Starting /dee2/code/volunteer_pipeline.sh SRR11668433 current disk space = 1544121466880 free memory = 1601209596 SRR11668433 SRAfilesize ea228734e97437676e2da7a91924e1ea SRR11668433.sra SRR11668433.sra file validated SRR11668433 is paired end SRR11668433 is conventional basespace SRR11668433 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668433_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.09375 32.0 32.0 32.0 32.0 32.0 2 31.52625 32.0 32.0 32.0 32.0 32.0 3 34.45125 37.0 32.0 37.0 32.0 37.0 4 35.41 37.0 37.0 37.0 32.0 37.0 5 36.1325 37.0 37.0 37.0 37.0 37.0 6 38.989 41.0 41.0 41.0 32.0 41.0 7 39.452 41.0 41.0 41.0 37.0 41.0 8 39.798 41.0 41.0 41.0 37.0 41.0 9 39.92225 41.0 41.0 41.0 37.0 41.0 10-11 40.01775 41.0 41.0 41.0 37.0 41.0 12-13 39.658 41.0 41.0 41.0 37.0 41.0 14-15 39.64425 41.0 41.0 41.0 37.0 41.0 16-17 39.479375000000005 41.0 41.0 41.0 37.0 41.0 18-19 39.6485 41.0 41.0 41.0 37.0 41.0 20-21 39.727625 41.0 41.0 41.0 37.0 41.0 22-23 39.75575 41.0 41.0 41.0 37.0 41.0 24-25 39.592749999999995 41.0 41.0 41.0 37.0 41.0 26-27 39.412875 41.0 41.0 41.0 37.0 41.0 28-29 39.455625 41.0 41.0 41.0 37.0 41.0 30-31 39.45975 41.0 41.0 41.0 37.0 41.0 32-33 39.006249999999994 41.0 41.0 41.0 37.0 41.0 34-35 39.213875 41.0 41.0 41.0 37.0 41.0 36-37 39.151624999999996 41.0 41.0 41.0 37.0 41.0 38-39 39.169375 41.0 41.0 41.0 37.0 41.0 40-41 39.166624999999996 41.0 41.0 41.0 37.0 41.0 42-43 38.65712499999999 41.0 41.0 41.0 32.0 41.0 44-45 38.873875 41.0 41.0 41.0 34.5 41.0 46-47 39.1135 41.0 41.0 41.0 37.0 41.0 48-49 38.929125 41.0 41.0 41.0 37.0 41.0 50-51 38.914375 41.0 41.0 41.0 34.5 41.0 52-53 38.32475 41.0 37.0 41.0 32.0 41.0 54-55 38.384375 41.0 39.0 41.0 32.0 41.0 56-57 38.2205 41.0 37.0 41.0 32.0 41.0 58-59 38.285250000000005 41.0 37.0 41.0 32.0 41.0 60-61 38.184124999999995 41.0 37.0 41.0 32.0 41.0 62-63 37.815 41.0 37.0 41.0 29.5 41.0 64-65 38.036 41.0 37.0 41.0 32.0 41.0 66-67 38.12325 41.0 37.0 41.0 32.0 41.0 68-69 38.029875000000004 41.0 37.0 41.0 32.0 41.0 70-71 37.700500000000005 41.0 37.0 41.0 27.0 41.0 72-73 37.65 41.0 37.0 41.0 27.0 41.0 74-75 37.025875 41.0 37.0 41.0 27.0 41.0 76-77 36.5315 39.0 34.5 41.0 27.0 41.0 78-79 36.9055 41.0 37.0 41.0 27.0 41.0 80-81 37.69175 41.0 37.0 41.0 27.0 41.0 82-83 37.568250000000006 41.0 37.0 41.0 27.0 41.0 84-85 37.5945 41.0 37.0 41.0 27.0 41.0 86-87 37.568875000000006 41.0 37.0 41.0 27.0 41.0 88-89 37.0635 41.0 37.0 41.0 27.0 41.0 90-91 36.906000000000006 41.0 37.0 41.0 24.5 41.0 92-93 36.739875 41.0 37.0 41.0 24.5 41.0 94-95 37.012625 41.0 37.0 41.0 27.0 41.0 96-97 36.618125000000006 41.0 37.0 41.0 22.0 41.0 98-99 36.42 41.0 37.0 41.0 22.0 41.0 100 35.22075 41.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 1.0 24 6.0 25 13.0 26 14.0 27 19.0 28 31.0 29 35.0 30 63.0 31 62.0 32 80.0 33 87.0 34 138.0 35 166.0 36 229.0 37 290.0 38 503.0 39 921.0 40 1340.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.87782805429865 10.35696329813977 14.504776269482154 38.260432378079436 2 30.825000000000003 12.0 25.674999999999997 31.5 3 27.700000000000003 17.275 21.775 33.25 4 32.175 19.25 18.725 29.849999999999998 5 33.2 21.825 20.45 24.525 6 27.900000000000002 26.75 23.200000000000003 22.15 7 19.275000000000002 26.55 32.6 21.575 8 20.599999999999998 25.15 27.400000000000002 26.85 9 24.75 20.3 29.875 25.074999999999996 10-11 25.1 28.3625 22.625 23.9125 12-13 25.5625 22.9375 23.875 27.625 14-15 24.675 23.962500000000002 24.675 26.687499999999996 16-17 26.375 23.1125 23.4125 27.1 18-19 25.0125 24.099999999999998 24.7 26.187500000000004 20-21 25.8625 23.6875 23.4875 26.9625 22-23 24.75 24.9 23.400000000000002 26.950000000000003 24-25 25.6064016004001 23.69342335583896 23.768442110527634 26.93173293323331 26-27 24.637500000000003 24.325 22.475 28.5625 28-29 26.437500000000004 23.7625 23.400000000000002 26.400000000000002 30-31 25.137500000000003 23.3 24.575 26.987499999999997 32-33 25.275 24.224999999999998 23.0 27.500000000000004 34-35 24.2625 23.7625 25.124999999999996 26.85 36-37 25.650000000000002 24.525 23.875 25.95 38-39 26.174999999999997 23.575 23.5625 26.687499999999996 40-41 25.087500000000002 24.887500000000003 23.375 26.650000000000002 42-43 24.587500000000002 24.15 24.887500000000003 26.375 44-45 23.9875 23.25 24.087500000000002 28.675 46-47 25.624999999999996 23.4125 23.6375 27.325 48-49 23.950895653263185 24.163848177376927 24.940498559438808 26.944757609921083 50-51 26.1125 22.400000000000002 24.7875 26.700000000000003 52-53 25.362499999999997 22.6375 23.625 28.375 54-55 25.900000000000002 22.8 24.4875 26.8125 56-57 25.9625 22.35 24.6625 27.025 58-59 26.0 22.55 24.5375 26.9125 60-61 25.825 23.200000000000003 24.575 26.400000000000002 62-63 25.8 23.1625 23.825 27.212500000000002 64-65 25.887500000000003 23.325000000000003 24.125 26.6625 66-67 25.95 25.1 22.875 26.075 68-69 24.65 25.5125 23.1 26.737499999999997 70-71 25.2875 24.962500000000002 23.1875 26.5625 72-73 26.700000000000003 24.5125 22.7125 26.075 74-75 25.633626097867 23.902132998745294 24.303638644918443 26.16060225846926 76-77 25.5125 24.0625 23.150000000000002 27.275 78-79 26.20481927710843 23.970883534136547 23.01706827309237 26.80722891566265 80-81 25.900000000000002 25.324999999999996 23.7125 25.0625 82-83 25.9625 24.637500000000003 22.825 26.575 84-85 25.924999999999997 24.775 22.85 26.450000000000003 86-87 25.8125 24.325 23.0125 26.85 88-89 26.400000000000002 24.7 21.825 27.075 90-91 25.775 24.375 23.3625 26.487500000000004 92-93 26.887499999999996 24.575 22.925 25.6125 94-95 26.7625 24.825 22.8 25.6125 96-97 25.637500000000003 24.0375 22.95 27.375 98-99 25.974999999999998 23.9875 23.175 26.8625 100 24.975 25.05 22.625 27.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 1.5 24 0.0 25 1.0 26 1.0 27 1.5 28 3.0 29 2.5 30 4.0 31 9.0 32 9.5 33 13.0 34 30.0 35 37.5 36 43.0 37 56.5 38 78.0 39 99.5 40 101.5 41 110.5 42 136.5 43 154.5 44 153.5 45 147.5 46 155.5 47 166.5 48 160.0 49 146.0 50 139.0 51 131.0 52 107.5 53 89.0 54 91.0 55 90.0 56 77.0 57 84.5 58 91.5 59 75.5 60 68.5 61 73.0 62 83.5 63 78.0 64 77.0 65 79.5 66 69.5 67 75.0 68 82.0 69 76.0 70 68.0 71 55.5 72 45.5 73 47.5 74 43.5 75 38.0 76 33.0 77 29.0 78 23.0 79 17.0 80 12.5 81 7.0 82 6.5 83 5.5 84 2.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.025 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.21250000000000002 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.375 76-77 0.0 78-79 0.4 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.10325390725083 96.7 2 0.7942608250064053 1.55 3 0.07686395080707148 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025621316935690495 1.525 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTAGGACATCTCGTAT 61 1.525 TruSeq Adapter, Index 22 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.1375 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.35 0.0 0.0 0.0 0.0 72-73 0.4 0.0 0.0 0.0 0.0 74-75 0.4125 0.0 0.0 0.0 0.0 76-77 0.4875 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.6125 0.0 0.0 0.0 0.0 82-83 0.7250000000000001 0.0 0.0 0.0 0.0 84-85 0.925 0.0 0.0 0.0 0.0 86-87 1.15 0.0 0.0 0.0 0.0 88 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11668433 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11668433_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.915 32.0 32.0 32.0 32.0 32.0 2 31.01 32.0 32.0 32.0 32.0 32.0 3 33.5825 37.0 32.0 37.0 32.0 37.0 4 34.27 37.0 37.0 37.0 27.0 37.0 5 35.075 37.0 37.0 37.0 32.0 37.0 6 38.28375 41.0 37.0 41.0 32.0 41.0 7 38.2465 41.0 37.0 41.0 32.0 41.0 8 37.99075 41.0 37.0 41.0 32.0 41.0 9 37.9365 41.0 37.0 41.0 32.0 41.0 10-11 37.746875 41.0 37.0 41.0 29.5 41.0 12-13 37.9785 41.0 37.0 41.0 29.5 41.0 14-15 37.9045 41.0 37.0 41.0 29.5 41.0 16-17 37.792249999999996 41.0 37.0 41.0 27.0 41.0 18-19 37.744749999999996 41.0 37.0 41.0 27.0 41.0 20-21 37.749375 41.0 37.0 41.0 29.5 41.0 22-23 37.621125 41.0 37.0 41.0 27.0 41.0 24-25 37.856750000000005 41.0 37.0 41.0 27.0 41.0 26-27 37.426249999999996 41.0 37.0 41.0 27.0 41.0 28-29 37.526375 41.0 37.0 41.0 27.0 41.0 30-31 37.092375000000004 41.0 37.0 41.0 27.0 41.0 32-33 37.15537500000001 41.0 37.0 41.0 27.0 41.0 34-35 36.982 41.0 37.0 41.0 24.5 41.0 36-37 36.958875 41.0 37.0 41.0 27.0 41.0 38-39 36.77275 41.0 37.0 41.0 24.5 41.0 40-41 36.6665 41.0 37.0 41.0 24.5 41.0 42-43 36.627875 41.0 37.0 41.0 22.0 41.0 44-45 36.518 41.0 37.0 41.0 24.5 41.0 46-47 36.5845 41.0 37.0 41.0 22.0 41.0 48-49 36.153999999999996 41.0 37.0 41.0 22.0 41.0 50-51 36.300375 41.0 37.0 41.0 22.0 41.0 52-53 36.408249999999995 41.0 37.0 41.0 22.0 41.0 54-55 36.116 41.0 37.0 41.0 22.0 41.0 56-57 35.93675 41.0 37.0 41.0 22.0 41.0 58-59 35.300875000000005 41.0 32.0 41.0 22.0 41.0 60-61 35.157250000000005 41.0 32.0 41.0 17.0 41.0 62-63 35.320875 41.0 32.0 41.0 22.0 41.0 64-65 35.688625 41.0 34.5 41.0 22.0 41.0 66-67 35.1995 41.0 32.0 41.0 22.0 41.0 68-69 35.22725 41.0 32.0 41.0 22.0 41.0 70-71 35.501375 41.0 32.0 41.0 22.0 41.0 72-73 34.7175 41.0 32.0 41.0 12.0 41.0 74-75 34.918 41.0 32.0 41.0 22.0 41.0 76-77 34.480625 39.0 32.0 41.0 22.0 41.0 78-79 35.093125 41.0 32.0 41.0 22.0 41.0 80-81 35.773125 41.0 32.0 41.0 22.0 41.0 82-83 35.1055 41.0 32.0 41.0 22.0 41.0 84-85 35.166875000000005 41.0 32.0 41.0 22.0 41.0 86-87 35.2335 41.0 32.0 41.0 22.0 41.0 88-89 34.6755 39.0 32.0 41.0 17.0 41.0 90-91 34.1685 37.0 32.0 41.0 12.0 41.0 92-93 34.6195 39.0 32.0 41.0 17.0 41.0 94-95 34.06175 37.0 32.0 41.0 12.0 41.0 96-97 34.300625 37.0 32.0 41.0 17.0 41.0 98-99 34.764250000000004 39.0 32.0 41.0 22.0 41.0 100 32.824 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 6.0 16 6.0 17 6.0 18 16.0 19 24.0 20 26.0 21 26.0 22 31.0 23 45.0 24 48.0 25 47.0 26 66.0 27 69.0 28 54.0 29 73.0 30 99.0 31 94.0 32 126.0 33 146.0 34 182.0 35 202.0 36 269.0 37 309.0 38 467.0 39 730.0 40 831.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.32040050062578 18.74843554443054 11.46433041301627 33.46683354192741 2 30.307576894223555 24.10602650662666 24.55613903475869 21.030257564391096 3 26.200000000000003 25.5 24.099999999999998 24.2 4 29.175 28.349999999999998 17.974999999999998 24.5 5 31.025000000000002 29.549999999999997 18.0 21.425 6 26.275 33.375 18.4 21.95 7 23.974999999999998 19.875 30.9 25.25 8 23.45 23.200000000000003 23.0 30.349999999999998 9 26.575 21.6 23.375 28.449999999999996 10-11 27.8375 26.75 19.375 26.0375 12-13 28.799999999999997 20.424999999999997 22.1875 28.5875 14-15 25.637500000000003 23.9375 23.25 27.175 16-17 27.1 22.925 23.3125 26.6625 18-19 26.75 23.549999999999997 23.5125 26.187500000000004 20-21 26.9625 24.3 22.400000000000002 26.337500000000002 22-23 28.675 24.1125 21.7 25.5125 24-25 26.237500000000004 24.8625 21.912499999999998 26.987499999999997 26-27 26.9125 25.35 21.175 26.5625 28-29 28.012500000000003 24.6125 21.9375 25.4375 30-31 26.825 22.55 23.4625 27.1625 32-33 26.5125 23.125 22.6375 27.725 34-35 27.0875 25.374999999999996 22.125 25.412499999999998 36-37 27.737499999999997 23.4875 22.7375 26.0375 38-39 27.35 25.624999999999996 21.099999999999998 25.924999999999997 40-41 28.962500000000002 22.9375 22.287499999999998 25.8125 42-43 27.462500000000002 22.75 23.1625 26.625 44-45 25.525 24.837500000000002 23.799999999999997 25.837500000000002 46-47 27.5625 24.0125 21.775 26.650000000000002 48-49 25.887500000000003 23.474999999999998 23.150000000000002 27.487499999999997 50-51 27.11906848629022 23.150118943282834 23.337924126705897 26.392888443721045 52-53 28.125 22.400000000000002 22.162499999999998 27.3125 54-55 27.187499999999996 23.05 23.0 26.7625 56-57 27.3875 23.7375 23.3875 25.4875 58-59 27.4125 23.674999999999997 21.462500000000002 27.450000000000003 60-61 26.7625 23.075000000000003 22.475 27.6875 62-63 27.1375 22.8125 23.525 26.525 64-65 27.27842547323555 24.119343111445403 22.79052275291463 25.811708662404413 66-67 27.037499999999998 23.625 22.0875 27.250000000000004 68-69 26.4625 23.7125 23.2125 26.6125 70-71 25.825 25.6125 22.4375 26.125 72-73 26.6 24.975 22.6125 25.8125 74-75 26.487500000000004 25.3125 22.112499999999997 26.087500000000002 76-77 26.1125 24.95 21.8 27.1375 78-79 26.737499999999997 24.2875 22.125 26.85 80-81 26.8125 24.825 22.7125 25.650000000000002 82-83 28.625 24.4875 20.9 25.9875 84-85 26.0 24.9125 22.475 26.6125 86-87 26.275 25.224999999999998 22.475 26.025 88-89 27.525 24.3125 22.425 25.7375 90-91 27.467434869739478 24.787074148296593 21.317635270541082 26.427855711422843 92-93 27.5125 24.55 21.7875 26.150000000000002 94-95 27.528441055131893 24.090511313914238 22.377797224653083 26.003250406300786 96-97 26.303287910988875 24.990623827978496 22.540317539692463 26.16577072134017 98-99 27.6 26.187500000000004 21.1125 25.1 100 27.325 25.924999999999997 21.025 25.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.5 26 2.5 27 2.5 28 3.0 29 5.0 30 8.0 31 9.0 32 12.0 33 15.5 34 18.5 35 28.0 36 46.5 37 54.5 38 62.5 39 89.5 40 104.0 41 107.0 42 121.0 43 142.5 44 158.5 45 164.5 46 149.0 47 140.5 48 142.5 49 128.0 50 113.5 51 109.5 52 96.5 53 86.0 54 86.0 55 87.0 56 92.0 57 79.0 58 78.5 59 96.5 60 95.0 61 84.0 62 87.0 63 84.5 64 78.5 65 80.0 66 86.0 67 83.0 68 82.0 69 76.0 70 75.5 71 72.5 72 62.0 73 64.0 74 49.5 75 39.0 76 37.0 77 33.0 78 23.5 79 18.0 80 17.0 81 12.5 82 7.0 83 2.5 84 2.0 85 2.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.1625 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.2875 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.2 92-93 0.0 94-95 0.0125 96-97 0.0125 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.94628630172193 96.25 2 0.9766126959650475 1.9 3 0.05140066820868672 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02570033410434336 1.7000000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCAGTGAAGGTGTAGATCT 68 1.7000000000000002 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.1375 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.35 0.0 0.0 0.0 0.0 72-73 0.425 0.0 0.0 0.0 0.0 74-75 0.4375 0.0 0.0 0.0 0.0 76-77 0.5125 0.0 0.0 0.0 0.0 78-79 0.6125 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.75 0.0 0.0 0.0 0.0 84-85 0.9375 0.0 0.0 0.0 0.0 86-87 1.1625 0.0 0.0 0.0 0.0 88 1.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Read 1601005 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Written 1601005 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra Read 1600997 spots for SRR11668433.sra Written 1600997 spots for SRR11668433.sra SRR ids: ['SRR11668433.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_imai3e8j SRR11668433.sra spots: 32019948 blocks: [[1, 1600997], [1600998, 3201994], [3201995, 4802991], [4802992, 6403988], [6403989, 8004985], [8004986, 9605982], [9605983, 11206979], [11206980, 12807976], [12807977, 14408973], [14408974, 16009970], [16009971, 17610967], [17610968, 19211964], [19211965, 20812961], [20812962, 22413958], [22413959, 24014955], [24014956, 25615952], [25615953, 27216949], [27216950, 28817946], [28817947, 30418943], [30418944, 32019948]] SRR11668433 file size 7670591 SRR11668433 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11668433 SRR11668433_1.fastq SRR11668433_2.fastq Input file: SRR11668433_1.fastq Paired file: SRR11668433_2.fastq trimmed: SRR11668433-trimmed-pair1.fastq, SRR11668433-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:45:38 2024 >> started Sat Dec 7 09:46:07 2024 >> done (28.266s) 32019948 read pairs processed; of these: 2811 ( 0.01%) short read pairs filtered out after trimming by size control 563448 ( 1.76%) empty read pairs filtered out after trimming by size control 31453689 (98.23%) read pairs available; of these: 2420360 ( 7.69%) trimmed read pairs available after processing 29033329 (92.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 52 0.00% 19 56 0.00% 20 47 0.00% 21 65 0.00% 22 51 0.00% 23 62 0.00% 24 81 0.00% 25 70 0.00% 26 69 0.00% 27 91 0.00% 28 79 0.00% 29 97 0.00% 30 106 0.00% 31 144 0.00% 32 141 0.00% 33 159 0.00% 34 176 0.00% 35 175 0.00% 36 212 0.00% 37 221 0.00% 38 234 0.00% 39 321 0.00% 40 358 0.00% 41 433 0.00% 42 433 0.00% 43 458 0.00% 44 476 0.00% 45 514 0.00% 46 535 0.00% 47 697 0.00% 48 757 0.00% 49 926 0.00% 50 1094 0.00% 51 1164 0.00% 52 1231 0.00% 53 1333 0.00% 54 1472 0.00% 55 1535 0.00% 56 1690 0.01% 57 1903 0.01% 58 2111 0.01% 59 2486 0.01% 60 2904 0.01% 61 3088 0.01% 62 3541 0.01% 63 3854 0.01% 64 4080 0.01% 65 4628 0.01% 66 4974 0.02% 67 6225 0.02% 68 5955 0.02% 69 6657 0.02% 70 7180 0.02% 71 8144 0.03% 72 9165 0.03% 73 10224 0.03% 74 11356 0.04% 75 12736 0.04% 76 14039 0.04% 77 15129 0.05% 78 16482 0.05% 79 17650 0.06% 80 19365 0.06% 81 21231 0.07% 82 23412 0.07% 83 26119 0.08% 84 28811 0.09% 85 32158 0.10% 86 35022 0.11% 87 37682 0.12% 88 40620 0.13% 89 43118 0.14% 90 46350 0.15% 91 49530 0.16% 92 53353 0.17% 93 57498 0.18% 94 61472 0.20% 95 67403 0.21% 96 72533 0.23% 97 82728 0.26% 98 159256 0.51% 99 1270373 4.04% 100 29033329 92.31% 31453689 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=16 prefix-density=0.29 prefix-fanout=3.0 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTA criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=158.17 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=18.3 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=25 prefix-density=0.28 prefix-fanout=2.6 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=30 fanout-score=267.96 fanout-score-rank=1 prefix-density=1.45 prefix-fanout=20.5 sequence=GCCGCCGCCGCG SRR11668433 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:46:40 Started mapping on | Dec 07 09:46:41 Finished on | Dec 07 09:48:38 Mapping speed, Million of reads per hour | 967.81 Number of input reads | 31453689 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 29747066 Uniquely mapped reads % | 94.57% Average mapped length | 197.98 Number of splices: Total | 17744186 Number of splices: Annotated (sjdb) | 16749927 Number of splices: GT/AG | 17508437 Number of splices: GC/AG | 197036 Number of splices: AT/AC | 8149 Number of splices: Non-canonical | 30564 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.01% Deletion average length | 1.98 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 859950 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 22922 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.17% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 846673 846673 846673 N_multimapping 859950 859950 859950 N_noFeature 849843 28948301 1157133 N_ambiguous 626975 3914 142481 UnstrandedReadsAssigned:28270248 PositiveStrandReadsAssigned:794851 NegativeStrandReadsAssigned:28447452 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR11668433 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11668433-trimmed-pair1.fastq SRR11668433-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,453,689 reads, 29,516,235 reads pseudoaligned [quant] estimated average fragment length: 202.57 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,227 rounds 52973 SRR11668433.ke.tsv 35125 SRR11668433.se.tsv 88098 total ==> SRR11668433.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 734.712 0 0 PNS24247 1044 842.43 57.3934 3.26532 PNS24249 1928 1726.43 354.563 9.84335 PNS24246 1044 842.43 57.3934 3.26532 PNS24248 1044 842.43 57.3934 3.26532 PNS24244 1471 1269.43 67.2569 2.53937 PNS24243 293 118.413 0 0 KQK14069 1603 1401.43 7892.79 269.934 KQK14071 474 277.947 574.522 99.0702 ==> SRR11668433.se.tsv <== BRADI_1g14170v3 9204 BRADI_1g53295v3 50 BRADI_1g59795v3 379 BRADI_1g07683v3 0 BRADI_1g00485v3 63 BRADI_1g20270v3 2572 BRADI_1g74790v3 144 BRADI_1g09890v3 15 BRADI_1g77505v3 491 BRADI_1g48960v3 0 SRR11668433 completed mapping pipeline successfully