.0 56-57 0.225 0.0 0.0 0.0 0.0 58-59 0.225 0.0 0.0 0.0 0.0 60-61 0.2375 0.0 0.0 0.0 0.0 62-63 0.25 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.275 0.0 0.0 0.0 0.0 68-69 0.2875 0.0 0.0 0.0 0.0 70-71 0.32499999999999996 0.0 0.0 0.0 0.0 72-73 0.3875 0.0 0.0 0.0 0.0 74-75 0.4875 0.0 0.0 0.0 0.0 76-77 0.6000000000000001 0.0 0.0 0.0 0.0 78-79 0.7375 0.0 0.0 0.0 0.0 80-81 0.925 0.0 0.0 0.0 0.0 82-83 1.1124999999999998 0.0 0.0 0.0 0.0 84-85 1.2625000000000002 0.0 0.0 0.0 0.0 86-87 1.4625 0.0 0.0 0.0 0.0 88-89 1.6375000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCTCC 15 0.009957196 47.5 66-67 >>END_MODULE Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453596 spots for SRR11668431.sra Written 2453596 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra Read 2453582 spots for SRR11668431.sra Written 2453582 spots for SRR11668431.sra SRR ids: ['SRR11668431.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_co15gn26 SRR11668431.sra spots: 49071654 blocks: [[1, 2453582], [2453583, 4907164], [4907165, 7360746], [7360747, 9814328], [9814329, 12267910], [12267911, 14721492], [14721493, 17175074], [17175075, 19628656], [19628657, 22082238], [22082239, 24535820], [24535821, 26989402], [26989403, 29442984], [29442985, 31896566], [31896567, 34350148], [34350149, 36803730], [36803731, 39257312], [39257313, 41710894], [41710895, 44164476], [44164477, 46618058], [46618059, 49071654]] SRR11668431 file size 11862840 SRR11668431 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11668431 SRR11668431_1.fastq SRR11668431_2.fastq Input file: SRR11668431_1.fastq Paired file: SRR11668431_2.fastq trimmed: SRR11668431-trimmed-pair1.fastq, SRR11668431-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:45:08 2024 >> started Sat Dec 7 09:45:53 2024 >> done (44.179s) 49071654 read pairs processed; of these: 6776 ( 0.01%) short read pairs filtered out after trimming by size control 288116 ( 0.59%) empty read pairs filtered out after trimming by size control 48776762 (99.40%) read pairs available; of these: 2174073 ( 4.46%) trimmed read pairs available after processing 46602689 (95.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 206 0.00% 19 179 0.00% 20 168 0.00% 21 150 0.00% 22 173 0.00% 23 174 0.00% 24 145 0.00% 25 148 0.00% 26 162 0.00% 27 191 0.00% 28 224 0.00% 29 290 0.00% 30 283 0.00% 31 379 0.00% 32 418 0.00% 33 384 0.00% 34 408 0.00% 35 440 0.00% 36 638 0.00% 37 547 0.00% 38 574 0.00% 39 655 0.00% 40 783 0.00% 41 875 0.00% 42 935 0.00% 43 984 0.00% 44 919 0.00% 45 1019 0.00% 46 1203 0.00% 47 1412 0.00% 48 1536 0.00% 49 1850 0.00% 50 2073 0.00% 51 2230 0.00% 52 2444 0.01% 53 2669 0.01% 54 2746 0.01% 55 2948 0.01% 56 3213 0.01% 57 3781 0.01% 58 4258 0.01% 59 4680 0.01% 60 5414 0.01% 61 5994 0.01% 62 6582 0.01% 63 6925 0.01% 64 7709 0.02% 65 8455 0.02% 66 9184 0.02% 67 10669 0.02% 68 11193 0.02% 69 12213 0.03% 70 13705 0.03% 71 15194 0.03% 72 16988 0.03% 73 18735 0.04% 74 20946 0.04% 75 23071 0.05% 76 25179 0.05% 77 27160 0.06% 78 29396 0.06% 79 32151 0.07% 80 35320 0.07% 81 38349 0.08% 82 43170 0.09% 83 46903 0.10% 84 51601 0.11% 85 56667 0.12% 86 60692 0.12% 87 65572 0.13% 88 70570 0.14% 89 74964 0.15% 90 79493 0.16% 91 86954 0.18% 92 93209 0.19% 93 100014 0.21% 94 109558 0.22% 95 116287 0.24% 96 123317 0.25% 97 131539 0.27% 98 138094 0.28% 99 143151 0.29% 100 152292 0.31% 101 46602689 95.54% 48776762 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=21 prefix-density=0.29 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=25 fanout-score=173.68 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=20.2 sequence=GGCGGCGGCGGCC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=6.17 fanout-score-rank=12 prefix-density=0.39 prefix-fanout=4.5 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.13 sequence-density-rank=23 fanout-score=259.23 fanout-score-rank=1 prefix-density=1.47 prefix-fanout=23.1 sequence=GCCGCCGCCGCG SRR11668431 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:46:24 Started mapping on | Dec 07 09:46:24 Finished on | Dec 07 09:48:35 Mapping speed, Million of reads per hour | 1340.43 Number of input reads | 48776762 Average input read length | 200 UNIQUE READS: Uniquely mapped reads number | 46804883 Uniquely mapped reads % | 95.96% Average mapped length | 200.24 Number of splices: Total | 27658132 Number of splices: Annotated (sjdb) | 26169487 Number of splices: GT/AG | 27276947 Number of splices: GC/AG | 317510 Number of splices: AT/AC | 15776 Number of splices: Non-canonical | 47899 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.10 Insertion rate per base | 0.01% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1001565 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 67424 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.21% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 970314 970314 970314 N_multimapping 1001565 1001565 1001565 N_noFeature 1239818 45605819 1707313 N_ambiguous 916992 6842 197612 UnstrandedReadsAssigned:44648073 PositiveStrandReadsAssigned:1192222 NegativeStrandReadsAssigned:44899958 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR11668431 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11668431-trimmed-pair1.fastq SRR11668431-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 48,776,762 reads, 45,783,008 reads pseudoaligned [quant] estimated average fragment length: 204.845 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52973 SRR11668431.ke.tsv 35125 SRR11668431.se.tsv 88098 total ==> SRR11668431.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.347 0 0 PNS24247 1044 840.155 59.0322 2.17105 PNS24249 1928 1724.16 481.749 8.63348 PNS24246 1044 840.155 59.0322 2.17105 PNS24248 1044 840.155 59.0322 2.17105 PNS24244 1471 1267.16 158.154 3.85649 PNS24243 293 122.306 0 0 KQK14069 1603 1399.16 5243.48 115.796 KQK14071 474 277.883 445.779 49.5677 ==> SRR11668431.se.tsv <== BRADI_1g14170v3 6055 BRADI_1g53295v3 88 BRADI_1g59795v3 925 BRADI_1g07683v3 0 BRADI_1g00485v3 124 BRADI_1g20270v3 8080 BRADI_1g74790v3 286 BRADI_1g09890v3 42 BRADI_1g77505v3 612 BRADI_1g48960v3 0 SRR11668431 completed mapping pipeline successfully