Starting /dee2/code/volunteer_pipeline.sh SRR11668432 current disk space = 1544134762496 free memory = 1601389468 SRR11668432 SRAfilesize 4df755cdcfbcfa327b1e41a5f65ceb7e SRR11668432.sra SRR11668432.sra file validated SRR11668432 is paired end SRR11668432 is conventional basespace SRR11668432 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668432_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1625 32.0 32.0 32.0 32.0 32.0 2 31.4625 32.0 32.0 32.0 32.0 32.0 3 34.64125 37.0 32.0 37.0 32.0 37.0 4 35.45875 37.0 37.0 37.0 32.0 37.0 5 36.07875 37.0 37.0 37.0 32.0 37.0 6 39.14825 41.0 41.0 41.0 37.0 41.0 7 39.4595 41.0 41.0 41.0 37.0 41.0 8 39.7585 41.0 41.0 41.0 37.0 41.0 9 39.87975 41.0 41.0 41.0 37.0 41.0 10-11 39.85724999999999 41.0 41.0 41.0 37.0 41.0 12-13 39.475125 41.0 41.0 41.0 37.0 41.0 14-15 39.448125000000005 41.0 41.0 41.0 37.0 41.0 16-17 39.450874999999996 41.0 41.0 41.0 37.0 41.0 18-19 39.5255 41.0 41.0 41.0 37.0 41.0 20-21 39.571125 41.0 41.0 41.0 37.0 41.0 22-23 39.580875000000006 41.0 41.0 41.0 37.0 41.0 24-25 39.508625 41.0 41.0 41.0 37.0 41.0 26-27 39.337125 41.0 41.0 41.0 37.0 41.0 28-29 39.341 41.0 41.0 41.0 37.0 41.0 30-31 39.38525 41.0 41.0 41.0 37.0 41.0 32-33 38.952875 41.0 41.0 41.0 34.5 41.0 34-35 39.040875 41.0 41.0 41.0 37.0 41.0 36-37 39.0025 41.0 41.0 41.0 37.0 41.0 38-39 39.009 41.0 41.0 41.0 37.0 41.0 40-41 38.887375 41.0 41.0 41.0 34.5 41.0 42-43 38.535125 41.0 39.0 41.0 32.0 41.0 44-45 38.69125 41.0 39.0 41.0 32.0 41.0 46-47 38.876875 41.0 41.0 41.0 34.5 41.0 48-49 38.704375 41.0 41.0 41.0 32.0 41.0 50-51 38.649249999999995 41.0 41.0 41.0 32.0 41.0 52-53 38.1575 41.0 37.0 41.0 32.0 41.0 54-55 38.1165 41.0 37.0 41.0 32.0 41.0 56-57 38.073 41.0 37.0 41.0 29.5 41.0 58-59 38.045125 41.0 37.0 41.0 32.0 41.0 60-61 37.95325 41.0 37.0 41.0 32.0 41.0 62-63 37.500375 41.0 37.0 41.0 27.0 41.0 64-65 37.561625 41.0 37.0 41.0 27.0 41.0 66-67 37.79875 41.0 37.0 41.0 29.5 41.0 68-69 37.62875 41.0 37.0 41.0 29.5 41.0 70-71 37.498875 41.0 37.0 41.0 27.0 41.0 72-73 37.485 41.0 37.0 41.0 27.0 41.0 74-75 36.830875 41.0 37.0 41.0 27.0 41.0 76-77 36.068749999999994 39.0 34.5 41.0 24.5 41.0 78-79 36.8685 41.0 37.0 41.0 27.0 41.0 80-81 37.586625 41.0 37.0 41.0 29.5 41.0 82-83 37.535375 41.0 37.0 41.0 27.0 41.0 84-85 37.5245 41.0 37.0 41.0 27.0 41.0 86-87 37.51375 41.0 37.0 41.0 27.0 41.0 88-89 37.184625 41.0 37.0 41.0 27.0 41.0 90-91 36.922125 41.0 37.0 41.0 27.0 41.0 92-93 36.627250000000004 41.0 37.0 41.0 22.0 41.0 94-95 37.03725 41.0 37.0 41.0 27.0 41.0 96-97 36.51775 41.0 37.0 41.0 22.0 41.0 98-99 36.50575 41.0 37.0 41.0 22.0 41.0 100 35.073 41.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 1.0 22 3.0 23 5.0 24 5.0 25 17.0 26 15.0 27 17.0 28 36.0 29 49.0 30 63.0 31 69.0 32 80.0 33 107.0 34 123.0 35 161.0 36 246.0 37 314.0 38 512.0 39 825.0 40 1349.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.75194576952046 10.871202611097162 11.423550087873462 41.95330153150891 2 31.275 11.15 28.725 28.849999999999998 3 29.049999999999997 15.8 21.325 33.825 4 32.425 17.875 18.7 31.0 5 32.7 22.375 20.95 23.974999999999998 6 26.275 25.775 23.825 24.125 7 19.3 26.85 33.275 20.575 8 21.8 23.775 28.349999999999998 26.075 9 23.175 20.599999999999998 30.225 26.0 10-11 25.112499999999997 26.237500000000004 23.9 24.75 12-13 25.5375 21.8125 25.025 27.625 14-15 25.424999999999997 23.6625 24.925 25.9875 16-17 25.587500000000002 23.6875 23.849999999999998 26.875 18-19 25.362499999999997 23.5 24.3625 26.775 20-21 25.2875 23.5375 24.125 27.05 22-23 25.587500000000002 24.7 23.1875 26.525 24-25 25.640705088136016 23.540442555319416 23.85298162270284 26.96587073384173 26-27 25.025 23.325000000000003 24.0375 27.6125 28-29 25.1875 23.75 24.175 26.887499999999996 30-31 25.650000000000002 24.0375 23.8125 26.5 32-33 26.2625 23.962500000000002 23.2875 26.487500000000004 34-35 25.15 23.175 24.775 26.900000000000002 36-37 24.825 23.0125 24.099999999999998 28.0625 38-39 27.450000000000003 23.425 22.650000000000002 26.474999999999998 40-41 25.9625 24.0125 23.0375 26.987499999999997 42-43 25.025 23.75 24.1125 27.1125 44-45 25.825 22.95 23.9875 27.237499999999997 46-47 26.150000000000002 22.6125 23.3625 27.875 48-49 25.53191489361702 23.11639549436796 24.09261576971214 27.25907384230288 50-51 26.900000000000002 22.975 23.325000000000003 26.8 52-53 25.7125 23.9125 22.85 27.525 54-55 26.525 23.7125 23.3875 26.375 56-57 26.1125 23.0875 23.599999999999998 27.200000000000003 58-59 26.325 22.8375 22.3875 28.449999999999996 60-61 25.525 22.9375 23.2375 28.299999999999997 62-63 26.2875 23.575 23.95 26.187500000000004 64-65 26.0625 23.4625 23.275000000000002 27.200000000000003 66-67 25.924999999999997 23.200000000000003 23.5125 27.3625 68-69 26.25 23.45 23.5 26.8 70-71 26.0125 24.224999999999998 23.7875 25.974999999999998 72-73 26.075 23.225 23.5 27.200000000000003 74-75 26.56641604010025 23.734335839598998 23.42105263157895 26.278195488721806 76-77 27.05 23.8625 22.662499999999998 26.424999999999997 78-79 25.41990473802958 23.89069942341439 23.90323389320632 26.78616194534971 80-81 26.437500000000004 23.7625 23.075000000000003 26.724999999999998 82-83 26.85 23.3625 23.275000000000002 26.5125 84-85 26.687499999999996 23.5875 22.225 27.500000000000004 86-87 26.275 22.7125 24.3 26.7125 88-89 26.3625 22.975 23.2125 27.450000000000003 90-91 25.8625 23.375 23.474999999999998 27.287499999999998 92-93 27.2625 23.599999999999998 22.95 26.187500000000004 94-95 26.937499999999996 24.0375 22.162499999999998 26.8625 96-97 26.424999999999997 23.925 23.075000000000003 26.575 98-99 26.125 23.7875 23.75 26.337500000000002 100 26.150000000000002 24.125 23.425 26.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.5 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.5 24 1.0 25 0.0 26 0.5 27 2.5 28 3.5 29 4.0 30 5.0 31 9.5 32 16.5 33 22.0 34 21.5 35 24.5 36 40.5 37 49.5 38 66.0 39 78.5 40 85.0 41 99.0 42 123.5 43 139.5 44 139.5 45 148.5 46 149.0 47 155.0 48 169.0 49 163.5 50 135.5 51 121.0 52 114.0 53 94.5 54 90.5 55 93.0 56 91.5 57 91.5 58 88.0 59 81.5 60 76.0 61 87.0 62 90.5 63 85.0 64 83.5 65 86.0 66 80.5 67 67.5 68 72.5 69 66.5 70 66.0 71 73.5 72 68.0 73 55.5 74 43.5 75 44.0 76 35.0 77 23.0 78 19.0 79 15.5 80 10.5 81 5.0 82 6.5 83 6.0 84 2.5 85 1.5 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.125 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.25 76-77 0.0 78-79 0.27499999999999997 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4952818158633 96.55 2 1.4027033919918388 2.75 3 0.0510073960724305 0.15 4 0.0 0.0 5 0.0 0.0 6 0.02550369803621525 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02550369803621525 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCTGACCATCTCGTAT 16 0.4 TruSeq Adapter, Index 15 (97% over 37bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.125 0.0 0.0 0.0 0.0 88 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11668432 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668432_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.63375 32.0 32.0 32.0 27.0 32.0 2 30.7925 32.0 32.0 32.0 32.0 32.0 3 33.125 37.0 32.0 37.0 22.0 37.0 4 33.8125 37.0 32.0 37.0 22.0 37.0 5 34.7675 37.0 37.0 37.0 32.0 37.0 6 37.6195 41.0 37.0 41.0 32.0 41.0 7 37.84225 41.0 37.0 41.0 27.0 41.0 8 37.72125 41.0 37.0 41.0 32.0 41.0 9 37.49375 41.0 37.0 41.0 27.0 41.0 10-11 37.368 41.0 37.0 41.0 27.0 41.0 12-13 37.432125 41.0 37.0 41.0 27.0 41.0 14-15 37.3985 41.0 37.0 41.0 27.0 41.0 16-17 37.341625 41.0 37.0 41.0 27.0 41.0 18-19 37.32525 41.0 37.0 41.0 27.0 41.0 20-21 37.328125 41.0 37.0 41.0 27.0 41.0 22-23 37.09075 41.0 37.0 41.0 27.0 41.0 24-25 37.332499999999996 41.0 37.0 41.0 27.0 41.0 26-27 36.880125 41.0 37.0 41.0 24.5 41.0 28-29 37.12225 41.0 37.0 41.0 27.0 41.0 30-31 36.66325 41.0 37.0 41.0 27.0 41.0 32-33 36.620625000000004 41.0 37.0 41.0 24.5 41.0 34-35 36.457875 41.0 37.0 41.0 24.5 41.0 36-37 36.45425 41.0 37.0 41.0 24.5 41.0 38-39 36.216125000000005 41.0 37.0 41.0 22.0 41.0 40-41 36.06375 41.0 37.0 41.0 22.0 41.0 42-43 36.323750000000004 41.0 37.0 41.0 22.0 41.0 44-45 36.088125000000005 41.0 34.5 41.0 22.0 41.0 46-47 36.171125 41.0 37.0 41.0 22.0 41.0 48-49 35.573 41.0 32.0 41.0 22.0 41.0 50-51 35.732625 41.0 34.5 41.0 22.0 41.0 52-53 35.856 41.0 37.0 41.0 22.0 41.0 54-55 35.830749999999995 41.0 32.0 41.0 22.0 41.0 56-57 35.7125 41.0 34.5 41.0 22.0 41.0 58-59 34.93025 41.0 32.0 41.0 17.0 41.0 60-61 35.049875 41.0 32.0 41.0 17.0 41.0 62-63 34.992374999999996 41.0 32.0 41.0 22.0 41.0 64-65 35.32225 41.0 32.0 41.0 22.0 41.0 66-67 34.872125 41.0 32.0 41.0 22.0 41.0 68-69 34.7385 41.0 32.0 41.0 17.0 41.0 70-71 35.0255 41.0 32.0 41.0 22.0 41.0 72-73 34.106375 41.0 29.5 41.0 12.0 41.0 74-75 34.197874999999996 41.0 32.0 41.0 12.0 41.0 76-77 34.070750000000004 39.0 32.0 41.0 22.0 41.0 78-79 34.786 39.0 32.0 41.0 22.0 41.0 80-81 35.457125000000005 41.0 32.0 41.0 22.0 41.0 82-83 34.94125 41.0 32.0 41.0 17.0 41.0 84-85 35.04225 41.0 32.0 41.0 22.0 41.0 86-87 35.2575 41.0 32.0 41.0 22.0 41.0 88-89 34.570375 39.0 32.0 41.0 12.0 41.0 90-91 33.92675 37.0 32.0 41.0 12.0 41.0 92-93 34.603750000000005 37.0 32.0 41.0 22.0 41.0 94-95 34.092125 37.0 32.0 41.0 12.0 41.0 96-97 34.112125 37.0 29.5 41.0 12.0 41.0 98-99 34.462374999999994 37.0 32.0 41.0 17.0 41.0 100 32.1225 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 3.0 16 9.0 17 19.0 18 20.0 19 25.0 20 29.0 21 45.0 22 34.0 23 56.0 24 53.0 25 51.0 26 59.0 27 97.0 28 75.0 29 79.0 30 88.0 31 100.0 32 140.0 33 130.0 34 177.0 35 195.0 36 241.0 37 313.0 38 444.0 39 724.0 40 792.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.77458093570178 18.914185639229423 11.508631473605204 36.8026019514636 2 30.64032016008004 25.71285642821411 23.861930965482742 19.78489244622311 3 24.224999999999998 27.224999999999998 22.0 26.55 4 28.375 29.5 17.775 24.349999999999998 5 30.2 31.374999999999996 17.724999999999998 20.7 6 24.7 34.8 17.849999999999998 22.650000000000002 7 24.099999999999998 18.5 31.65 25.75 8 25.4 21.275 23.05 30.275000000000002 9 25.650000000000002 20.4 25.35 28.599999999999998 10-11 26.987499999999997 26.875 19.675 26.4625 12-13 27.575 21.475 22.3625 28.5875 14-15 25.5625 24.025 23.775 26.637499999999996 16-17 27.125 23.4625 21.6875 27.725 18-19 26.7625 24.2 22.725 26.3125 20-21 27.0125 24.4 22.1375 26.450000000000003 22-23 27.474999999999998 23.325000000000003 21.825 27.375 24-25 27.250000000000004 24.05 21.75 26.950000000000003 26-27 26.8125 24.087500000000002 21.875 27.224999999999998 28-29 27.325 23.75 21.6875 27.237499999999997 30-31 26.650000000000002 23.35 23.35 26.650000000000002 32-33 26.9625 23.7625 22.575 26.700000000000003 34-35 27.212500000000002 24.075 21.912499999999998 26.8 36-37 27.462500000000002 23.7125 21.7375 27.0875 38-39 26.737499999999997 23.974999999999998 22.237499999999997 27.05 40-41 27.462500000000002 23.7875 22.0625 26.687499999999996 42-43 27.0875 23.2375 22.925 26.75 44-45 26.575 23.5375 22.662499999999998 27.224999999999998 46-47 27.625 23.3875 21.2625 27.725 48-49 27.700000000000003 22.9625 21.4875 27.85 50-51 27.48874437218609 23.011505752876438 22.336168084042022 27.163581790895446 52-53 27.900000000000002 23.425 22.1375 26.5375 54-55 27.224999999999998 23.962500000000002 22.3875 26.424999999999997 56-57 26.625 23.2375 22.2625 27.875 58-59 27.3375 22.787499999999998 21.912499999999998 27.962500000000002 60-61 26.900000000000002 24.2375 20.3625 28.499999999999996 62-63 27.150000000000002 23.65 22.325 26.875 64-65 27.666499749624435 23.97346019028543 21.807711567351028 26.552328492739107 66-67 26.5125 23.8125 22.675 27.0 68-69 26.875 23.825 22.45 26.85 70-71 27.800000000000004 23.2125 21.725 27.2625 72-73 26.6125 23.9125 22.5125 26.9625 74-75 27.1375 23.825 22.6875 26.35 76-77 27.750000000000004 23.9875 22.2125 26.05 78-79 27.700000000000003 22.8625 22.1875 27.250000000000004 80-81 27.712500000000002 23.4375 21.4875 27.3625 82-83 27.400000000000002 23.8125 21.6625 27.125 84-85 27.287499999999998 23.7625 22.0875 26.8625 86-87 28.037499999999998 23.35 21.275 27.3375 88-89 27.55 23.3125 22.1375 27.0 90-91 27.740240240240237 23.273273273273272 22.71021021021021 26.276276276276278 92-93 26.5125 24.6 22.1 26.787499999999998 94-95 28.249999999999996 23.825 21.0 26.924999999999997 96-97 27.6625 24.1125 21.7 26.525 98-99 27.212500000000002 25.112499999999997 21.675 26.0 100 29.325000000000003 23.625 20.724999999999998 26.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 2.0 24 1.5 25 1.5 26 2.5 27 2.0 28 6.0 29 7.0 30 6.0 31 11.0 32 16.0 33 15.5 34 14.5 35 22.0 36 34.0 37 48.5 38 62.0 39 75.0 40 90.0 41 112.5 42 125.5 43 124.0 44 135.0 45 143.0 46 130.0 47 127.0 48 134.0 49 133.0 50 116.0 51 106.5 52 103.0 53 91.5 54 86.5 55 85.0 56 92.0 57 91.5 58 94.5 59 103.5 60 95.5 61 91.0 62 97.5 63 96.0 64 90.5 65 78.0 66 78.0 67 93.0 68 92.0 69 85.5 70 85.0 71 79.5 72 64.0 73 59.0 74 53.5 75 42.5 76 38.5 77 27.5 78 22.5 79 19.5 80 14.0 81 14.0 82 9.5 83 4.0 84 1.5 85 2.5 86 4.0 87 2.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.05 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.15 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.1 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62455425369333 96.8 2 1.248089658685685 2.45 3 0.05094243504839531 0.15 4 0.05094243504839531 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025471217524197655 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAAGTCGAGGTGTAGATCT 16 0.4 Illumina Single End PCR Primer 1 (96% over 33bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.6499999999999999 0.0 0.0 0.0 0.0 84-85 0.875 0.0 0.0 0.0 0.0 86-87 1.1125 0.0 0.0 0.0 0.0 88 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188542 spots for SRR11668432.sra Written 1188542 spots for SRR11668432.sra Read 1188553 spots for SRR11668432.sra Written 1188553 spots for SRR11668432.sra SRR ids: ['SRR11668432.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6g1nh5xr SRR11668432.sra spots: 23770851 blocks: [[1, 1188542], [1188543, 2377084], [2377085, 3565626], [3565627, 4754168], [4754169, 5942710], [5942711, 7131252], [7131253, 8319794], [8319795, 9508336], [9508337, 10696878], [10696879, 11885420], [11885421, 13073962], [13073963, 14262504], [14262505, 15451046], [15451047, 16639588], [16639589, 17828130], [17828131, 19016672], [19016673, 20205214], [20205215, 21393756], [21393757, 22582298], [22582299, 23770851]] SRR11668432 file size 5688875 SRR11668432 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11668432 SRR11668432_1.fastq SRR11668432_2.fastq Input file: SRR11668432_1.fastq Paired file: SRR11668432_2.fastq trimmed: SRR11668432-trimmed-pair1.fastq, SRR11668432-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:43:56 2024 >> started Sat Dec 7 09:44:29 2024 >> done (33.394s) 23770851 read pairs processed; of these: 2771 ( 0.01%) short read pairs filtered out after trimming by size control 153716 ( 0.65%) empty read pairs filtered out after trimming by size control 23614364 (99.34%) read pairs available; of these: 1825521 ( 7.73%) trimmed read pairs available after processing 21788843 (92.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 80 0.00% 19 74 0.00% 20 55 0.00% 21 56 0.00% 22 65 0.00% 23 57 0.00% 24 70 0.00% 25 81 0.00% 26 81 0.00% 27 67 0.00% 28 71 0.00% 29 121 0.00% 30 92 0.00% 31 104 0.00% 32 112 0.00% 33 129 0.00% 34 122 0.00% 35 142 0.00% 36 128 0.00% 37 150 0.00% 38 188 0.00% 39 170 0.00% 40 244 0.00% 41 261 0.00% 42 295 0.00% 43 264 0.00% 44 288 0.00% 45 307 0.00% 46 334 0.00% 47 369 0.00% 48 388 0.00% 49 477 0.00% 50 539 0.00% 51 649 0.00% 52 721 0.00% 53 736 0.00% 54 793 0.00% 55 872 0.00% 56 945 0.00% 57 1077 0.00% 58 1267 0.01% 59 1462 0.01% 60 1606 0.01% 61 1862 0.01% 62 2034 0.01% 63 2285 0.01% 64 2603 0.01% 65 2709 0.01% 66 3116 0.01% 67 3710 0.02% 68 3661 0.02% 69 4190 0.02% 70 4795 0.02% 71 5216 0.02% 72 5777 0.02% 73 6632 0.03% 74 7525 0.03% 75 8514 0.04% 76 9198 0.04% 77 10197 0.04% 78 11138 0.05% 79 12207 0.05% 80 13225 0.06% 81 14730 0.06% 82 16343 0.07% 83 18152 0.08% 84 19756 0.08% 85 21941 0.09% 86 24467 0.10% 87 26122 0.11% 88 28644 0.12% 89 30534 0.13% 90 32612 0.14% 91 35436 0.15% 92 38460 0.16% 93 40467 0.17% 94 44398 0.19% 95 48291 0.20% 96 52357 0.22% 97 60510 0.26% 98 124785 0.53% 99 1010813 4.28% 100 21788843 92.27% 23614364 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=15 prefix-density=0.33 prefix-fanout=3.0 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=148.86 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=17.9 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=22 prefix-density=0.30 prefix-fanout=2.6 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.13 sequence-density-rank=26 fanout-score=245.08 fanout-score-rank=1 prefix-density=1.32 prefix-fanout=23.4 sequence=CCGCCGCCGCCA SRR11668432 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:45:17 Started mapping on | Dec 07 09:45:17 Finished on | Dec 07 09:46:39 Mapping speed, Million of reads per hour | 1036.73 Number of input reads | 23614364 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 22147463 Uniquely mapped reads % | 93.79% Average mapped length | 197.98 Number of splices: Total | 13181570 Number of splices: Annotated (sjdb) | 12444324 Number of splices: GT/AG | 13007164 Number of splices: GC/AG | 146150 Number of splices: AT/AC | 5695 Number of splices: Non-canonical | 22561 Mismatch rate per base, % | 0.59% Deletion rate per base | 0.01% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 747097 % of reads mapped to multiple loci | 3.16% Number of reads mapped to too many loci | 24547 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.27% % of reads unmapped: other | 0.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 719804 719804 719804 N_multimapping 747097 747097 747097 N_noFeature 621912 21543683 854153 N_ambiguous 482317 3048 116722 UnstrandedReadsAssigned:21043234 PositiveStrandReadsAssigned:600732 NegativeStrandReadsAssigned:21176588 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR11668432 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11668432-trimmed-pair1.fastq SRR11668432-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,614,364 reads, 22,088,379 reads pseudoaligned [quant] estimated average fragment length: 208.913 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52973 SRR11668432.ke.tsv 35125 SRR11668432.se.tsv 88098 total ==> SRR11668432.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 728.361 0 0 PNS24247 1044 836.087 45.5905 3.47934 PNS24249 1928 1720.09 215.352 7.98865 PNS24246 1044 836.087 45.5905 3.47934 PNS24248 1044 836.087 45.5905 3.47934 PNS24244 1471 1263.09 24.8765 1.2567 PNS24243 293 118.688 0 0 KQK14069 1603 1395.09 5879.59 268.918 KQK14071 474 273.545 425.883 99.3426 ==> SRR11668432.se.tsv <== BRADI_1g14170v3 6770 BRADI_1g53295v3 44 BRADI_1g59795v3 286 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 1912 BRADI_1g74790v3 115 BRADI_1g09890v3 15 BRADI_1g77505v3 314 BRADI_1g48960v3 0 SRR11668432 completed mapping pipeline successfully